• 沒有找到結果。

Paxillin Predicts Survival and Relapse in Non-Small Cell Lung Cancer by MicroRNA-218 Targeting.

N/A
N/A
Protected

Academic year: 2021

Share "Paxillin Predicts Survival and Relapse in Non-Small Cell Lung Cancer by MicroRNA-218 Targeting."

Copied!
11
0
0

加載中.... (立即查看全文)

全文

(1)

2010;70:10392-10401. Published online December 14, 2010.

Cancer Res

De-Wei Wu, Ya-Wen Cheng, John Wang, et al.

Lung Cancer by MicroRNA-218 Targeting

Small Cell

Paxillin Predicts Survival and Relapse in Non

Updated Version

10.1158/0008-5472.CAN-10-2341

doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2010/12/13/70.24.10392.DC1.html

Access the most recent supplemental material at:

Cited Articles

http://cancerres.aacrjournals.org/content/70/24/10392.full.html#ref-list-1

This article cites 46 articles, 18 of which you can access for free at:

E-mail alerts

Sign up to receive free email-alerts

related to this article or journal.

Subscriptions

Reprints and

.

[email protected]

Publications Department at

To order reprints of this article or to subscribe to the journal, contact the AACR

Permissions

.

[email protected]

Department at

(2)

Tumor and Stem Cell Biology

Paxillin Predicts Survival and Relapse in Non

–Small Cell Lung

Cancer by MicroRNA-218 Targeting

De-Wei Wu1, Ya-Wen Cheng2, John Wang3, Chih-Yi Chen4, and Huei Lee1,2,5,6

Abstract

Paxillin (PXN) gene mutations are associated with lung adenocarcinoma progression and PXN is known to be a target gene of microRNA-218 (miR-218). On this basis, we hypothesized that PXN overexpression via miR-218 suppression may promote tumor progression and metastasis and that PXN may predict survival and relapse in non–small cell lung cancer (NSCLC). Expression of miR-218 and PXN in 124 surgically resected lung tumors were evaluated by real-time PCR and immunohistochemical analysis. The prognostic value of miR-218 and PXN expression on overall survival (OS) and relapse-free survival (RFS) was analyzed by the Kaplan–Meier test and Cox regression analysis. miR-218 expression in lung tumors was negatively associated with PXN expression. Multivariate analyses showed that PXN and miR-218 might independently predict OS and RFS, respectively, in NSCLC. Moreover, patients with low miR-218 combined with PXN-positive had the worst OS and RFS among the 4 combinations. In a cell model, PXN was negatively regulated by miR-218 and cell proliferation, invasion, and soft agar colony formation were enhanced by PXN overexpression induced by miR-218 suppression. Taken together, our findings suggest that PXN overexpression induced by miR-218 suppression is an independent predictor of survival and relapse in NSCLC, highlighting PXN as a potential therapeutic target to improve clinical

outcomes in this disease.Cancer Res; 70(24); 10392–401. 2010 AACR.

Introduction

Lung cancer is the leading cause of cancer deaths in industrial countries, with only 15% of all affected individuals surviving more than 5 years from the time of diagnosis (1). Tumor migration and metastasis are the key causes of death in patients with poor prognosis (2). However, the molecular pathogenesis of this disease remains largely unclear.

The focal adhesion protein paxillin (PXN), a target of several genes, is involved in signal transduction and is important for cell mobility and migration. An early study showed that PXN might suppress lung tumor progression (3). Recently, about 10% of PXN mutations were found in lung tumors from Caucasians and African-Americans but not from Taiwanese patients (4). The authors further showed that mutated PXN

might act as an oncogene that enhances cell proliferation in vitro and causes xenograft tumors in vivo. Interestingly, PXN overexpression has been observed in lung cancer cells and tumor tissues (4). In human cervical cancer tissues, human papillomavirus (HPV) 18-immortalized genital epithelial cells, and high-grade dysplastic and invasive cervical carcinomas, PXN overexpression may be associated with cervical tumor metastasis (5). However, the underlying mechanism of PXN overexpression involved in human tumorigenesis is not yet known.

MicroRNAs (miRNAs) are small noncoding RNAs that serve as negative regulators of gene expression (6–8). By integration

with the 30-untranslated region (30-UTR) of mRNA, via partial

sequence homology, miRNAs cause gene silencing either by mRNA degradation or by repression of translation (9). Some reports have indicated that miRNAs are key players in the regulation of tumor proliferation and cell invasion (10–12). The suppression of miR-218 has been shown in lung tumors (13). Recent report indicated that miR-218 expression was decreased in primary normal bronchial epithelial (NHBE) cells after exposure to cigarette smoke condensates and 1 of the 85 genes known to be targeted by miR-218 is PXN (14). In addition, miR-218 also seems to function as a tumor suppressor to inhibit cancer cell proliferation and invasion (15, 16). These observations prompt us to assume that PXN expression is regulated by miR-218 expression and that PXN overexpression may participate in lung tumor progression and metastasis.

In this study, 124 lung tumors surgically resected from lung cancer patients were evaluated for PXN and miR-218 expression by immunohistochemical analysis and real-time Authors' Affiliations:1

Institute of Medical and Molecular Toxicology, 2

Institute of Medicine, Chung Shan Medical University, Taichung, Taiwan, ROC;3

Department of Pathology, Taichung Veterans General Hospital, Taiwan, ROC;4

Department of Surgery, China Medical University Hospital, Taiwan, ROC;5

Division of Environmental Health and Occupational Med-icine, National Health Research Institute, Miaoli, Taiwan, ROC; and 6

Department of Medical Research, Chung Shan Medical University Hos-pital, Taichung, Taiwan, ROC

Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Corresponding Author: Huei Lee, Institute of Medicine, Chung Shan Medical University, No. 110, Sec. 1, Chien-Kuo N. Rd., 104 Taichung, Taiwan, ROC. Phone: 886-4-24759400; Fax: 886-4-24720407; E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-10-2341

2010 American Association for Cancer Research.

Cancer

Research

Cancer Res; 70(24) December 15, 2010 10392

on December 19, 2010

cancerres.aacrjournals.org

(3)

PCR, and the prognostic value of PXN and miR-218 expression was evaluated with respect to overall survival (OS) and relapse-free survival (RFS). Data were statistically analyzed by Kaplan–Meier and multivariate Cox regression analyses. We further examined the cell proliferation rate, efficacy of colony formation, invasion, and soft agar colony formation to verify whether PXN upregulation induced by miR-218 suppres-sion could predict a poor clinical outcome resulting from enhanced tumor growth and metastasis.

Materials and Methods

Study subjects and cell lines

Lung tumor specimens were collected from 124 patients with primary lung cancer at the Department of Thoracic Surgery, Taichung Veterans General Hospital, between 1998 and 2004. The patients were requested to submit a written informed consent form approved by the institutional review board. The tumor type and stage of each collected specimen were histolo-gically determined according to the World Health Organization's (WHO) classification system. Forty female (32.2%), 84 males (67.8%), 66 nonsmokers (53.2%), 58 smokers (46.8%), 53 patients with adenocarcinoma (42.7%), 71 patients with squamous cell carcinoma (57.3%), 50 patients with stage I (40.3%), 25 patients with stage II (20.2%), and 49 patients with stage III (39.5%) were enrolled in this study (Supplementary Table 1).

Cell lines

A549, H1299, Ch27, H460, Calu-1, H661, SiHa, and C33A cells were obtained from the American Type Culture Collection (ATCC) and cultured as described. CL1-0 and CL1-5 cells were kindly provided by Dr. P.-C. Yang (Department of Internal Medicine, National Taiwan University Hospital). TL-1, TL-2, and TL-4 were kindly provided by Dr. Y.-W. Cheng (Institute of Medicine, Chung Shan Medical University; refs. 17, 18). Cells were cultured and stored according to the suppliers’ instruc-tions and used at passages 5 to 20. Once resuscitated, cell lines were routinely authenticated (once every 6 months, cells were last tested in December 2009) through cell morphology mon-itoring, growth curve analysis, species verification by isoen-zymology and karyotyping, identity verification using short tandem repeat profiling analysis, and contamination checks. Real-time quantitative RT-PCR analysis of miR-218 and PXN mRNA expression levels

DNase I–treated total RNA (10 ng) was subjected to

miRNA RT-PCR analysis with the TaqMan miRNA Reverse Transcription Kit (Applied Biosystems), miRNA Assays (Applied Biosystems), and a Real-Time Thermocycler 7500 (Applied Biosystems). RNU6B was used as the small RNA reference housekeeping gene. For PXN and SLIT2 mRNA expression, the primers used for RT-PCR analysis are described in Supplementary Table 2. Reverse transcription reaction and real-time quantitative PCR were done as described previously (17). The miR-218 and PXN mRNA levels in lung tumors that were higher than the median value were defined as "high," whereas levels lower than the median value were defined as "low."

Immunohistochemical analysis

Antimouse PXN antibodies were purchased from Neomar-kers. The immunohistochemical procedures and quantifica-tion methods were as described previously (18). In lung tumors, immunostaining was defined as "positive" if PXN immunoreactivity was observed in 10% or more of the cells in paraffin sections; tumors with lower percentages of immu-noreactive cells showed "negative" immunostaining. miR-218 precursor and inhibitor transfection

Cells were grown to confluence in 6-well plates. miR-218

precursor (Pre-miR-218, 20–40 nmol/L/well; (Ambion),

miR-218 inhibitor (40–80 nmol/L/well; (Ambion), and negative control (Ambion) cells were transfected using Lipofectamine 2000 transfection reagent (Invitrogen) according to the man-ufacturer's protocol. Transfection efficiency was evaluated by real-time PCR.

Luciferase reporter assay

Double-stranded oligonucleotides corresponding to the

wild-type (WT 30-UTR) or mutant (Mut 30-UTR) miR-218

binding site in the 30-UTR of PXN were synthesized and ligated

between the SpeI and HindIII restriction sites of pmiR-REPORT miRNA Expression Reporter Vector (Ambion). The oligonucleotides used are described in Supplementary Table 2. Cells were transfected with appropriate plasmid and Pre-miR-218. Luciferase assays were done using the luciferase reporter assay system (Promega) 48 hours after transfection. Normal-ized luciferase activity was reported as luciferase activity/ b-galactosidase activity.

Plasmid construction

Detailed plasmids are presented in the Supplementary Methods section.

HPV16 E6 siRNA transfection assays

The RNA interference target sequences for HPV16 E6 siRNA (E6si) have been previously verified (19, 20). The procedures and methods were as described previously (17, 18).

Western blotting assay

For immunoblotting of PXN, b-actin, and HPV16 E6 cell

lysates were prepared as described above (18). Doubling time and soft agar assays

The procedures and methods of doubling time and soft agar assays were as described previously (17, 18).

Colony formation assay

For the colony formation assay, 200 transfected cells were plated in a 6-well plate for 10 days. Colonies were fixed with methanol/acetone (1:1) and stained with crystal violet (1 mg/mL).

Invasion assay

These assays were done according to a previously reported method (21).

(4)

Statistical analysis

Statistical analysis was conducted using the SPSS statistical software program (Version 15.0; SPSS Inc.). The association between miR-218 expression and PXN protein expression was

analyzed by thec2test. Survival plots were generated using the

Kaplan–Meier method, and differences between patient

groups were determined by the log-rank test. Multivariate Cox regression analysis was conducted to determine OS and RFS. The analysis was stratified for all known variables (age, gender, smoking status, tumor type, and tumor stage) and protein expression.

Results

PXN expression in lung tumors is correlated with miR-218

To understand whether PXN expression in lung tumors is associated with miR-218 expression, the expression of miR-218,

PXN mRNA, and protein were evaluated by real-time PCR and immunohistochemical analysis. Representative PXN protein expression in the lung tumors is shown in Figure 1A, which shows that PXN was predominantly expressed in the cytoplasm of the tumor cells and that some PXN protein was found in the nucleus of the tumor cells. In this studied population, the prevalence of PXN mRNA and protein expression in lung tumors was positively correlated with tumor stage; namely, the high or positive expression of PXN mRNA and protein was more prevalent in stage III patients than in stage I and II patients (PXN mRNA, P ¼ 0.022; PXN protein, P ¼ 0.035; Table 1). In contrast, the high expression of miR-218 in stage III patients was marginally lower than that in stage I and II patients (P ¼ 0.055; Table 1). The expression of PXN mRNA and protein in lung tumors was negatively correlated with miR-218 expression (PXN mRNA, P ¼ 0.012; PXN protein, P ¼ 0.031; Table 1). These results suggest that PXN expression in lung tumors is negatively associated with miR-218 expression. PXN positive

A

B

1.0 Ov er all sur viv al Relapse-free sur viv al Relapse-free sur viv al 0.8 0.6 0.4 0.2 0.0 0 25 50 75 100 125 1.0 Ov er all sur viv al 0.8 0.6 0.4 0.2 0.0 0 25 50 75 Months miR-218 High (62) miR-218 Low (62) PXN protein – (58) PXN protein + (66) 100 125 1.0 0.8 0.6 0.4 P = 0.014 P < 0.001 P < 0.001 P = 0.011 0.2 0.0 0 25 50 75 100 125 1.0 0.8 0.6 0.4 0.2 0.0 0 25 50 75 Months miR-218 High (49) miR-218 Low (54) PXN protein – (48) PXN protein + (55) 100 125 PXN negative

Figure 1.When miR-218 expression was low and PXN expression was high, the clinical outcome in lung cancer patients was poor. A, representative immunostained images showing high PXN expression (left) and low PXN expression. B, OS and RFS curves for all studied patients with high or low miR-218 expression (top) and high or low PXN expression (bottom).

Wu et al.

Cancer Res; 70(24) December 15, 2010 Cancer Research 10394

on December 19, 2010

cancerres.aacrjournals.org

(5)

PXN and miR-218 are associated with OS and RFS in lung cancer

We hypothesized that PXN overexpression in lung tumors due to miR-218 suppression could contribute to tumor pro-gression and metastasis. Therefore, we expected that PXN and miR-218 expression would be associated with OS and RFS in lung cancer. Of the 124 patients enrolled, 103 were available for RFS analysis, with a median number of follow-up months of 26.0. In the RFS analysis group, the condition relapsed in 41 patients (5, local recurrence; 27, distant metastasis; 9, local recurrence and distant metastasis) and 32 patients died from the disease. No patients received adjuvant treatment before surgical therapy. Kaplan–Meier analysis showed that patients with low miR-218 expression had shorter median months of OS and RFS than did patients with high miR-218 expression (26.0 months vs. 33.9 months, P ¼ 0.014 for OS; 19.3 months vs. 35.4 months, P ¼ 0.011 for RFS; Fig. 1B). In addition, we observed that PXN-positive patients had shorter median months of OS and RFS than did PXN-negative patients (23.2 months vs. 38.4 months, P <0.001 for OS; 14.7 months vs. 36.4 months, P <0.001 for RFS; Fig. 1B). As expected, the median months of OS and RFS were significantly higher for stage I patients than for stage II or III patients (35.8 months for stage I vs. 30.6 months for stage II vs. 17.1 months for stage III, P <0.001 for OS; 33.8

months for stage I vs. 26.5 months for stage II vs. 12.1 months for stage III, P <0.001 for RFS; Supplementary Table 3). Inter-estingly, in this studied population, patients with adenocarci-nomas had shorter median months of OS and RFS than did those with squamous cell carcinomas (22.0 months vs. 40.4 months, P ¼ 0.002 for OS; 18.9 months vs. 30.6 months, P ¼ 0.007 for RFS; Supplementary Table 3). Multivariate analysis conducted after the parameters of age, gender, smoking, tumor type, and tumor stage were adjusted, showed that the hazard ratios (HR) for OS and RFS in patients with low miR-218 were 1.67 (OS) and 2.08 (RFS) times those of patients with high

miR-218, respectively (95% CI¼ 1.03–2.70, P ¼ 0.036 for OS; 95% CI

¼ 1.23–3.50, P ¼ 0.006 for RFS; Table 2).

As expected, patients with PXN-positive expression had HRs that were 2.62 (OS) and 2.28 (RFS) times those of patients

with PXN-negative expression (95% CI¼ 1.58–4.37, P < 0.001

for OS; 95% CI ¼ 1.37–3.77, P ¼ 0.001 for RFS; Table 2).

Moreover, patients with low miR-218 and PXN-positive expression had the worst OS and RFS among the 4 possible

combinations (HR¼ 3.94, 95% CI ¼ 1.93–8.02, P < 0.001 for OS;

HR ¼ 3.84, 95% CI ¼ 1.93–7.67 for RFS, P<0.001; Table 2).

These results suggest that suppression of miR-218 may induce PXN overexpression to promote tumor malignancy in patients and lead to poor OS and RFS.

Table 1. The correlation between clinical parameters with miR-218 and PXN expressions and correlation between miR-218 and the expression of PXN mRNA and protein

miR-218 PXN mRNA PXN protein

No Low High P Low High P Negative Positive P Age <68 59 29 30 0.857 31 28 0.590 28 31 0.884 368 65 33 32 31 34 30 35 Gender Female 40 22 18 0.442 18 22 0.442 14 26 0.070 Male 84 40 44 44 40 44 40 Smoking status Nonsmokers 66 32 34 0.719 30 36 0.280 26 40 0.079 Smokers 58 30 28 32 26 32 26 Tumor type ADC 53 31 22 0.102 22 31 0.102 18 35 0.013 SCC 71 31 40 40 31 40 31 Stage I 50 24 26 0.055 30 20 0.022 27 23 0.035 II 25 8 17 15 10 15 10 III 49 30 19 17 32 16 33 miR-218 Low 62 24 38 0.012 23 39 0.031 High 62 38 24 35 27 PXN mRNA Low 62 39 23 <0.001 High 62 19 43

(6)

PXN transcription is modulated by miR-218 in lung cancer cells

To explore whether PXN expression is negatively associated with miR-218 expression in lung cancer cells, 11 lung cancer cell lines and 2 cervical cancer cells lines were used to evaluate PXN and miR-218 expression by real-time PCR. The expression levels of PXN mRNA in all of these cell lines were inversely correlated with the miR-218 expression levels (Fig. 2A). To verify whether PXN mRNA expression was modulated by miR-218, CL1-5 and TL-1 cells, which have high levels of PXN mRNA, were treated with a miR-218 precursor. In addition, CL1-0 and TL-4 cells, which have low levels of PXN mRNA, were treated with an miR-218 inhibitor. After confirming the expression of mature miR-218 in treatment cells evaluated by real-time PCR (Fig. 2B), we found that the PXN mRNA levels in the CL1-5 and TL-1 cells were reduced by the miR-218 precursor in a dose-dependent manner whereas the levels in the CL1-0 and TL-4 cells were markedly increased in response to the miR-218 inhibitor (Fig. 2C). To obtain further direct evidence that PXN is a target of miR-218, the miR-218 binding sequences of the WT or Mut PXN 3’-UTR (Fig. 2D) were constructed with a pmiR-REPORT miRNA Expression Reporter Vector (Ambion) and subsequently transfected into TL-1 and CL1-5 cells, respec-tively. The luciferase reporter assay showed that the reporter

activity of WT-PXN 3’-UTR was markedly reduced by miR-218

in both cell types, but no reduction was seen in the reporter

activity of Mut-PXN 3’-UTR when compared with

miR-non-specific control (NC) cells (Fig. 2D). These results suggest that miR-218 may modulate PXN expression by directly targeting its 3’-UTR in lung cancer cells.

Overexpression of PXN following miR-218 suppression enhances cell proliferation, soft agar colony formation, and invasion ability

Alterations in PXN expression have been shown to be implicated in cell growth and invasion in lung cancer (4). To

determine whether PXN upregulation by a reduced expres-sion of miR-218 can increase cell proliferation, soft agar colony formation, and invasion ability, CL1-5 cells were treated with PXN RNAi and an miR-218 precursor, and CL1-0 cells were treated with a miR-218 inhibitor. The doubling time of CL1-5 cells was significantly elevated by treatment with the miR-218 precursor (from 23.8 hours in the control cells to 35.2 hours) and PXN RNAi [from 23.8 hours in the nonspecific RNAi control cells (NC) to 34.7 hours; Fig. 3A]. Similarly, the doubling time of CL1-0 cells was reduced by treatment with the miR-218 inhibitor in a dose-dependent manner (from 23.2 hours in the control cells to 22.1 and 19.2 hours; Fig. 3A). Additionally, the colony count was found to depend on PXN expression in miR-218 expression-altered or PXN-knockdown cells (Fig. 3B). Soft agar assay indicated that colony size was markedly decreased in CL1-5 cells after treatment with the miR-218 precursor and PXN RNAi, and that colony formation efficacy was also reduced (Fig. 3C). A Boyden chamber assay indi-cated that the invasion ability of CL1-5 cells was significantly reduced by treatment with the miR-218 precursor and PXN RNAi (Fig. 3C). On the other hand, the invasion ability and colony formation efficacy of CL1-0 cells was markedly increased by treatment with the miR-218 inhibitor (Fig. 3C). To verify whether PXN is responsible for cell growth and metastasis, CL1-0 cells were treated with PXNsi or PXNsi and the miR-218 inhibitor. The results of the Boyden chamber and colony formation assays showed that the oncogenic potential decreased markedly after treatment with both agents when compared with the potential after treatment with the miR-218 inhibitor alone. Western blotting indicated that the oncogenic potential of CL1-0 cells treated with different agents was consistent with PXN expression (Fig. 3D). These results clearly indicate that upregulation of PXN by miR-218 suppression promotes the cell proliferation and oncogenic potential in lung cancer cells.

Table 2. Cox regression analysis of various potential prognostic factors in lung cancer patients with miR-218 and PXN expression Variables Case no. Median survival, mo OS, % Adjusted HRa 95%CI P Case no. Median survival, mo RFS, % Adjusted HRa 95%CI P miR-218 þ (High) 62 33.9 48.4 1 49 35.4 38.8 1  (Low) 62 26.0 29.0 1.67 1.03–2.69 0.036 54 19.3 20.4 2.08 1.23–3.50 0.006 PXN  (Negative) 58 38.4 55.2 1 48 36.4 43.8 1 þ (Positive) 66 23.2 24.2 2.62 1.58–4.37 <0.001 55 14.7 16.4 2.28 1.37–3.77 0.001 miR-218/PXN þ/ 35 52.0 65.7 1 27 40.0 48.1 1 / 23 32.4 39.1 1.93 0.88–4.25 0.102 21 30.6 38.1 1.70 0.77–3.73 0.188 þ/þ 27 27.3 25.9 3.13 1.48–6.64 0.003 22 25.5 27.3 1.88 0.87–4.05 0.107 /þ 39 18.3 23.1 3.94 1.93–8.02 <0.001 33 13.8 9.1 3.84 1.93–7.67 <0.001

aHR adjusted for age, gender, smoke, tumor type, and tumor stage.

Wu et al.

Cancer Res; 70(24) December 15, 2010 Cancer Research 10396

on December 19, 2010

cancerres.aacrjournals.org

(7)

Figure 2. miR-218 suppressed PXN expression by directly targeting its 3’-UTR. A, expression levels of miR-218 and PXN were evaluated by real-time PCR in 11 lung and 2 cervical cancer cell lines. B, in TL-4 and CL1-0 cells, miR-218 was knocked down by a miR-218 inhibitor (at 2 doses). miR-218 was overexpressed by treatment with a miR-218 precursor (various doses) in TL-1 and CL1-5 cells. The miR-218 level was determined by real-time PCR. C, PXN mRNA level was determined by real-time PCR, and the levels of PXN andb-actin protein were evaluated by Western blotting.b-Actin was used as a protein loading control. NC, nonspecific control. D, top, miR-218 binding sequence of WT or Mut PXN 3’-UTR were synthesized and ligated with pmiR-REPORT miRNA Expression Reporter Vector. Bottom, TL-1 and CL1-5 cells were transfected with Pre-miR-218 (40mmol/L/well; Ambion), miR-nonspecific control (Ambion), 500 ng pMIR-Reporter luciferase vector, including 3’-UTR of PXN (with WT or Mut miR-218 response element), and b-galactosidase plasmid. In all experiments, the relative level in the NC and vector controls was arbitrarily assigned as 1.

A

B

C

D

10 8 6 4 2 2.5 Relative miR-218 expression Relative PXN mRNA (103) (103) 2 1.5 1 0.5 0 2.5 3 1.2 1 0.8 0.6 0.4 0.2 0 1.2 1 0.8 0.6 0.4 0.2 0

Relative luciferase activity

1.2 1 0.8 0.6 0.4 0.2 0 1.2 8 6 4 2 4 3 2 1 0 0 1 0.8 0.6 0.4 0.2 0 2 1.5 1 0.5 0 (nmol/L) 0 20 TL-1 CL1-5 CL1-0 40 miR-218 precursor 0 20 40 0 40 80 1.2 1 0.8 0.6 0.4 0.2 0 TL-4 TL-1 CL1-5 CL1-0 TL-4 0 40 80 0 20 (nmol/L) PXN β-Actin 40 0 20 40 0 40 80 0 40 80

miR-218 precursor miR-218 inhibitor miR-218 inhibitor miR-218 precursor

WT-PXN 3’-UTR miR-218

miR-218

miR-218 NC miR-218 NC miR-218 NC miR-218

NC

Mut-PXN 3’-UTR

Mut-PXN 3’-UTR Mut-PXN 3’-UTR

CL1-5 TL-1 WT-PXN 3’-UTR WT-PXN 3’-UTR ...AUUUUAUUGUUUCUU---AGCACAAG... ...AUUUUAUUGUUUCUU---CTAGTCCG... UGUACCAAUCUAGUUCGUGUU UGUACCAAUCUAGUUCGUGUU

miR-218 precursor miR-218 inhibitor miR-218 inhibitor

CL1-0 H661 TL-4 A549 TL-2 TL-1H1299 CL-5 Calu-1 Ch27 H460 C33A SiHA

0 miR-218 expression 10 miR-218 PXN 8 6 4 2 0 miR-218 expression (10 6) 5’ 3’ 3’ 5’

(8)

PXN modulation by E6 is mediated by miR-218 Expression of miR-218 has been shown to be reduced by HPV16 E6 in cervical cancer (22). Therefore, we then ques-tioned whether E6 in HPV16-positive lung cancer cells could have a similarly inhibitory effect on miR-218 expression. To this end, E6 in TL-1 cells was knocked down using E6 RNAi, and E6 was overexpressed in TL-4 cells by transfection with an E6 cDNA plasmid. As expected, miR-218 expression in the TL-1 cells was elevated by E6 knockdown in a dose-dependent manner (Fig. 4A). Conversely, miR-218 expression in the TL-4

cells was significantly decreased due to E6 overexpression (Fig. 4A). The increase in the miR-218 level due to E6 knock-down in the TL-1 cells concomitantly decreased PXN expres-sion (Fig. 4A). The opposite relationship was observed with E6 overexpression in the TL-4 cells (Fig. 4A). To verify whether PXN expression is modulated by E6 via miR-218, TL-1 cells were treated with E6si and the miR-218 inhibitor either separately or concomitantly. Real-time PCR and Western blot data showed that the PXN mRNA level was greatly reduced by E6 knockdown and slightly elevated by treatment with the

3.5 3 2.5 2 1.5 1 0.5 0 40 30 20 NC NC 40 nmol/L80 nmol/L miR-218 PXNsi 10 0 40 80 0 CL1-5 CL1-0 Hours Relative to NC PXN NC miR-218

Doubling times CL1-5 NC CL1-5 miR-218

CL1-0 miR-218i (40 nmol/L)

CL1-0 miR-218i (80 nmol/L) CL1-5 PXNsi Colony formation assay

CL1-0 NC CL1-0 CL1-0 NC miR-218i miR-218i + PXNsi PXNsi NC miR-218i miR-218i + PXNsi PXNsi Soft agar Invasion capability CL1-5 PXNsi CL1-0 miR-218i (nmol/L) β-Actin PXN β-Actin PXN β-Actin

C

D

A

B

Figure 3.PXN is deregulated by miR-218 and cell proliferation and oncogenic potential are enhanced. A, proliferation rate of CL1-0 cell with or without miR-218 inhibitor treatment and of CL1-5 cells with or without PXN-knockdown plasmid and miR-218 precursor treatment were evaluated on the basis of the cell doubling time. The change in the PXN expression was confirmed by Western blotting (left), and the doubling time is shown at the right. B, representative colony counts of CL1-0 cells with or without miR-218 inhibitor treatment and CL1-5 cells with or without PXN-knockdown plasmid and miR-218 precursor treatment. C, representative soft agar colony sizes and number of invading cells for CL1-0 cells with or without miR-218 inhibitor treatment and CL1-5 cells with or without PXN-knockdown plasmid and miR-218 precursor treatment (left). The soft agar colony formation and invasion ability were evaluated for CL1-0 cells with or without miR-218 inhibitor treatment and for CL1-5 cells with or without PXN-knockdown plasmid and miR-218 precursor treatment and compared with those of NC controls (right). D, effects of PXNsi, miR-218 inhibitor, and combined treatment with PXNsi and the miR-218 inhibitor on PXN expression, soft agar colony formation, and invasion ability in CL1-0 cells. NC, nonspecific control; miR-218i, miR-218 inhibitor. In all experiments, the relative mRNA level in the NC controls was arbitrarily assigned as 1.

Wu et al.

Cancer Res; 70(24) December 15, 2010 Cancer Research 10398

on December 19, 2010

cancerres.aacrjournals.org

(9)

miR-218 inhibitor as compared with levels in the nonspecific RNAi control (NC) cells (Fig. 4B). However, the PXN mRNA level in the TL-1 cells remained unchanged with the combined treatment with E6si and the miR-218 inhibitor (Fig. 4B). These results clearly indicate that PXN expression modulation by E6 is predominantly mediated by miR-218. Further verification of the role of PXN on the oncogenic potential of cells was obtained by treating TL-1 cells with E6si, the miR-218 inhi-bitor, PXNsi, and combinations of these 3 agents. The onco-genic potential was greatly reduced by E6si, followed by the combination treatments; conversely, the oncogenic potential was slightly elevated by treatment with the miR-218 inhibitor and the combined E6si and miR-218 inhibitor treatment (Fig. 4C). These results clearly indicate that PXN upregulated by E6 is mediated by miR-218 in lung cancer cells.

Discussion

In recent years, miRNA molecules have emerged as power-ful regulators of gene expression and genome stability. Several miRNAs have been found to be involved in the initiation and progression of lung cancer and to be associated with the diagnosis, prognosis, and treatment of lung cancer. For diag-nosis, miR-205 is a highly accurate marker for lung cancer of squamous histology (23), whereas 488, 503, and miR-647 have been identified as markers of disease recurrence in stage I lung cancer (24). With regard to prognosis, miR-155, let-7a, miR-221, miR-137, miR-372, miR-182, miR-21, miR-205, and miR-34a have been found useful in predicting survival and relapse in lung cancer patients (13, 25–28). As shown in this study, miR-218 may predict the OS and RFS in lung cancer patients, although the prognostic significance of miR-218 for

OS and RFS was relatively lower than that of PXN (HR: 1.67 vs. 2.62 for OS; 2.08 vs. 2.28 for RFS; Table 2). HPV16 E6 has been shown to reduce miR-218 expression in cervical cancer cells (22). HPV16/18 infection was found to be associated with lung cancer development in a group of Taiwanese women, more than 90% of whom had never smoked (29). We also found that E6 was negatively associated with miR-218 expression and positively associated with PXN expression (P ¼ 0.001 for miR-218; P < 0.001 for PXN; Supplementary Table 4). The HRs for RFS with regard to miR-218 and PXN expression were also elevated in E6-positive patients compared with E6-negative patients (3.38 vs. 2.09 for miR-218; 2.79 vs. 2.43 for PXN; Supplementary Table 5). Additionally, the HRs for OS and

RFS in patients with E6þ/miR-218/PXNþ were markedly

increased to 6.68 and 5.97 times those in patients with

E6/miR-218þ/PXN, respectively (95% CI ¼ 2.44–18.30, P

< 0.001 for OS; 95% CI ¼ 2.01–17.75, P ¼ 0.001 for RFS; Supplementary Table 5). The results suggest that PXN over-expression induced by miR-218 suppression may promote tumor malignancy, resulting in poor OS and RFS, and it may also be useful as an indicator of OS and RFS in cases of lung cancer with HPV infection.

PXN is a multidomain protein that localizes at the intra-cellular surfaces where cells adhere to the extraintra-cellular matrix. Through the interactions of its multiple protein-binding mod-ules, many of which are regulated by phosphorylation (30–32), PXN serves as a platform for the recruitment of numerous regulatory and structural proteins that control the dynamic

changes in cell adhesion, cytoskeletal reorganization (33–35),

and gene expression that are necessary for cell survival and metastasis (5, 34). A recent report indicated that PXN muta-tion and gene amplificamuta-tion in lung cancer cells and tumor

Relative miR-218 Relative PXN expression 1.2 1 0.8 0.6 0.4 0.2 0 1.2 1.4 1 0.8 0.6 0.4 0.2 0 Relative to NC 1.2 1.4 1 0.8 0.6 0.4 0.2 0 2.5 3.5 3 2 1.5 1 0.5 0 PXN HPV16 E6

A

B

C

TL-1 E6si TL-1 TL-1 E6si miR-218i miR-218i miR-218i PXNsi E6si E6si + TL-4 E6 NC. NC #1 #2 0 5 10 (μg) β-Actin PXN β-Actin PXN β-Actin Soft agar Invasion capability

Figure 4.PXN is an indicator of HPV-induced increased oncogenic potential. A, HPV16 E6 in TL-1 cells was knocked down by 2 E6 siRNAs (E6si#1 and #2). HPV16 E6 was overexpressed using an E6 overexpression plasmid (at various doses) in TL-4 cells. The miR-218 level was determined by real-time PCR, and the levels of HPV16 E6, p53, PXN, andb-actin were evaluated by Western blotting. b-Actin was used as a protein loading control. NC, nonspecific control. B, TL-1 cells were transfected with E6 siRNA and the miR-218 inhibitor, as indicated. The total amount of siRNA and miRNA inhibitor was kept constant by addition of the negative control in each transfection unit. C, effects of PXNsi, the miR-218 inhibitor, and E6si on PXN expression, soft agar colony formation, and invasion ability in TL-1 cells. NC, nonspecific control; miR-218i, miR-218 inhibitor. In all experiments, the relative mRNA level in NC controls was arbitrarily assigned as 1.

(10)

tissues might promote cell growth and invasion (4). In this study, PXN overexpression in lung cancer cells and tumor tissues was also found to enhance cell proliferation and tumor invasiveness (Fig. 3). Patients with high PXN expression had poorer OS and RFS than those with low PXN expression (Table 2). To verify whether PXN gene amplification could contribute to PXN overexpression in lung tumors, real-time PCR analysis was conducted to determine the extent of PXN amplification. Among 124 lung tumors, 17 tumors were detected with PXN amplification that was not associated with PXN mRNA and protein expression in lung tumors (PXN mRNA, P ¼ 0.433; PXN protein, P ¼ 0.619; Supplementary Tables 6 and 7). Moreover, PXN amplification was also not related with miR-218 expression (P ¼ 0.433; Supplementary Table 8). Previously, there were no mutations for PXN identi-fied in Taiwanese sample (0 of 70; ref. 4). We also used direct sequencing to detect mutations in exon 4 of the PXN gene. In lung cancer, in this exon has been shown to be the most frequently mutated site. No mutations in A127T in the PXN gene were found in the 124 lung tumors enrolled in this study (data not shown). These results suggest that PXN overexpres-sion enhances tumor growth and metastasis in response to reduction of miR-218 rather than by gene mutation or gene amplification, at least in our studied population.

To determine whether PXN upregulation could affect cer-tain important metastasis-related genes to cause tumor malig-nancy, the expression profiles of PXN-knockdown CL1-5 cells were analyzed by PCR array and compared with those of NC cells. Among the 2-fold and higher upregulated genes, CD44 molecule (CD44) showed the highest upregulation by PXN knockdown (12.0-fold), followed by serpin peptidase inhibitor, clade B (ovalbumin, SERPINB5; 8.32-fold), LY6/PLAUR domain containing 3 (LYPD3; 4.45-fold), TIMP metallopeptidase inhi-bitor 4 (TIMP4; 3.33-fold), chemokine (C-X-C motif), ligand 12 (CXCL12; 2.70-fold), platelet/endothelial cell adhesion mole-cule (PECAM1; 2.46-fold), and tumor-associated calcium sig-nal transducer 1 (TACSTD1; 2.27-fold). On the other hand, chemokine (C-X-C motif) receptor 4 (CXCR4) and matrix metallopeptidase 7 (MMP7) were found to be downregulated (0.47-fold for CXCR4 and 0.49-fold for MMP7; Supplementary Table 9). CD44 expression has been shown to be relevant to tumor growth and metastasis in various human cancers including colon (36) and breast cancer (37), lymphomas (38), melanomas (39), and gastric (40) and lung carcinomas (41, 42). SERPINB5 (also known as Maspin) has been shown to be a tumor suppressor and may inhibit tumor growth and

metastasis in breast cancer (43–45). These results suggest that tumor growth and metastasis enhanced by PXN overexpres-sion may occur at least in part due to increased CD44 and SERPINB1 expression. However, the underlying mechanism of PXN overexpression on lung tumor growth and metastasis needs further exploration.

miR-218 is transcribed within the intronic region of the known tumor suppressor genes SLIT2 (16, 22) and SLIT3 (13). SLIT2 has frequently been found to be inactivated in lung and breast tumors due to promoter hypermethylation (46), and SLIT3 promoter hypermethylation in lung and breast cancer is rarer than SLIT2 promoter hypermethylation (47). In this study, SLIT2 expression was significantly reduced in HPV16-infected TL-1 cells and E6-overexpressing TL-4 cells, and the alterations in SLIT2 expression was consistent with miR-218 suppression by E6 (Supplementary Fig. 1A). Methylation-specific PCR (MSP) analysis showed that promoter hypermethylation occurred in TL-1 and CL1-5 cells and that miR-218 and SLIT2 expression was restored when both cell types were treated with demethylated agent 5-aza-dC (Supplementary Fig. 1B and C). Therefore, miR-218 deregulation by E6 may partially occur via promoter hypermethylation of the SLIT2 gene.

In summary, we provide the evidence to show that PXN upregulation in response to miR-218 reduction may enhance tumor growth and metastasis in lung cancer and that PXN and miR-218 may act as independent indicators of OS and RFS, respectively, in non–small cell lung cancer (NSCLC). We further found that the PXN level is useful for predicting the OS and RFS in NSCLC with HPV infection. Therefore, we recommend PXN as a potential target for therapeutics in NSCLC.

Disclosure of Potential Conflicts of Interest No potential conflicts of interest were disclosed.

Grant Support

This work was jointly supported by grants from the National Health Research Institute (NHRI96-TD-G-111-006; NHRI97-TD-G-111-006) and the National Science Council (NSC-96-2628-B-040-002-MY3) of Taiwan, ROC.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 07/02/2010; revised 10/27/2010; accepted 10/28/2010; published Online 12/15/2010.

References

1. Shedden K, Taylor JM, Enkemann SA, et al. Gene expression-based survival prediction in lung adenocarcinoma: a multi-site, blinded validation study. Nat Med 2008;14:822–7.

2. Gupta GP, Massague J. Cancer metastasis: building a framework. Cell 2006;127:679–95.

3. Salgia R, Li JL, Ewaniuk DS, et al. Expression of the focal adhesion protein paxillin in lung cancer and its relation to cell motility. Oncogene 1999;18:67–77.

4. Jagadeeswaran R, Surawska H, Krishnaswamy S, et al. Paxillin is a target for somatic mutations in lung cancer: implications for cell growth and invasion. Cancer Res 2008;68:132–42.

5. McCormack SJ, Brazinski SE, Moore JL Jr, Werness BA, Goldstein DJ. Activation of the focal adhesion kinase signal transduction path-way in cervical carcinoma cell lines and human genital epithelial cells immortalized with human papillomavirus type 18. Oncogene 1997;15:265–74.

Wu et al.

Cancer Res; 70(24) December 15, 2010 Cancer Research 10400

on December 19, 2010

cancerres.aacrjournals.org

(11)

6. Pillai RS. MicroRNA function: multiple mechanisms for a tiny RNA?RNA 2005;11:1753–61.

7. Zamore PD, Haley B. Ribo-gnome: the big world of small RNAs. Science 2005;309:1519–24.

8. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and func-tion. Cell 2004;116:281–97.

9. Esquela-Kerscher A, Slack FJ. Oncomirs—microRNAs with a role in cancer. Nat Rev Cancer 2006;6:259–69.

10. Calin GA, Croce CM. MicroRNA signatures in human cancers. Nat Rev Cancer 2006;6:857–66.

11. Bueno MJ, de Castro IP, Malumbres M. Control of cell proliferation pathways by microRNAs. Cell Cycle 2008;7:3143–8.

12. Nicoloso MS, Spizzo R, Shimizu M, Rossi S, Calin GA. MicroRNAs— the micro steering wheel of tumour metastases. Nat Rev Cancer 2009;9:293–302.

13. Yanaihara N, Caplen N, Bowman E, et al. Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 2006;9:189–98.

14. Schembri F, Sridhar S, Perdomo C, et al. MicroRNAs as modulators of smoking-induced gene expression changes in human airway epithe-lium. Proc Natl Acad Sci USA 2009;106:2319–24.

15. Gao C, Zhang Z, Liu W, Xiao S, Gu W, Lu H. Reduced microRNA-218 expression is associated with high nuclear factor kappa B activation in gastric cancer. Cancer 2010;116:41–9.

16. Tie J, Pan Y, Zhao L, et al. MiR-218 inhibits invasion and metastasis of gastric cancer by targeting the Robo1 receptor. PLoS Genet 2010;6: e1000879.

17. Cheng YW, Wu TC, Chen CY, Chou MC, Ko JL, Lee H. Human telomerase reverse transcriptase activated by E6 oncoprotein is required for human papillomavirus-16/18-infected lung tumorigen-esis. Clin Cancer Res 2008;14:7173–9.

18. Cheng YW, Wu MF, Wang J, et al. Human papillomavirus 16/18 E6 oncoprotein is expressed in lung cancer and related with p53 inacti-vation. Cancer Res 2007;67:10686–93.

19. Jiang M, Milner J. Selective silencing of viral gene expression in HPV-positive human cervical carcinoma cells treated with siRNA, a primer of RNA interference. Oncogene 2002;21:6041–8.

20. Yoshinouchi M, Yamada T, Kizaki M, et al.In vitro and in vivo growth suppression of human papillomavirus 16-positive cervical cancer cells by E6 siRNA. Mol Ther 2003;8:762–8.

21. Wu HH, Cheng YW, Chang JT, et al. Subcellular localization of apurinic endonuclease 1 promotes lung tumor aggressiveness via NF-kappaB activation. Oncogene. 2010;29:4330–40.

22. Martinez I, Gardiner AS, Board KF, Monzon FA, Edwards RP, Khan SA. Human papillomavirus type 16 reduces the expression of micro-RNA-218 in cervical carcinoma cells. Oncogene 2008;27:2575–82. 23. Lebanony D, Benjamin H, Gilad S, et al. Diagnostic assay based on

hsa-miR-205 expression distinguishes squamous from nonsquamous non-small-cell lung carcinoma. J Clin Oncol 2009;27:2030–7. 24. Patnaik SK, Kannisto E, Knudsen S, Yendamuri S. Evaluation of

microRNA expression profiles that may predict recurrence of localized stage I non-small cell lung cancer after surgical resection. Cancer Res 2010;70:36–45.

25. Takamizawa J, Konishi H, Yanagisawa K, et al. Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer Res 2004;64:3753–6. 26. Yu SL, Chen HY, Chang GC, et al. MicroRNA signature predicts

survival and relapse in lung cancer. Cancer Cell 2008;13:48–57. 27. Markou A, Tsaroucha EG, Kaklamanis L, Fotinou M, Georgoulias V,

Lianidou ES. Prognostic value of mature microRNA-21 and micro-RNA-205 overexpression in non-small cell lung cancer by quantitative real-time RT-PCR. Clin Chem 2008;54:1696–704.

28. Gallardo E, Navarro A, Vinolas N, et al. miR-34a as a prognostic marker of relapse in surgically resected non-small-cell lung cancer. Carcinogenesis 2009;30:1903–9.

29. Cheng YW, Chiou HL, Sheu GT, et al. The association of human papillomavirus 16/18 infection with lung cancer among nonsmoking Taiwanese women. Cancer Res 2001;61:2799–803.

30. Salgia R, Brunkhorst B, Pisick E, et al. Increased tyrosine phosphor-ylation of focal adhesion proteins in myeloid cell lines expressing p210BCR/ABL. Oncogene 1995;11:1149–55.

31. Schaller MD. Paxillin: a focal adhesion-associated adaptor protein. Oncogene 2001;20:6459–72.

32. Weng Z, Taylor JA, Turner CE, Brugge JS, Seidel-Dugan C. Detection of Src homology 3-binding proteins, including paxillin, in normal and v-Src-transformed Balb/c 3T3 cells. J Biol Chem 1993;268: 14956–63.

33. Turner CE. Paxillin and focal adhesion signalling. Nat Cell Biol 2000;2: E231–6.

34. Brown MC, Turner CE. Paxillin: adapting to change. Physiol Rev 2004;84:1315–39.

35. Schaller MD, Parsons JT. pp125FAK-dependent tyrosine phosphor-ylation of paxillin creates a high-affinity binding site for Crk. Mol Cell Biol 1995;15:2635–45.

36. Mulder JW, Kruyt PM, Sewnath M, et al. Colorectal cancer prognosis and expression of exon-v6-containing CD44 proteins. Lancet 1994;344:1470–2.

37. Kaufmann M, Heider KH, Sinn HP, von Minckwitz G, Ponta H, Herrlich P. CD44 variant exon epitopes in primary breast cancer and length of survival. Lancet 1995;345:615–9.

38. Stauder R, Eisterer W, Thaler J, Gunthert U. CD44 variant isoforms in non-Hodgkin's lymphoma: a new independent prognostic factor. Blood 1995;85:2885–99.

39. Manten-Horst E, Danen EH, Smit L, et al. Expression of CD44 splice variants in human cutaneous melanoma and melanoma cell lines is related to tumor progression and metastatic potential. Int J Cancer 1995;64:182–8.

40. Miwa T, Watanabe A, Yamada Y, et al. Progression in gastric carci-noma relative to the ratio of CD44 epithelial variant transcript to CD44 hematopoietic variant transcript. Cancer 1996;77:25–9.

41. Ramasami S, Kerr KM, Chapman AD, King G, Cockburn JS, Jeffrey RR. Expression of CD44v6 but not E-cadherin or beta-catenin influ-ences prognosis in primary pulmonary adenocarcinoma. J Pathol 2000;192:427–32.

42. Clarke MR, Landreneau RJ, Resnick NM, et al. Prognostic significance of CD44 expression in adenocarcinoma of the lung. Clin Mol Pathol 1995;48:M200–4.

43. Liu Z, Shi HY, Nawaz Z, Zhang M. Tamoxifen induces the expression of maspin through estrogen receptor-alpha. Cancer Lett 2004;209: 55–65.

44. Hendrix MJ, Seftor EA, Kirschmann DA, Seftor RE. Molecular biology of breast cancer metastasis. Molecular expression of vascular mar-kers by aggressive breast cancer cells. Breast Cancer Res 2000;2: 417–22.

45. Sheng S, Carey J, Seftor EA, Dias L, Hendrix MJ, Sager R. Maspin acts at the cell membrane to inhibit invasion and motility of mammary and prostatic cancer cells. Proc Natl Acad Sci USA 1996;93:11669– 74.

46. Dallol A, Da Silva NF, Viacava P, et al. SLIT2, a human homologue of the Drosophila Slit2 gene, has tumor suppressor activity and is frequently inactivated in lung and breast cancers. Cancer Res 2002;62:5874–80.

47. Dickinson RE, Dallol A, Bieche I, et al. Epigenetic inactivation of SLIT3 and SLIT1 genes in human cancers. Br J Cancer 2004;91:2071–8.

數據

Table 1). In contrast, the high expression of miR-218 in stage III patients was marginally lower than that in stage I and II patients (P ¼ 0.055; Table 1)
Table 1. The correlation between clinical parameters with miR-218 and PXN expressions and correlation between miR-218 and the expression of PXN mRNA and protein
Table 2. Cox regression analysis of various potential prognostic factors in lung cancer patients with miR- miR-218 and PXN expression Variables Case no
Figure 2. miR-218 suppressed PXN expression by directly targeting its 3’-UTR. A, expression levels of miR-218 and PXN were evaluated by real-time PCR in 11 lung and 2 cervical cancer cell lines
+3

參考文獻

相關文件

6 《中論·觀因緣品》,《佛藏要籍選刊》第 9 冊,上海古籍出版社 1994 年版,第 1

High pre-treatment serum level of vascular endothelial growth factor (VEGF) is associated with poor outcome in small-cell lung cancer. Telomerase as tumor

From the left, epidermal disarray, plentiful small and bright cells, and scattered larger dendritic cells are apparent in the suprabasal epithelium, indicating likely LM (C), then a

They could also successfully form single-cell derived colonies (Fig.. Pyogenic granuloma-derived cells. A) After the initial seeding, many cells attached to the plates in an

The current study found that high-grade MECs had the highest incidence of strong MUC1 expression in mucous cells, with intermedi- ate- and low-grade tumours showing the

The e xfoliated oral buccal cells and blood samples were collected for the assay of micronucleus frequency (MNF) and comet assay.. We find that there are higher MNF

This type of limit can be evaluated for certain functions, including rational functions, by dividing numerator and denominator by the highest power of x that occurs in the

A revolution: Probability propagation in networks with cycles, Jordan, Kearns and Solla (eds), Advances in Neural Information Processing Systems 10, MIT Press.