(農業試驗所特刊第139號)International Symposium on Rice Research in the Era of Global Warming

全文

(1)

(2) International Symposium on International Symposium on Rice Research in the Era of Global Warming. October 6- 7, 2009 TARI, Taichung, Taiwan.

(3) Special publication of TARI No.139 ISBN-13:978-986-02-0782-8. Taiwan Agricultural Research Institute Council of Agriculture 189 Chung-Cheng Road, Wufeng, Taichung Hsien 41301 Taiwan, ROC. Tel: +886-4-2330-2301 Fax: +886-4-2333-8162 Web site: www.tari.gov.tw C 2009 Taiwan Agricultural Research Institute Copyright○. All Right Reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means: electronically, mechanically, by photocopying, recording or otherwise, without the prior permission of the copying owner.. ISBN-13 : 978-986-02-0782-8 Taiwan Agricultural Research Institute, Spec. Publ. No.139 Printed in Taiwan, ROC, by Asia United Advertising Ltd. December 2009.

(4) International Symposium on Rice Research in the Era of Global Warming Proceedings of International Symposium. Edited by. Min-Tze Wu. Jen-Ren Chen. Dah-Jiang Liu. Director. Researcher. Director General. Biotechnology Divison TARI. Biotechnology Divison TARI. TARI Council of Agriculture. Published by Taiwan Agricultural Research Institute Council of Agriculture December, 2009.

(5) CONTENTS Preface ......................................................................................................................i Opening Ceremony Welcome Address Dah-Jiang Liu........................................................................................................... v Opening Remarks Su-San Chang ........................................................................................................viii Presentation Papers Effect of global warming on rice culture and adaptive strategies Motohiko Kondo ....................................................................................................... 1 Changes in water distribution of developing rice caryopses by high-temperature stress Tsutomu Ishimaru ................................................................................................... 10 Fine Mapping of the Giant Embryo Gene GE2 in Rice Yann-Rong Lin ........................................................................................................ 17 Marker-assisted selection for biotic stress tolerance in rice: current status and emerging needs Casiana M. Vera Cruz ............................................................................................ 31 Marker-Assisted Breeding for Abiotic Stress Tolerance in Rice: Progress and Future Perspectives Michael J. Thomson................................................................................................ 43.

(6) Mapping of Brown Planthopper Resistance Gene Introgressed from Oryza nivara into Cultivated Rice, O. sativa Min-Tze Wu............................................................................................................. 56 Integration of genomics into breeding in rice Masahiro Yano ........................................................................................................ 66 Genetic engineering of “C4 rice”: Rationale and performance of transgenic rice plants expressing cyanobacterium and maize CO2 concentrating mechanism genes Maurice S. B. Ku .................................................................................................... 79 Development of Single Nucleotide Polymorphism (SNP) Markers and Applications in Rice Breeding Zi-Xuan Wang ......................................................................................................... 90 Update for elite Japonica variety Shao-yang Lin......................................................................................................... 95. Program Schedule .............................................................................................. 107.

(7) i. Preface Climate change due to global warming may be one of the greatest threats facing the planet, as we have witnessed increasing temperatures in various regions and increasing extremities of natural disasters in recent years. The potential impacts of global warming on agriculture are in many ways, including crop production, agricultural practices, environmental effects, and ecosystems. This symposium was held on October 6-7, 2009 to discuss effects of climate change on rice production and identify research needs to deal with the inevitable threats of global warming. Growing rice crop is subject to numerous stresses such as flooding, drought, chilling injury, heat injury, salt injury and pest problems, including weeds, insects and pathogens. Efforts to overcome these stresses in the past have been through development of stress-tolerant varieties by conventional breeding and improvement of cultural techniques. Application of modern technologies such as exploitation of DNA markers in rice genome for rice breeding will likely accelerate the development of new rice varieties that are tolerant to environmental stresses. Since rice is the most important food crop in Taiwan, our research efforts on this crop have been intensive in the past, especially in the fields of breeding, pest management (weeds, insects and diseases) and cultural practices. Several rice varieties with high yield and superior quality have been developed through conventional breeding by researchers at the Taiwan Agricultural Research Institute (TARI) and other Agricultural Improvement Stations. During the past ten years, the rice breeding program at TARI has expanded further to incorporate new molecular techniques for improvement of rice production. Numerous researchers in other rice-producing countries are also actively pursuing studies on the use of DNA technologies for rice breeding. At this 2-day symposium, we are fortunate to invite ten speakers, who are renowned scientists in the field of rice research, from Taiwan,.

(8) ii Philippines, and Japan to discuss issues related to rice production under harsh climate. Their presentations published in the proceedings would benefit not only all the participants but also many others involved in the research of rice crop. As the Director General of TARI, I would like to express my gratitude to the speakers for their contributions and to members of TARI for organizing this symposium and editing the proceedings. Financial supports for the symposium and the proceedings are provided by the Council of Agriculture, Taiwan.. Dah-Jiang Liu, Ph.D. Director General Taiwan Agricultural Research Institute Council of Agriculture.

(9) iii. Opening Ceremony.

(10) v. Welcome Address Dr. Dah-Jiang Liu Director General Taiwan Agriculture Research Institute Council of Agriculture Dr. Wu, Research Fellow of the Academia Sinica and a very respected rice scientist; Dr. Chang, Director of the Department of International Affairs of the Council of Agriculture; Dear Participants; Honorable Guests; Ladies and Gentlemen. Good morning.. Welcome to Taiwan Agricultural Research Institute for the International Symposium on Rice Research in the Era of Global Warming. We are here for the opening ceremony of the Symposium, and you know that typhoon Parma has been lingering in the Bashi Channel between the Philippines and Taiwan for several days. The weakening typhoon persists.. It is still there.. There is an old Chinese saying:. “Old friends come to visit me in the midst of a thunderstorm”, implying the precious friendship among old pals and the happiest mood of the master. Here at TARI, as the host of the Symposium, with all my honor and pleasure, I sincerely welcome all of you coming to this Institute for the very important Symposium.. We are all familiar with the meaning and consequences of global warming in the long run.. Scientists around the world, including those in Taiwan, are working hard. to get clear the responses of crops to the environmental changes. Genetic variation in tolerating rather extreme climatic or soil conditions has been evaluated. In the past ten years, we have built up the mutation pool with over 3,000 lines of the.

(11) vi japonica rice Tainung 67 in order to create more genetic variability.. Together with. Dr. Johnson Wang of the National Chung-Hsing University, and in cooperation with the International Rice Research Institute, we have also established the IR-64 mutation pool with more than 600 lines at the F5 or F6 generation; and more lines are coming. Part of the mutated lines has been screened for their performance under unfavorable environmental conditions; and breeding programs with these materials are being carried out.. During the past 25 years in Taiwan, the most important goal of rice breeding has been the development of varieties of high eating quality.. This Institute, along with. our Chiayi branch station and the seven independent district agricultural improvement stations, that is, a total of 9 institutions, have been working competitively on the breeding of high quality rice.. For an island as small as. Taiwan, it might not be sensible to invest so much money and manpower into this single breeding program.. Taiwan Agricultural Research Institute, at the. headquarters here, has decided that, starting from next year, we will no longer make any new cross for the development of high quality rice. Rather, we will shift our resources to the breeding of rice varieties adaptive to high temperature or high salinity, or tolerant to drought or low water supply condition. More efforts will also be put on the utilization of molecular markers to facilitate the process of our rice breeding programs.. Taiwan has a long history of cooperation with Japan, the Philippines and the United States on researches of not only rice, but also other subjects of agricultural production. I sincerely wish that by holding this symposium, more meaningful collaboration on issues of global warming can be developed. By working together,.

(12) vii we should be in a much better position to meet the challenges of the changing environments.. I thank the Council of Agriculture for supporting rice research, international cooperation, and this Symposium; and to Dr. Chang for her presence at the opening ceremony. I would like to appreciate Dr. Wu, Director of the Biotech Division of TARI, and his staffs for making all the preparations and arrangements.. I fully. understand and appraise their hardworking during the past several months. I would also like to thank specially to Dr. Wu Hong-Pan of Academia Sinica. He has done so much to help the materialization of this Symposium in such a short period of time, not to mention Dr. Wu’s long-time and critical contribution to rice research in Taiwan.. Of course, I thank you, all the speakers and participants in this room.. You will. certainly make great contributions and benefit from each other in our future rice studies aimed to cope with the impacts of global warming.. Please enjoy your stay in this Institute for the next two days. To our foreign friends, have a wonderful time in this country. I assure you that typhoon Parma will be gone by tomorrow so that your trip back home will certainly be a very safe one.. Thank you very much..

(13) viii. Opening Remarks Dr. Su-Sang Chang Dircetor General International Affairs Department Council of Agriculture Dr. Hong-Pang Wu, distinguished Research Fellow of Academia Sinica, Dr. Liu, Director General of Taiwan Agricultural Research Institute, all honorable guests and participants, Ladies and Gentlemen, Good Morning! On behalf of the Council of Agriculture of Taiwan, I am very glad to be here, and it’s a great honor for me to address you as part of the opening ceremony for the International Symposium on Rice Research in the Era of Global Warming. I would also like to extend my warmest welcome to all of you, especially those friends coming a long way to this country from Japan and the Philippines. Global warming has been an issue of worldwide concern for a long time. Its impact on the global ecology and human beings is not as far away as we thought before. Actually, we are facing the global warming right now and it has already been threatening our day-to-day living to an extent beyond what we could have imagined a few years ago. Earlier this year in July, we worried about the possible drought which could imperil the transplanting of the second crop rice in Taiwan. Then, a few days later in August, the struck of the severest flood we have ever encountered in our history took hundreds of lives away and wiped out thousands of hectares of farmland and fish ponds in just two days. This example, along with so many other climatic disasters occurred in many countries in recent years, forced us to face.

(14) ix seriously the inevitable consequences of atmospheric change or global warming to be happened in the near future. The production of agricultural crops depends on the adequacy of environmental conditions. As a result of evolution, almost all crops can grow normally only in a rather narrow range of temperature. With the trend of increasing temperature and decreasing supply of available irrigation water due to global warming, agricultural harvest and food supply, as well as human life and welfare as a whole, is an urgent issue must be taken into consideration by agricultural scientists in the whole world. No country can consider herself an exception. For the climate changing dramatically and unpredictably, our government has assigned us missions to develop various crop varieties of stress-tolerance to the environment. Because the earth warming is a global problem, it may results in frequent occurrence of alternant heat waves, droughts, floods, plant diseases, and the winter may be shorter but colder, and so on. The resulting problems are complex and cross-interacting each other. As agronomists and plant physiologists and pathologists, in the scene, we have been capable of contributing our efforts on rice breeding and cultivation. Thus an important purpose of this symposium is to gather the experts of this field that we will be acquainted with each other through the talks and discussion activities. I deeply hope after this symposium we may work together in the future, because we have the same goal to overcome the inevitable obstacles. I would like to thank the Symposium Committee for organizing this fantastic symposium, and especially thanks to all outstanding scientists and experts from abroad and Taiwan for attending this symposium. In this room, I see many agricultural experts from different regions of Taiwan, some of you I am very familiar with, because we have worked together for a long time for Taiwan’s agriculture. We have just heard Dr. Liu’s address reviewing the history of.

(15) x rice research in Taiwan. This is just one of the remarkable achievements of our agricultural research in Taiwan. I am truly thankful to all of you for contribution to new scientific knowledge and increase our farmers’ income. Today, I am also very happy to see so many young friends in this room. You are the new generation and new blood for our efforts to improve sustainability of agriculture in Taiwan. Particularly, I would like to thank all the invited speakers for your contributions to this symposium. I wish all of you will enjoy the sessions of this symposium and establish friendships and future collaborations after this symposium..

(16) xi. Presentation Papers.

(17) International Symposium (2009) Rice Research in the Era of Global Warming 1~9. Effect of global warming on rice culture and adaptive strategies Motohiko Kondo1,* 1. National Institute of Crop Science, National Agriculture and Food Research Organization, 2-1-18 Kannondai, Tsukuba, Ibaraki 305-8518, Japan, *Corresponding author: chokai@affrc.go.jp. ABSTRACT The Fourth Assessment Report of Intergovernmental Panel on Climate Change in 2007 implied the increasing trend in global temperatures associated with anthropogenic greenhouse gases concentrations. In recent years, negative effect by high temperature to rice yield and grain appearance quality is recognized even in sub-tropical and temperate areas. High temperature induced sterility is most serious threat by high temperature on yield reduction. Occurrence of chalky grain is now crucial issue in Japan. Although high temperature during early ripening stages is a major trigger for chalky grain, other climatic conditions such as radiation, agronomic techniques and rice varieties are also responsible. This indicates the importance of integrated measure of variety and crop management to mitigate negative effect of high temperature. Key words: rice, high temperature, grain quality. INTRODUCTION The Fourth Assessment Report of Intergovernmental Panel on Climate Change (IPCC) in 2007 strongly implied that the increasing trend in global temperatures since the mid-20th century is the result of increase in anthropogenic greenhouse gases concentrations. High atmospheric CO2 leads to the increase in biomass.

(18) production and yield through enhanced photosynthesis. On the other hand, it has been known that high temperature above optimum has negative effect on yield and grain quality in rice by inducing decline of grain setting, reduced grain weight, increased respiration, and also through aggravating biotic stress. Importantly, high temperature indirectly suppresses rice production by increasing water demand in water-limited area. Coping with these constraints derived from rising temperature will maximize the beneficial effect by CO2 increases. Developing adaptive strategies to increasing temperature by understanding the response of rice to high temperature are crucial challenges in rice research. This paper reports on current knowledge on physiological response of rice to high temperature mainly based on experiences in Japan and discuss adaptive strategy.. YIELD AND GRAIN SETTING Spikelet formation The effect of temperature on yield appears through the changes in biomass production and harvest index. Generally, harvest index is more fluctuant as compared with biomass production due to higher sensitivity to temperature in spikelet formation, grain setting and grain filling. The study in western Japan (Suzuki 1980) showed that high temperature has positive effect on biomass production at early stages by enhancing tillering, leaf expansion and nutrient uptake. While, positive effect by higher temperature on biomass is less or becomes negative in later stages due to larger burden from increased maintenance respiration associated with excessive growth, faster senescence, and shortened growth period. The factors causing reduction in harvest index by high temperature include decreased number of spikelet, sterility, and reduced single grain weight. Lowered spikelet formation efficiency, which is defined as spikelet number per unit biomass or unit N uptake at heading stage, is partly attributed to increased 2.

(19) proportion of unproductive tiller, lowered number of spikelet per panicle caused by excessive vegetative growth and reduced N uptake. Yield decline trend with decreasing biomass and spikelet number was observed in long-term experiment in the Philippines (Peng et al 2001). It appeared to be associated with increase in daily minimum temperature. Physiological mechanisms underlying specific effect of high night temperature on the spikelet formation remain unclear for further study.. High-temperature-induced sterility Floret sterility induced by high temperature above 35 oC (Satake and Yoshida 1978) is most serious threat to reduce grain yield. High temperature-induced sterility has been reported in the tropics, and recently in China (Wang 2002). In the hot summer of 2007, increase in sterility rate was observed in farmers fields in central Japan (Hasegawa et al 2009). The most sensitive stage to high temperature-induced sterility is anthesis followed by young microspore stages (Satake and Yoshida 1978). High day temperature at anthesis time induces sterility by reducing the number of pollen grain shed on stigma. Morphologies of anther which affect theca dehiscence are proposed to be responsible for genotypic difference in sensitivity of pollen shedding, such as thickness of locule wall, length of dehiscence at basal part of theca (Matsui et al 2001, 2005). It was also proposed that the traits that flower early morning or night, which is found in cultivated rice species and wild relatives, may also be useful to escape from high day temperature (Nishiyama and Blanco 1980). We need more information on critical temperature and stages under field conditions to assess the risks of sterility under global warming. Field observation in open field (Hasegawa et al 2009) implied that sterility rate with air temperature above 35 oC was considerably lower than that predicted from the results obtained in chamber experiment. Possible factor explaining these differences between 3.

(20) chamber experiments and field include temperature gaps between air and spikelet, physiological status of the plant grown in field and pot.. GRAIN FILLING AND QUALITY Effect of temperature on grain quality High temperatures during ripening stages lead to smaller grain size and deterioration of grain appearance quality such as chalky grain and fissured grains. Under high temperatures, increase in grain weight is accelerated in the early ripening stages while duration of ripening period becomes shorter, which results in smaller final grain size (Sato and Inaba 1976). In recent years, high temperature above 26-27 oC during early ripening stages increase the occurrence of chalky grain and fissured grain in Japan (Fig. 1)(Kondo et al. 2006, Nagata et al. 2004, Terashima et al. 2001). Chalky grains are composed of various types such as white-backed, milky white, white-belly, and white-based grain having different opaque endosperm portion. Milky white grain seriously degrades the market value. Not only high temperature, but also other climatic conditions such as low radiation, typhoon and plant factors such as high spikelet number are important factor to cause milky-white grain. Gain chalkiness is suggested to be caused by disorder of starch accumulation processes based on the fact that opaque portions of chalky grain, amyloplast development is abnormal (Zakaria et al 2002). The causes of chalkiness and small grain are hypothesized to be source limitation and/or disorder of starch synthesis processes. There are two major sources of carbon for starch synthesis in the endosperm, newly photosynthesized carbon from leaf and accumulated non-structural carbon, mainly starch and sugars, in stem and leaf sheath. Photosynthetic rate at single leaf level is relatively stable under short-term exposure to wide range of temperature, e.g. 24 - 36 oC (Vong and Murata 1977).. 4.

(21) Fig. 1. Various types of grain appearance quality. From left: perfect grain, milky-white grain, white-backed grain, fissured grain. Photograph by N. Iwasawa.. The effect of high temperature on canopy photosynthesis under longer exposure to high temperature in field conditions is more complex since water and nutrient status of the plant are affected by temperature. The duration of active photosynthesis becomes shorter due to faster leaf senescence. During grain filling under higher temperature, decrease of non-structural carbon becomes faster, which indicate that carbon source for starch synthesis in endosperm depends more on reserved carbon in stem and leaf sheath to satisfy the increased carbon demand with accelerated grain filling. Further study is desired on the spatial and temporal substrate levels in endosperm as affected by temperature to clarify the involvement of limitation in substrate supply for starch synthesis. The results in separate high temperature treatment on panicle and vegetative organs showed that treatment on panicle had more pronounced effect on final grain size and quality although vegetative organs were also sensitive to temperature to less extent (Sato and Inada 1973). It has been reported that activity and expression of some key enzymes involved in starch synthesis from ADP-glucose and conversion of sucrose to ADP-glucose are lowered under high temperature in cereal grains. In rice, high temperature depresses the expression of granule-bound starch synthase I, branching enzymes, and ADP-glucose 5.

(22) pyrophosphorylase while enhances expression of amylase (Yamakawa et al. 2007). Since the expression of genes and enzymic activity are affected by the substrate levels, the interaction of source and sink ability in response to high temperature should be further studied.. ADAPTIVE MEASURES Cultivation methods The agronomic countermeasures against high temperature damage include shifting cropping seasons, improving crop, soil, and nutrient management. Escaping from high temperature from anthesis and early ripening stage by moving transplanting date is the first major way in cropping system. The most sensitive period to high temperature is first 20 days after heading for chalky grains. Lowering expected temperature in this critical period by delaying of transplanting date has been successful to improve grain quality to some extent. Low N status magnifies the deterioration of grain quality, especially enhancing white-backed and white-base grains. Application rate of N has been decreasing since 1980s because of consumer’s preference for low protein content in the grain. The low N application rate, in turn, induces the increased sensitivity to high temperature. Maintaining appropriate N status during ripening is important to maintain grain quality. Maintaining favorable soil conditions for root functions to ensure photosynthesis is important in soil management. Photosynthesis may be suppressed by high temperature due to reduced stomatal conductance, possibly related to the limitation of water uptake by root (Tsuno and Yamaguchi 1987). High soil temperature suppresses root growth (San-oh and Kondo 2006). Lowering soil temperature by cold water irrigation is effective to reduce fissured grain with the condition that water availability is not limited. The early drainage before harvest induces water stress that enhances deterioration of grain quality.. 6.

(23) Varietal improvement in grain quality Genotypic variations have been reported in sensitivities to high temperature in chalkiness and grain size. Genetic analyses for white-based and white-backed grains have been performed using japonica genotypes and several candidate QTLs were identified (Kobayashi et al. 2007, Tabata et al. 2007). Identification of the physiological functions of these QTLs is now under way. The genotypic differences in susceptibility to milky-white grains and grain size are less clear at present. Putative physiological and morphological traits related to the milky-white grain and grain size include stable sink ability under various temperature ranges, high source ability, low panicle temperature, and morphologies of the panicle and grain.. Future research In physiological aspects, detailed understanding is required to clarify key carbon metabolisms which confer stable grain development under high temperature and low radiation. Genotypic improvement in adaptability to high temperature in spikelet formation, sterility and grain filling under are desired using wider germplasms. Limited information is available in genetic diversity in optimum temperature in grain filling and photosynthesis. Understanding the genetic factor and agronomic measure to control stomatal conductance would be useful because it determines canopy temperature and also affect water use. Increasing temperature is anticipated to have not only negative impact, but also positive aspects such as expanding crop growing spell. Development of crop production system which maximizes beneficial effect of global warming should be also considered.. 7.

(24) REFERENCES Hasegawa T, Yoshimoto M., Kuwagata T, Ishigooka Y, Kondo M, Ishimaru T. 2008. The impact of global warming on rice production. Lessons from spikelet sterility observed under the record hot summer of 2007. NIAES Annual Report 2008, 23-25. http://www.niaes.affrc.go.jp/annual/r2008/index.html. Kobayashi AKobayashi A, Genliang B, Shenghai Y, Tomita K. (2007). Detection of quantitative trait loci for white back and basal-white kernels under high temperature stress in japonica rice varieties. Breed. Sci. 57: 107–116. Kondo M, Morita S, Nagata K, Koyama Y, Ueno N, Hosoi J, Ishida Y, Yamakawa T, Nakayama Y, Yoshioka Y, Ohashi Y, Iwai M, Odaira Y, Nakatsu S, Katsuba Z, Hajima M, Mori Y, Kimura H, and Sakata M. 2006 Effects of air temperature during ripening and grain protein contents on grain chalkiness in rice. Jpn. J. Crop Sci.75 Suppl.2:14-15. Kondo M, Kuwagata T, Ishigooka Y, Toritani H, Hasegawa T, Sasahara K, Ishimaru T, and Sanoh Y. 2007 Analysis on the effect of climatic conditions on the occurrence of milky white grain and white base grain using national statistical survey on rice. J. Crop Sci. 76 Suppl.1:210-211. Matsui T, Kobayashi K, Kagata H, and Horie T. 2005 Correlation between viability of pollination and length of basal dehiscence of the theca in rice under a hot-and-humid condition. Plant Prod. Sci. 8:109-114. Matsui T, Omasa K, Horie T. 2001 Comparison between anthers of two rice (Oryza sativa L.) cultivars with tolerance to high temperatures at flowering or susceptibility. Plant Prod. Sci. 4:36-40. Nagata, K., Takita, T.,Yoshinaga, S., Terashima, K., Fukuda, A. 2004. Effect of air temperature during the early grain-filling stage on grain fissuring in rice. Japanese Journal of Crop Science, 73:336-342. Nakagawa H, Horie T and Matsui T 2003 Effects of climate change on rice production and adaptive technologies. In “Rice Science: Innovations and Impact for Livelihood.” Mew, T.W., Brar, D.S., Peng, S., Dawe, D. & Hardy, B. eds., International Rice Research Institute, pp.635-658. Nishiyama I and Blanco L 1980 Avoidance of high temperature sterility by flower opening in the early morning. JARQ. 14:116-117. Peng S, Huang J, Sheehy JE, Laza RC, Visparas RM, Zhong X, Centeno GS, Khush GS, Cassman KG 2004. Rice yields decline with higher night temperature from global warming. Proc. Natl. Acad. Sci. USA 101:9971-9975 San-oh Y and Kondo M 2006 Effects of soil temperature on growth, grain quality and root function in rice. Jpn. J. Crop Sci. 75 suppl. 1:234-235. Sato K and Inaba K.1973. High temperature injuries to ripening of the rice plant. 2. The ripening of rice grains when panicle and straw were separately treated under different temperature. Proc. Crop Sci. Soc Jpn. 42:214-219. 8.

(25) Sato K and Inaba K. 1976. High temperature injuries to ripening of the rice plant. 5. An early decline of the assimilate storing ability of rice grains under high temperature. Proc. Crop Sci. Soc Jpn. 45:156-161. Satake T and Yoshida S 1978 High temperature-induced sterility in indica rices at flowering Jpn. J. Crop Sci. 47:6-17. Suzuki M. 1980. Studies on distinctive patterns of dry matter production in the building process of grain yields in rice plants grown in the warm region in Japan. Bull. Kyushu Nat. Agri. Exp. Sta. 20:429-494. Tabata M, Hirabayashi H, Takeuchi Y, Ando I, Iida Y, Ohsawa R 2007. Mapping of quantitative trait loci for the occurrence of white-back kernels associated with high temperatures during the ripening period of rice (Oryza sativa L.) Breed. Sci. 57: 47–52. Terashima K, Sato Y, Sakai N, Watanabe T, Ogata T, Akita S (2001). Effect of high air temperature in summer of 1999 on ripening and grain quality of rice. Jpn. J. Crop Sci.70:449-458. Tsuno Y and Yamaguchi T 1987 Relationship between respiratory rate of root and temperature modulated photosynthesis in rice plant and the factors concerning the respiratory rate of root. Jpn. J. Crop Sci. 56:536-546 Vong NQ and Murata Y 1977 Studies on the physiological charactereristics of C3 and C4 crop species. Jpn. J. Crop Sci. 46:45-52 Wang C, Yang J, Wa J, and Cai Q 2004 Influence of high and low temperature stress on fertility and yield of rice (Oryza sativa L.):Case study with Yangtze River rice cropping region in China. Abstract World Rice Research Conference 2004. p97. Yamakawa, H., T. Hirose, et al. 2007. Comprehensive expression profiling of rice grain filling-related genes under high temperature using DNA microarray. Plant Physiol. 144: 258-277. Zakaria S, Matsuda T, Tajima S, Nitta Y. 2002 Effect of high temperature at ripening stage on the reserve accumulation in seed in some rice cultivars. Plant Prod. Sci. 5:160-168.. 9.

(26) International Symposium (2009) Rice Research in the Era of Global Warming 10~16. Changes in water distribution of developing rice caryopses by high-temperature stress Tsutomu Ishimaru1,*, Akemi K. Horigane2, Masashi Ida1, Norio Iwasawa1, Yumiko A. San-oh1, Mikio Nakazono3, Naoko K. Nishizawa3, Takehiro Masumura4, Motohiko Kondo1, Mitsuru Yoshida2 1. National Institute of Crop Science, NARO, 2-1-18 Kannondai, Tsukuba, Ibaraki 305-8518, Japan 2 National Food Research Institute, NARO, 2-1-12 Kannondai, Tsukuba, Ibaraki 305-8642, Japan 3 Graduate School of Agricultural and Life Sciences, The University of Tokyo, Yayoi, Bunkyo, Tokyo 113-8657, Japan 4 Graduate School of Life and Environmental Science Kyoto Prefectural University, Shimogamo, Sakyo-ku, Kyoto 606-8522, Japan *Corresponding author: cropman@affrc.go.jp. ABSTRACT High-temperature stress during grain ripening causes formation of chalky grains through loose packing of amyloplasts. The presence of chalky grains decreases the value of rice in most of the world markets. In the present study, the changes in water distribution in rice caryopses under high-temperature stress were investigated by magnetic resonance imaging. Milky-white and white-cored types of chalky grains, which had chalkiness around the centre of the endosperm, were frequently formed in high-temperature condition. Magnetic resonance images of the early-stage caryopses in high-temperature condition showed the lower water content around the centre of the endosperm, where the single-shaped amyloplasts was observed by scanning electron microscopy. In the middle stage, water content in the central chalky part became higher than in the lateral translucent part. Pooling of water in the free spaces between the loosely packed amyloplasts in the.

(27) chalky part led the higher water content after the middle stage. The physiological mechanism for the formation of white-cored and milky-white grains that occurred under the high-temperature stress was discussed in relation to these observations. Keywords: Grain chalkiness, High-temperature stress, Magnetic resonance imaging, Rice, Water distribution. INTRODUCTION Recently rice plants are often exposed to high temperatures during grain ripening in Japan possibly owing to global warming. The exposure to high temperature shortens the period for grain ripening but causes the formation of chalky grains. Considerable effort has been expended to understand the underlying mechanism of the high-temperature induced grain chalkiness from morphological (Zakaria et al., 2002), transcriptional (Yamakawa et al., 2007), proteomic (Lin et al., 2005). and genetic (Kobayashi et al., 2007; Tabata et al., 2007) perspectives. During the ripening of cereal crops, a large amount of storage material accumulates in the seeds concomitantly with a decrease in water content. Magnetic resonance imaging (MRI) has led to the understanding of the precise water distribution in developing grains of barley (Kano et al., 1990; Glidewell, 2006) and rice (Horigane et al., 2001). However, these studies were conducted using caryopsis from normal condition; the relationship between change in spatial and temporal water distribution and the formation of grain chalkiness under high-temperature stress has not been studied yet. In the present study, the water distribution in developing rice caryopses exposed to high-temperature stress was investigated by MRI, and its relation to the formation of grain chalkiness was discussed. Of the various types of chalky grains, we focused on the formation of the milky-white grains and white-cored grains, which were chalky in the central portion.. 2.

(28) MATERIALS AND METHODS Oryza sativa ‘Koshihikari’ (Japonica rice variety) was used. At 3 or 4 days after flowering (DAF), plants were transferred into a naturally illuminated temperature-controlled chamber. Day (13 h) and night (11 h) air temperatures were maintained at 26 °C and 20 °C in the control treatment, and 33 °C and 27 °C in the high-temperature treatment, respectively. Samples were collected three times (early, middle and late) during the dry-matter accumulating stage for each treatment. MRI was performed using an NMR spectrometer (DRX300WB, Bruker, Karlsruhe, Germany) equipped with a microimaging accessory at a magnetic field of 7.1 Tesla. The water distribution in cross-sections was estimated from proton density weighted (PDW) images. The in-plane resolution for the PDW images was 39 × 39 μm2 and the slice thickness was 1 mm. At maturity, grain appearance was visually evaluated. Amyloplasts of perfect grains from the control treatment and white-cored/milky-white grains from the high-temperature treatment were examined by scanning electron microscopy (Real Surface View VE-7800, KEYENCE, Osaka, Japan).. RESULTS AND DISCUSSION Perfect grains were predominantly formed in control condition, while over half of grains had white-cored and milky-white types of chalkiness in high temperature condition (Fig. 1A-D). Scanning electron microscopic observation of fully matured grains revealed that the starch granules were tightly packed in the grains from the control group (Fig. 2A). In contrast, starch granules were loosely packed and had single-rounded amyloplasts in the central chalky area of grains from the high-temperature group (Fig. 2B) as reported previously (Lisle et al., 2000). These results suggested that plastid initiation (i.e. amyloplast number) or starch granule initiation would be affected in the early dry-matter accumulating stage in high temperature condition. 3.

(29) Control. A. High temperature. B. C. D. Fig. 1 Appearance of rice grains grown under control and high temperature condition. Typical appearance of grains (A, B) and median transverse sections of fully matured grains (C, D). Bar = 3mm. A. B. Fig. 2 Scanning electron micrographs of amyloplastss in the centre of matured grains from the control (A) and high-temperature (B) conditions.. Changes in water distribution in developing caryopses by high-temperature stress were investigated by MRI. In early dry-matter accumulating stage, the signal intensity was lower in grains from the high-temperature group than in those from controls especially along the dorso-ventral line (Fig. 3A, D), where coincided with the central chalky part of matured grains. This result suggested that the 4.

(30) lower water content of the central endosperm in the early stage of grain ripening in high-temperature condition might be related to the chalky centre through the formation of single-rounded amyloplasts. In contrast, the water content in the central core of the grain became higher in the high-temperature treated caryopses than in the controls in the middle stage (Fig. 3B, E). In the late stage, this pattern of water distribution was more clearly observed in the high-temperature treated caryopses than in the controls (Fig. 3C, F). Free water might have been pooled in the gaps between the loosely packed starch granules in the chalky area. This may be the reason for the higher water content in the core compared to the lateral parts for the high-temperature treated caryopses.. Early. Middle. Late. A. B. C. D. E. F. Fig. 3 PDW images of cross-sections of developing rice caryopses of controls (A, B, C) and high-temperature treated plants (D, E, F) in each dry-matter accumulating stage.. 5.

(31) CONCLUSION The present study clearly demonstrated the changes in water distribution of developing rice caryopses by high-temperature stress using MRI. The results indicated the possibility that disorganized formation of amyloplasts in the central endosperm of the grains from high temperature condition was due to rapid decline of water from early to middle stage. Further studies are needed to confirm our hypothesis that the water stress during the early stage of development is a cause of the hampered starch synthesis.. ACKNOWLEDGEMENT This work was supported by a Grant-in-Aid from the National Agricultural and Food Research Organization (NARO), Japan.. REFERENCES Glidewell, S. M. 2006. NMR imaging of developing barley grains. J. Cereal Sci. 43: 70-78. Horigane, A. K., W.M.H.G. Engelaar, S. Maruyama, M. Yoshida, A. Okubo and T. Nagata. 2001. Visualisation of moisture distribution during development of rice caryopses (Oryza sativa L.) by nuclear magnetic resonance microimaging. J. Cereal Sci. 33: 105-114. Kano, H., N. Ishida, T. Kobayashi and M. Koizumi. 1990. 1H-NMR imaging analysis of changes of free water distribution in barley and soybean seeds during maturation. Jpn. J. Crop Sci. 59: 503-509. Kobayashi, A., B. Genliang, Y. Shenghai and K. Tomita. 2007. Detection of quantitative trait loci for white-back and basal-white kernels under high temperature stress in japonica rice varieties. Breed. Sci. 57: 107-116. Lisle, A. J., M. Martin and M. A. Fitzgerald. 2000. Chalky and translucent rice grains differ in starch composition and structure and cooking properties. Cereal Chem. 77: 627-632. Lin, S. K., M. C. Chang, Y. G. Tsai and H. S. Lur. 2005. Proteomic analysis of the 6.

(32) expression of proteins related to rice quality during caryopses development and the effect of high temperature on expression. Proteomics 5: 2140-2156. Tabata, M., H. Hirabayashi, Y. Takeuchi, I. Ando and Y. Iida. 2007. Mapping of quantitative trait loci for the occurrence of white-back kernels associated with high temperatures during the ripening period of rice (Oryza sativa L.). Breed. Sci. 57: 47-52. Yamakawa, H., T. Hirose, M. Kuroda and T. Yamaguchi. 2007. Comprehensive expression profiling of rice grain ripening-related genes under high temperature using DNA microarray. Plant Physiol. 144: 258-277. Zakaria, S., T. Matsuda, S. Tajima and Y. Nitta. 2002. Effect of high temperature at ripening stage on the reserve accumulation in seed in some rice cultivars. Plant Prod. Sci. 5: 160-168.. 7.

(33) International Symposium (2009) Rice Research in the Era of Global Warming 17~30. Fine Mapping of the Giant Embryo Gene GE2 in Rice Yann-Rong LIN1,*, Shun-Hui CHIANG2, Yong-Pei WU3 1 2 3. Department of Agronomy, National Taiwan University, Taipei, Taiwan Department of Agronomy, National Taiwan University, Taipei, Taiwan. Taoyuan District Agricultural Research and Extension Station, Taoyuan, Taiwan Department of Agronomy, Chiayi Agricultrual Experiment Station, Taiwan Agricultural Research Institute, Chiayi , Taiwan *Corresponding author: ylin@ntu.edu.tw. ABSTRACT Giant embryo rice enriched with micro-nutrients can promote nutrition level of rice, and breeding of giant embryo rice is an important task.. A new giant. embryo variety, Tainung 78 developed by mutagenesis breeding, exhibits similar phenotypes of agronomic traits but 3~5 fold large embryo size to those of its derived parent, Tainung 72.. After linkage analysis of 46 F2 individuals of TNG. 78 × TCS 17, the mutated gene conferring giant embryo was coarsely mapped in the interval between RM243 and RM420 on the long arm of chromosome 7, which was different position from the GE, and was temporally named as GE2. By employing additional 87 F2 individuals and 5 markers to fine map GE2, the chromosome segment encompassing GE2 was confined to 170 kb and contained 24 candidate genes after annotation. High resolution mapping by using more individuals and markers and sequencing the candidate genes are subjected to touch the target gene. Once GE2 isolated via this positional cloning strategy, we can elucidate the mechanism of GE2 how it enlarges embryo size under gene function and regulation.. In the meanwhile, the two flanking markers of GE2,. CH0709 and CH0720, are subjected to rice breeding programs to breed more.

(34) giant embryo varieties. Furthermore, we are attempting to pyramid GE2 and the golden rice gene of Tainung 76, GR1 to purple rice CNY941201, to promote the nutrition of rice. Key words: Giant embryo, Genetic mapping, Marker-assisted breeding, Rice, Tainung 78 (TNG 78).. INTRODUCTION Rice, domesticated 9000 years ago, is the most important crop and is cultivated between 55°N and 36°S latitudes in various environments, such as irrigated, rainfed and floodprone ecosystems. There are two cultivated rice species, Oryza glaberrima cultivated only in Africa and Oryza sativa with two major subspecies, japonica and indica, widely cultivated mostly in Asian and other parts of the world (Khush 1997). More than three billion people in the world rely on rice, providing 23 % of calories consumed by human (Khush 2003).. On the other. hand, about 90% of rice is produced in Asia (Fisher et al. 2000), providing up to 35~60% of the total calories consumed by Asians (Khush and Brar 2002). The edible endosperm contains carbonhydrate with majority which provides daily calories; on the other hand, rice embryo contains several micronutrients such as fatty acid, vitamins B and E, nicotana, and so on.. Giant embryo with enlarged. embryo size can promote the nutrition of rice. The giant embryo mutant of Kinmaze, induced by NMU (N-methyl-N-nitrosourea), enlarged embryo size of 2~3 fold embryo and increased the total fatty acid from 2.6% to 3.91% (Satoh and Omura 1981; Sato and Iwata 1990).. Giant embryo rice with enlarged embryos. enriches gamma-amino butyric acid (GABA) content in pre-germinated seeds (Yutaka et al. 1994), which is good for decreasing cholesterol and increasing antioxidants in vivo (Lee et al. 2007). 18.

(35) Three QTLs affecting embryo length mapped on chromosomes 1, 2, and 3, and three QTLs affecting embryo width mapped on chromosomes 2, 8, and 10, respectively, were identified from a japonica/indica cross (Dong et al. 2003). GE, a giant embryo locus with four mutant alleles (ge-2, ge-3, ge-4, and ge-5) induced by NMU, was reported and mapped on chromosome 7.. The giant embryo was. the consequence of enlarged scutellum and degenerated endosperm (Hong et al. 1995; 1996). Six giant embryo lines with 2~5 fold enlarged embryo size were selected and breed from japonica Tainung 72 induced by NMU (Wu and Lur 2002), and one of six was entitled as Tainung 78. In this study, we mapped the giant embryo locus of Tainung 78 by linkage analysis of genotypes of the giant embryo and molecular markers from segregating F2 populations.. The flanking. markers of the giant embryo locus can be implemented marker-assisted selection in rice breeding to breed more elite cultivars possessing enlarged embryo.. MATERIALS AND METHODS Plant Materials The panicles of 20 individuals, after 10 hours of self pollination, of Oryza sativa ssp.. japonica. cv.. Tainung. 72,. TNG. 72,. were. soaked. in. 1. mM. N-methyl-N-nitrosourea (NMU) for 4 hours; rice panicle were washed by running water about 6 hours and were planted in greenhouse to harvest M1 seeds in the first crop season, 2002. Approximate 4000 M1 were grown in paddy rice field of Chiayi Agricultural Experiment Station, Chiayi, Taiwan. The M1 plants were self pollinated, and three seeds of each M1 hill were randomly picked and bulked together. Approximate 4000 M2 individuals were planted in field in the first crop season 2003 and were screened for the desirable phenotype, giant embryo. Six M3 lines exhibiting giant embryo were consequently selected to self and propagate by pedigree method. The embryo size of the selected giant embryo 19.

(36) mutant line, entitled Tainung 78 (TNG 78), is about 3~5 fold larger than that of normal TNG 72 seeds. To achieve the goal of fine mapping the mutated gene conferring giant embryo, the giant embryo variety TNG 78 was crossed to ssp. indica cv.Taichung Sen 17 (TCS 17), and the F1 progenies were selfed to obtain F2 seeds. About 46 and 600 F2 individuals for coarse and fine genetic mapping were planted in paddy rice field of Chiayi Agricultural Experiment Station in the second crop seasons of 2007 and 2008, respectively.. Genetic Mapping of the Giant Embryo Gene Molecular Marker Assay The rice genomic DNA extraction was adopted the procedures of Li et al. (1995) with modification for mini-preparation. Approximately 0.02~0.1 gram of fresh tissues of 6- ~ 8-week-old young seedlings was homogenized in 900 μl of extraction buffer(100mM Tris, pH 8.0; 50 mM EDTA, pH 8.0; 500 mM NaCl; 1.25% SDS; fresh-made 0.38% of NaHSO3) at a frequency of 30 1/s for 2 min by TisseLyser (Qiagen, Germany). The homogenized leaf tissues were incubated at 65℃for 30 min with twice gently inverted mix, and was subsequently added with 270 μl of 5 M KOAc, which was set on ice for 20 min.. The supernatants were. saved after centrifugation at 15,000 rpm for 10 min at 4℃, and 700 μl of ice-cold isopropanol was consequently added to precipitate DNA. DNA pellets were washed with 70% of ethanol, air dried, and dissolved in 100 μl of TE buffer. Two types of public PCR-based markers, simple sequence repeat from Gramene (SSR; McCouch et al. 2002, IRGSP 2005) and sequence tagged site (STS) from Rice Genome Research Program, were first used to survey polymorphic markers between the parents, TNG 78 and TCS 17.. If the linkage distances of two. adjacent polymorphic markers were larger than 20 cM, we designed indel 20.

(37) markers, affixed by CH, SLS, and STS, based on blast genomic sequences of japonica cv Nipponbare version 5 against indica 9311. A polymorphic sequences with longer than 10 bp were selected and designed primers by using Primer3 on the basis of the flanking sequences of indels for PCR products of 100~300 bp after application.. A total of 22 newly designed polymorphic markers were. subjected to coarse genetic linkage analysis of GE2 (Table 1). PCR was performed in 25 μl of reactions containing 0.2 μM of each primer, 200 μM deoxyribonucleotides, 1× Taq buffer, 0.5 unit of GeneTaq DNA Polymerase (GenePure Tech, Taiwan), and 40-60 ng of rice genomic DNA.. The PCR profile. was: 94℃ for 5 min, followed by 35 cycles of 94℃ for 1 min, 55℃ for 1 min, 72℃ for 2 min, and finally by 5 min at 72℃ for the final extension (Biometra, German).. PCR products subsequently were run on 2.5% agarose at 250V for. 14~23 min, using FEBE electrophoresis system (Faster Easier Better Electrophoresis, Biokeystone, California, USA).. Genetic Mapping of the Giant Embryo Gene A total of 84 DNA makers including 47 SSR, 15 STS, and 22 indel markers were applied to the F2 segregating population of 46 F2 individuals for coarse linkage mapping analysis.. The genotype of the giant embryo gene of each F2 individual. was predicted by the segregation ratio of embryo size of its 50 seeds. The putative genotypes of giant embryo accompanied with genotypes of 84 markers were employed for linkage analysis, which was performed by the program MAPMAKER/EXP version 3.0 (Lander et al. 1987), using the Kosambi function (Kosambi 1944).. The LOD threshold was fixed at 3.5, markers are unlinked. while genetic distance more than 40 cM. For fine mapping, additional 87 F2 individuals and five markers in the target region were applied to narrow down the chromosome segment encompassing the giant embryo gene. 21.

(38) Physical Mapping Analysis of the GE2 Locus To find out the physical position of GE2, the primer sequences of flanking markers were used as queries to search the japonica cv Nipponbare sequence database by BLASTN.. The BAC/PAC contig encompassing were consequently. identified, which was based on the rice pseudomolecules (release 5) based on the IRGSP minimum tilling path in representing the 12 rice chromosomes (IRGSP 2005). and. was. retrieved. from. Rice. Genome. Annotation. (http://rice.plantbiology.msu.edu/). RESULTS Inheritance of Giant Embryo of TNG 78 The giant embryo variety, Tainung 78 (TNG 78), was derived from Tainung 72 induced by NMU and breed by pedigree selection.. The agronomic traits of TNG. 78, such as plant height, heading date, days to maturity, are similar to those of TNG 72.. There is no significant difference in grain shape of grains and brown. rice of TNG 72 and TNG 78, neither (Fig. 1). However, the embryo sizes of TNG 72 and TNG 78 are distinguishable that the embryo size of TNG 78 about 3~5 fold larger due to mutation (Fig. 1). The rice bran of TNG 78 including embryo contain enriched total of fatty acids, total of protein, minerals, amino acids, vitamin E, and other micronutrients (data not shown). After six-year selection and purification, the maturity, morphologies and agronomic characters of TNG 78 resemble those of its derived parent, TNG 72, in field trials for the following years. TNG 72 exhibit enlarged embryo in every crop seasons, which implies that the inheritance of giant embryo of TNG 78 is stable. From the segregation ratio of normal to large embryo in the F2 segregating population of TNG 78 × TCS 17 indicated the mutated allele resulting enlarged 22.

(39) Table 1. The newly designed polymorphic markers between Tainung 78 and Taichung Sen 17. Positiona Forward sequence. Primer. Chr. Reverse sequence. STS322. 1. 10.9. AAGCTTTGACTTGTATTGCAC TTTGTATCATGTTCCCAATTC. STS326. 1. 55.7. GCTCAGTATATTACGGTGGAA GGGAAGTAAATTGAATTGGTT. STS420. 1. 157.6. ATTACCGACAGCAATAGTTCA CACAGGTCATACACCATCTTT. STS307. 2. 118.1. GGCTGTTCCTACTTCCTAGTC GCCTTATCCTGTACTTACACC. STS331. 3. 91.1. TGGGAGTGACAACTCATCTAC ACACCAGCAAATCAGATACAT. SLS178. 3. 115.6. AGAAGAGTTACCTCCATCCT. SLS189. 4. 28.6. ATCAGAATATTCGGGAAAAG TTGTATACTCATTATGTAAATGGA. STS332. 4. 97.4. ACAAACAGTTGTATCACTGGG GAGAGCTAACGTCCTTGATTT. STS344. 4. 108.2. GTCGAGAGCAACACAATACA TTAGATCATGATTCGGAAATG. STS230. 5. 67.5. TATATGGATCATCATGTGCAA TCACAAACATCTGTGTGCAG. STS358. 6. 96.5. CTCATGACCCTCATAGAGCTT TTAAGATGACATTAAATCACAC. SLS164. 7. 41.7. CTGCATATTTTCCCCTATTA. GGACAAGGCACTAATACAGT. CH0866. 8. 0.5. CTCCTTTCCCAATCTTACCT. GCGCATGCAGTATTATGTTA. SLS182. 8. SLS188. 8. CH0862. 8. SLS506. 9. 45.2-49.3 ATCTCTCTAATCTTGCTGGCT TCCGTAACCCAAATAAACATA. SLS510. 9. 58.3-60.8 TCAATTTGTGGGTTAGGTTTA AACTGTGATTATCAACACGC. CH1105. 11. 2.5-2.8. CH1106. 11. 57.3. TGTTCTCTAGGGGAACAAAA ATGCCTTTTTCGTAGGTGTA. SLS173. 11. 91.4. ACCCCTACCTCTACTAGTGC. SLS167. 12. 39.4. GCAATAAAAACATAAAAGCA TAAAAATATGCTGAGCAGTC. 21.6-25.2 ATCCTGACCTCTTGTTCTAC 92.2. AGGCTTCAAGTTATTGCTAA. TTAACATAGAAGACCATACGC. GGCATCAGTAAGACACAATA AATGAATCTGTCTAGATTGG. 105.7-106.1 GAAGACGAGTGAGGTCAGAA TCCAATAAAACTGAGGCTGT. TCGTTTCCTTCAAAACCTTA. TTCGGTTGAACTGATAAATGT. CGGTTTGGGTGATAATATAG. a The linkage map position of the markers are referred to IRGSP after blasting its primer sequences against BACs.. 23.

(40) Fig. 1. The morphologies of seeds, brown rice and polished grains of TNG 72 (left ) and TNG 78 (right).. Coarse Genetic Mapping of the Giant Embryo 2 A total of 84 PCR based markers, including 47 SSRs, 15 STS, and 22 indels, were subjected for coarse genetic mapping Giant Embryo2, GE2. Exclude chromosome 12 with one marker, the average interval of genetic distances of each chromosome ranged from 10.3 cM to 24.07 cM, with an average of 17.41 cM, based on the marker position aligned to the rice high-density linkage map published by Harushima et al. (1998) (Table 2).. 24.

(41) Table 2. The markers employed to construct linkage analysis of GE2. Genetic marker Chr. Average genetic distance (cM). SSR. STS. Indel. subtotal. 1. 5. 3. 3. 11. 20.41. 2. 9. 0. 1. 10. 17.09. 3. 4. 3. 2. 9. 15.12. 4. 3. 1. 3. 7. 17.35. 5. 4. 2. 1. 7. 14.80. 6. 6. 0. 1. 7. 17.71. 7. 5. 1. 1. 7. 24.07. 8. 3. 1. 4. 8. 18.53. 9. 2. 2. 2. 6. 19.68. 10. 3. 1. 0. 4. 10.30. 11. 3. 1. 3. 7. 16.44. 12. 0. 0. 1. 1. -. Total. 47. 15. 22. 84. 17.41. The coarse genetic linkage analysis was performed by 46 F2 individuals of TNG 78 × TCS 17.. The recombination frequencies of genotypes of 84 markers and. the putative genotypes of GE2, which predicted by the segregation ratio of embryo size in approximate 50 F3 seeds of each F2 individuals, were analyzed by MAPMAKER/EXP version 3.0 (Lander et al. 1987) using the Kosambi function (Kosambi 1944). The GE2 was resided in the interval of RM234 and RM420 on the long arm of chromosome 7, 9.0 cM away from RM234 and 17.8 cM from RM420 (Fig. 2).. 25.

(42) Fine Genetic Mapping of Giant Embryo2 Additional 87 out of 600 F2 of TNG 78 × TCS 17 planted in the 2nd crop season of 2008 were incorporated with five newly designed polymorphic markers in the target region to narrow down the chromosome segment encompassing GE2. GE2, flanking by CH0709 and CH0720, is confined in an interval of approximate 170 kb (Fig. 2). The target region of GE2 is covered by three BACs and encloses 20 genes, 3 putative/hypothetic genes, and one retrotransposon, annotated by MSU Rice Genome Annotation (Osa1) Release 6.1 (http://rice.plantbiology.msu.edu/cgi-bin/gbrowse/rice/).. Fig. 2. The genetic and physical maps of Giant embryo 2 (GE2).. 26.

(43) DISCUSSION Giant embryo rice enriched with total proteins, total fatty acids, vitamins, and GABA content in pre-germinated seeds. How to enlarge embryo size is an important task in rice breeding.. It is not common to find giant embryo rice from. natural germplasm because rice grains with large embryo are usually accompanied with small endosperm, leading to poor germination.. Mutagenesis. breeding by using chemical mutagens which results few mutations are adopted in giant embryo.. A famous Japanese lowland rice cultivar with giant embryo,. Hamiminori, was bred by the cross EM40 and Akenohoshi which EM40 was derived from Kinmaze induced by NMU (Hiroshi et al. 2001).. Several new. indica and japonica varieties were developed by mutagenesis in China, too (Zhang et al. 2007; Piao et al. 2009). In Taiwan, one of the authors, Y.-P. Wu who is a rice breeder, used NMU to induce TNG 72 and selected from 6 lines exhibiting giant embryo following by the pedigree method. One of six giant embryo mutant lines has 3~5 fold enlarged embryo was claimed as variety TNG 78 in 2009. TNG 78 possesses similar phenotypes of the agronomic traits to its derived parent TNG 72, such as plant height, heading date, yield components, and aroma (Fig. 1). As the high potential nutrition of giant embryo rice, TNG 78 can be utilized in enriching human nutrition as a daily food and as nutrition supplements by brown rice tea bag, healthy nutrition addition agents, and germinated rice. The locus of GE2 was coarsely mapped in the interval 26.8 cM, between RM234 and RM420 on the long arm of chromosome 7, corresponding to the interval of 14.4 cM from 93.9 cM (RM234) and 118.3 cM (RM420) on the long arm of chromosome 7, with an interval of 14.4 cM, based on the rice high-density linkage map published by Harushima et al. (1998) (Fig. 2). The discrepancy in 27.

(44) interval lengths of RM234 and RM420 is because of different numbers of F2 individuals and different parents used in crosses. The alternative possibility was 46 individuals subjected to coarse mapping were pre-selected for giant embryo phenotype, leading to higher local recombination rates surrounding GE2. The locus of GE with four alleles was mapped at the interval of 86.7 cM and 93.0 cM of chromosome 7 by means of high resolution mapping and physical mapping (Nagasawa et al. 2002). The linkage maps of GE and GE2 are slightly different that GE2 might be a new locus corresponding to enlarged embryo size. GE2 was fine mapped in a 170-kb chromosome segment by recombination study of additional 87 F2 individuals and 5 markers. The candidate genes were delimited to 20 genes and 3 hypothetic/putative genes. Further investigations of high-resolution mapping by more recombinants and high-density markers to confine the target region with less candidate genes, consequently on positional cloning of the isolation gene, are being carried out to elucidate the gene function and regulation of GE2. The ‘alteration of plant embryo/endosperm size during seed development’, including giant embryo GE with four alleles, is patented (WO/2007/070687, 2007; US7,582,817 B2, Sep. 1, 2009).. Thus, the flanking. markers of GE2, CH0709 and CH0720, can be implemented to rice breeding programs to breed more varieties with enlarged embryo by marker assisted selection as foreground selection. In addition, the flanked markers of the giant embryo can be incorporated with the functional marker of golden rice gene GR1 of japonica Tainung 76, a sodium azide derived from japonica Tainung 67, to introgress into a purple pericarp line, CNY941201, to promote nutrition of rice which can alleviate malnutrition as rice for the major staple food.. 28.

(45) ACKNOWLEDGMENTS The authors appreciate Su-Chen Kou for technical assistance and Sheng-Wei Ho for making tables and figures.. REFERENCES Dong, Y., E. Tsuzuki, H. Kamiunten, H. Terao, and D. Lin. 2003. Mapping of QTL for embryo size in rice. Crop Sci. 43:1068-1071 Fisher, K.S., J. Barton, G.S. Khush, H. Leung, and R. Cantrell. 2000. Genomics and agriculture collaborations in rice. Science 290：279-280. Harushima,Y., M. Yano, A. Shomura, M.Sato, T. Shimano, Y. Kuboki, T. Yamamoto, S.Y. Lin, B.A. Antonio, et al. 1998. A high-density rice genetic linkage map with 2275 markers using a single F2 population. Genetics. 148: 479–494. Hiroshi, N., I. Shuichim. Hideo, I. Takuro, N. Nobuoki, H. Takafumi, S. Makoto, O. Masahiro, and Y. Taiji. 2001. A new rice cultivar with giant embryo "Haiminori". Bulletin of the Chugoku National Agricultural Experiment Station 22: 25-40 (in Japanese with English abstract) Hong, S.K., H. Kitano, H. Satoh, and Y. Nagato. 1996. How is embryo size genetically regulated in rice? Development 122: 2051-2058. Hong, S.K., T. Aoki, H. Kitano, H. Satoh, and Y. Nagato. 1995. Phenotypic diversity of 188 rice embryo mutants. Dev. Genet. 16: 298-310. IRGSP. 2005. The map-based sequence of the rice genome. Nature 436: 793-800. Khush, G.S. 1997. Origin, dispersal, cultivation and variation of rice. Mol. Biol. 35: 25-34. Khush, G.S. 2003. Productivity improvements in rice.. Plant. Nutr. Rev. 61：S114-116.. Khush, G.S. and D.S. Brar. 2002. Biotechnology for rice breeding: Progress and potential impact. In: Proceeding of the 20th Session of the International Rice Commission (23rd - 26th July, 2002, Bangkok, Thailand). Kosambi, D.D. 1944. The estimation of map distances from recombination values. Ann. Eugen. 12: 172-175 Lander E.S., P. Green, J. Abrahamson, A. Barlow, M.J. Daly, S.E. Lincoln, and L. Newburg. 1987. MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural 29.

(46) populations. Genomics 1: 174-181 Lee, Y.R., C.E. Kim, M.Y. Kang, and S.H. Nam. 2007. Cholesterol-lowing and antioxidant status-improving efficacy of germinated giant embryonic rice (Oryza sativa L.) in high cholesterol-fed rats. Ann. Nutr. Metab. 51: 519-526. Li, Z.K., S.R.M. Pinson, M.A. Marchetti, J.W. Stansel, and W.D. Park. 1995. Identification of QTL for heading date and plant in rice using RFLP markers. Theor. Appl. Genet. 91: 382-388 Matsuo, T., H. Satch , K. Yoon , and T. Omura. 1987. Oil content and fatty acid composition of a giant embryo mutant (English summary on p191). Japan J. Breed 37: 185-191. McCouch S.R., L. Teytelman, Y. Xu, K.B. Lobos, K. Clare, M. Walton, B. Fu, R. Maghirand, Z.K. Li, Y.Z. Xing, Q. Zhang, I. K ono, M. Yano, R.F. Jellstrom, G. DeClerck, D. Schneider, S. Cartinhour, D.Ware, and L. Stein. 2002. Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.). DNA Res. 9: 199-207 Nagasawa, N., Y. Nagato, and H. Sakai. 2002. Physical mapping of the GIANT EMBRYO gene in a highly recombinogenic region of chromosome 7. Rice Genet. Newsl. 19: 45 Piao, Z., J. Zhang, J. Lu, C. Zhu, and Z. Zhang. 2009. Breeding and application of functional japonica rice Jupeijing 1 with giant embryo. China Rice 2009 (3): 34-35 (in Chinese). Satoh, H. and Iwata N. 1990. Linkage analysis in rice. On three mutant loci for endosperm properties, ge (giant embryo), du-4 (dull endosperm-4) and flo-1(floury endosperm-1). Japan J. Breed. 40: 268-269 Satoh, H. and T. Omura. 1981. New endosperm mutations induced by chemical mutagens in rice. Japan J. Breed 31: 316 -323. Wu, Y.P. and H.S. Lur. 2002. Rice mutation breeding. Chinese Agron. J. 12: 219-239. (in Chinese with English abstract) Yutaka, M., H. Toshiroh, and S. Takayo. 1994. Accumulation of γ-aminobutyric acid (Gaba) in rice germ during water soaking. Biosci. Biotechnol. Biochem. 58: 2291-2292. Zhang, Q., S. Zhang, R. Huang, G. Lin, and R. Yang. 2007. Induced mutation and genetic analysis of giant embryo in indica rice. Scientia Agricultura Sinica 40: 1309-1314. 30.

(47) International Symposium (2009) Rice Research in the Era of Global Warming 31~42. Marker-assisted selection for biotic stress tolerance in rice: current status and emerging needs Casiana M. Vera Cruz, Kshirod K. Jena, IL Ryong Choi, Darshan S. Brar Hei Leung* Division of Plant Breeding, Genetics and Biotechnology, International Rice Research Institute, DAPO 7777, Manila, Philippines *Corresponding author: h.leung@cgiar.org. Introduction Because of the intensive studies done on host plant resistance and host-pathogen interactions for some rice pathosystems, many useful resistance genes and markers are available in rice. This makes it possible to practice marker-assisted selection (MAS) for disease resistance breeding at a relatively early stage. Beside scientific advances, there are also practical reasons why MAS is particularly relevant for breeding for biotic stress tolerance: •. Most disease assays require the use of pathogens and insects, which are often variable and contribute considerable variation in the phenotypic evaluation. In some cases, the pathogens and insects as screening agents are geographically limited due to quarantine measures.. •. Interactions between host and pathogen often exhibit strong epistasis; i.e. resistance tends to mask the phenotypic expression of other genes. Thus, gene pyramiding is possible only through the use of genetic markers.. •. In the case of insect-transmitted viruses, phenotypic evaluation is further complicated by the complex interactions of host, vectors, and viruses.. These limitations can be addressed by using genetic markers as a surrogate for the target phenotype. Thus, MAS is used not only as a tool to increase efficiency but an essential approach for achieving a breeding objective. However, no MAS will be successful if the genes/markers do not represent high-quality genes expressing.

(48) the appropriate spectrum of resistance. In this brief review, we will discuss the current status of MAS applications for key disease and insect pests of rice, the ongoing needs, and emerging challenges.. Bacterial blight resistance: a successful case of MAS in rice breeding MAS in bacterial blight (BB) is the most advanced in rice breeding program, both in terms of science and in producing commercial products. A number of releases with different Xa combinations have been made in the past decade. The pathway to success dated back to over 20 years ago when a concerted effort was made to produce a comprehensive series of near-isogenic lines for all bacterial blight resistance genes (Xa). In retrospect, the key features for success may include the following: •. A strong research environment exists for studying host-pathogen interactions of bacterial blight, leading to many mapped and cloned Xa genes, hence providing either very tightly linked or gene-based markers. A list of widely used genes is summarized in Leung (2008).. •. Most of the discovered Xa genes are bred into the indica recurrent parent IR24, a variety with wide adaptability and high agronomic qualities. This breeding-ready background accounts for the extensive use of Xa genes in breeding programs of both the public and private sectors. Recurrent parents in japonica (Toyonishiki) and indica-japonica (Milyang 23) backgrounds were also made.. •. Extensive testing data on individual Xa genes and gene pyramids across locations.. •. A capacity building network sustained continuously for 9 years by the Asian Rice Biotechnology Network. It facilitated distribution of NILs and gene pyramids, provided training and capacity building, and on-site technical backstopping to breeding programs. 32.

(49) These positive attributes appear simple, yet establishing such a system requires an understanding of the biology of the pathosystem, systematic development of specialized genetic stocks, and a network to evaluate and disseminate the genes/breeding lines and appropriate diagnostic BB strains. Yet, even with this successful record, bacterial blight has not disappeared as a problem. There is a continuing need for different combinations of Xa genes to cope with new virulences and changing production system. This is particularly evident in India and China.. Bacterial blight is a key problem in the fast. expanding lowland rice production in western Africa. Because of the generally low level of resistance in many hybrid rice varieties, bacterial blight is expected to become more prominent with the spread of hybrid rice technology. This will require an increased effort to incorporate Xa genes into parental lines for both 3way (CMS line) (Borines et al, 2008; Agarcio et al, 2007) and 2-line hybrids (Perez et al. 2008).. Blast Just like the Xa genes, many blast resistance genes Pi have been reported in the literature. However, the use of MAS in blast resistance breeding has lagged behind bacterial blight. There are at least two reasons for this gap. First, breeding for blast resistance cannot follow the simple pyramiding of major R gene as in bacterial blight. The blast fungus appears to have a dynamic genome with great capacity to change in response to R genes deployed in rice varieties. Consequently, breeding for blast resistance requires a diversity of Pi genes and QTL. Second, many Pi genes have been bred into the genetic backgrounds of Co39 (indica type) and LTH (japonica type) because of their wide-susceptibility to blast (Fukuta et al 2004, Kobayashi et al, 2007; Fukuta et al, 2009). This comprehensive series of NILs and monogenic lines are ideal materials for genetic studies but less so for varietal development because they do not have the wide agronomic adaptability, such as IR24. 33.

(50) Table 1. Pi-genes used in breeding program of NARES partners. Near-isogenic line Pi-gene. Designation. Donor. Chro Class of gene. LTH. CO-39. US-2 BC4F1. Being used in breeding. Piz. IRBLz-Fu. Fukunishiki ML: IRBLz-Fu. 6. -. BC3F1 -. -. Pish. IRBLsh-S. Shin 2 MlL: IRBLsh-S. 1. -. BC3F1. BC6F14 BC4F1. Philippines BC3F1. Pi1. IRBL1-CL (C101LAC). C101LAC ML:IRBL1-CL (C101LAC). 11. -. BC6F16 -. BC6F14 -. Indonesia; BC6F7 India. Pi3. IRBL3-CP4 (C104PKT). Pai-kan-tao ML: IRBL3-CP4 (C104PKT) Taebeg. 9. -. BC6F16 BC6F15. BC4F1 -. Vietnam BC4F1 -. Piz-5 = Pi2. IRBLz-CA (C101A51). C101A51 ML: IRBLz-CA. 6. BC6F16 -. BC6F14 -. Indonesia BC4F1. Pi5(t). IRBL5-M. RIL249 (Moroberekan) ML:IRBL5-M (RIL249). 9. BC6F16 -. BC6F14 -. BC6F8. Pi9(t)a. IRBL9-W. Oryza minuta WHD-IS-75-1-127 ML:IRBL9-W (WHD-IS-75-1127). 6. BC6F16 -. BC3F1. India BC6F7. Pik-p. IRBLkpK60. HR 22 K60 ML:IRBLkp-K60 (K60). 11. -. BC3F1. BC6F14 -. BC6F7. Pik-h. IRBLkh-K3. HR 22 K3 ML: IRBLkh-K3 (K3). 11. -. BC6F14 -. BC6F14 -. Bangladesh BC6F7. pi21. -. Owarihatamochi. Proline-rich protein. -. -. Pi36. -. Kasalath. Rice coiled-coil-. -. -. -. -. 8. NBS-LRR (Nbs4-Pi2) -. NBS-LRR (Nbs2-Pi9). NBS-LRR, resembles Mla1 and Mla6 than Pita, Pib, Pi9,. -. -. -. -. Japan. None None; evaluated against Chinese isolates. and Piz-t.. Pi40(t). IR65482-4136-2-2b. O. australiensis (Acc. 100882). 6. NBS-LRR motifs. 34. -. -.

(51) Recent developments in blast research provide new opportunities to implement MAS in blast resistance breeding: 1. Increasing amount of experimental data has enabled us to distinguish high-quality Pi genes (Table 1). Some of these genes have been cloned, hence providing gene-based markers for use (Liu et al. 2009). 2. Blast resistance QTL are available that can provide broad-spectrum resistance—e.g. germin and germin-like protein, complex gene loci together give QTL effect (Manosalva et al, 2009; Carrillo et al, 2009). 3. Novel genes conferring broad-spectrum disease resistance have been identified. One such example is pi21, a resistance gene that provides stable blast resistance in upland rice grown in Japan. (Fukuoka et al, 2009). Unlike the “traditional” R genes with NBS-LRR domains, the wild type Pi21 gene encodes a proline-containing protein such that a recessive mutation of the gene confers partial resistance. It would be interesting to introduce pi21 into multiple genetic backgrounds and agronomic settings. Because gene-based markers are available, production of gene pyramids can be accelerated by marker-assisted selection and without total dependency on phenotypic evaluation.. It means that genotypes can be constructed with. combinations of multiple R genes and QTL.. Brown Planthoppers (BPH) Application of MAS for selection of insect resistance is most advanced for gall midge because of the strong interaction phenotypes between gall midge and rice. The observations so far suggest a gene-for-gene interaction similar to that found in highly specialized host-pathogen interactions. For tropical Asia, the key insect problem amenable to a MAS breeding approach is brown planthopper because the number of genes identified for BPH is high (Yencho et al, 2000; Jena et al, 2006; Rahman et al, 2009). Recent study has evaluated the virulence of laboratory strains of the BPH (Nilaparvata lugens) and the whiteback planthoppers 35.

(52) (Sogatella furcifera) collected between 1966 and 2005 using rice differential varieties carrying different planthopper resistance genes. The study suggested that long-term mass rearing in the laboratory has not affected virulence status, thus will be useful in analyzing resistance genes against BPH and WBPH (Myint et al, 2009). Resistance from wild rices has become the potential for exploring novel genes. Of 21 BPH resistance loci, 11 have been identified from wild rice species; they are Bph10 (O. australiensis), Bph12(t) (O. latifolia), Bph13(t) in chromosome 2 (O. eichingeri) and another Bph13(t) in chromosome 3 (O. officinalis), Bph14 and Bph15 (O. officinalis), Bph18(t) (O. australiensis), bph11(t) and bph12(t) (O. officinalis), Bph20(t) and Bph21(t) (O. minuta). Major genes conferring BPH resistance in several cultivated rice and wild species have been mapped with markers that will facilitate MAS for BPH resistance (Jena et al, 2006). Also, there is an on-going effort to produce series of NILs carrying important Bph resistance genes. We foresee a growing need for MAS for insect resistance breeding. For example, the donor cultivar Rathu Heenati carrying Bph3 was combined with KDML105 essential grain quality traits. The linkage drag between Bph3 and Wxa alleles was separated by phenotypic and MAS (Jairin et al, 2009). All introgression lines from this population showed broad spectrum resistance against BPH populations in Thailand and had grain quality similar to KDML105.. Tungro viruses Since the 1990s, a number of tungro resistant varieties has been developed by direct phenotypic screening. Initially, most selected varieties were resistant to the green leafhopper (GLH). Emphasis was later shifted to resistance to tungro viruses (e.g., the development of Matatag 1). However, there is difficulty in conducting screening because the phenotypic assay is often based on the percent of plants showing symptom expression within a line. The complexity of the 36.