中國醫藥大學機構典藏 China Medical University Repository, Taiwan:Item 310903500/41366
全文
(2) Contents ठᖴ............................................................................................................................. IV ύЎᄔा!)Bctusbdu!jo!Dijoftf* .......................................................................... V Abstract ...................................................................................................................... VI Introduction .................................................................................................................. 1 Characteristics and epidemiology of Campylobacter jejuni .............................. 1 Virulence factors of Campylobacter jejuni.......................................................... 2 (1) Flagella .............................................................................................. 2 (2) Enterotoxin ....................................................................................... 3 (3) Lipopolysaccharide (LPS) ............................................................... 3 (4). Cytotoxin ........................................................................................... 4. Cytolethal distending toxin (CDT) ..................................................................... 4 Characteristics of nanoparticles ......................................................................... 6 Materials and methods ................................................................................................ 8 Antibodies ............................................................................................................. 8 Bacterial strain and culture ................................................................................ 8 In vitro cell culture system ................................................................................... 8 Construction and protein purification of CDT subunits .................................. 9 Generation of anti-serum against each CDT subunit ..................................... 10 Protein concentration and quantification ........................................................ 10 Preparing of chitosan/heparin nanoparticles .................................................. 11 Preparing of CdtB-loaded nanoparticles ......................................................... 11 Western blot analysis ......................................................................................... 12 Cell viability assay.............................................................................................. 12 In vitro cellular uptake and CLSM visualization ............................................ 13 Flow cytometry analysis .................................................................................... 13 Contrast microscopy .......................................................................................... 14 Determination of the mitochondrial membrane potential ............................. 14 Measurements of reactive oxygen species (ROS) ............................................ 15 Statistical analysis .............................................................................................. 15 Results ......................................................................................................................... 16 Discussion.................................................................................................................... 21 References ................................................................................................................... 26. Ŋ.
(3) Table Contents Table 1. Campylobacter jejuni’s source and host-related disease. .......................... 31 Table 2. Particle sizes and zeta potentials of nanoparticles prepared with different chitosan and heparin concentrations in deionized water (n = 5). ......... 32 Table 3. Particle sizes and zeta potentials of the prepared bacterial toxin-loaded nanoparticles in deionized water (n = 5). ................................................ 33. ŊŊ.
(4) Figure Contents Figure 1. The infection routes of Campylobacter jejuni. (Adapted from (86)) .... 34 Figure 2. The polydispersity index (left panel) and transmission electron microscopy examination (right panel) of CdtB-loaded chitosan/heparin nanoparticles. ............................................................................................. 35 Figure 3. Determination of CdtB by using SDS-PAGE and western bloting. ...... 36 Figure 4. Confocal microscopy analysis of Nanoparticle -CdtB delivery. ............ 37 Figure 5. Detection the efficiency of CDT holotoxin or Nanoparticle -CdtB delivered into cells. .................................................................................... 38 Figure 6. Nanoparticle -CdtB induced cell cycle arrest at G2/M phase in AGS cells. ............................................................................................................. 39 Figure 7. Cells were detachment after Nanoparticle -CdtB treatment for 24 to 72 hours. .......................................................................................................... 40 Figure 8. The effects of Nanoparticle -CdtB on cell viability in AGS cells. .......... 41 Figure 9. Nanoparticle -CdtB induced apoptosis of human gastric adenocarcinoma cells................................................................................. 42 Figure 10. Bax, Bak, Bcl-2 activation are involved in Nanoparticle -CdtB mediated cell apoptosis in human gastric adenocarcinoma cells. ......... 43 Figure 11. Depiction of the mechanism of Nanoparticle-CdtB delivers into host cell nucleus and induces cell apoptosis. ................................................... 44. ŊŊŊ.
(5) ठᖴ! ࣴزғఱޑ೭ٿԃǴךவচҁᚸᔉคޑޕঁཥᗲΓǴډޔΕჴᡍ࠻ࡕ ډڙԴৣॺࡰޑᏤаϷᏢߏࡰޑॺۆ௲Ǵωᅌᅌԋߏय֧ǴډӵϞךջஒவύ୯ ᙴᛰεᏢǴӧᏢය໔࣬ޑךགᖴࡰޑךᏤԴৣǴᒘݞדԴৣǹдჹޑך ᜢЈค༾όԿǴӧғࢲᜢЈޑךᔮٰྍǴӧჴᡍԴৣόѝࢂ๏ΑࡘךԵޑ БӛǴΨ๏ΑךӭޑЍکႴᓰǴததӧჴᡍၶ֚ډᜤਔǴԴৣᕴҔྕࢋ ޑઓ࣮ךћךόाᎨӆуݨӆոΚǴВதғࢲΨόਔޑፎॺךӞസ ǴගਁޑॺךγǴךளૈӧ CHL lab.ύᏢಞࢂޑҹࡐ۩ᅽޑ٣Ƕ CHL lab.ޑᏢߏॺۆᗋԖ୷ᙴޑӕᏢॺǴգॺޔ๏ΑࡐךӭޑᔅշၟႴ ᓰǴჴᡍၶډόၱਔǴգॺᕴ๏ࡐךӭࡌޑᡣૈךӧၶ֚ډნਔճޑ ၸǴᖴᖴߓ୯Ꮲߏǵॕ൛ǵ෩෩ǵࢽەӧჴᡍ๏ޑךᔅշǹќѦ lab.္ޑᏢ ࡐॺۂགᐟգॺӧزࣴךғఱٿޑԃύᇙΑόϿޑઢǴᡣךӧჴᡍ࠻္ޑ ঁВηкᅈઢǴᖴᖴޑεᏢᏢۂǴᗋԖৎᅺǵଁᅴǵࢅኾǵᆢΥǵ ΚӹǵᲹฑǵۗǴӢࣁԖգॺωᡣך೭ٿԃၸளߚதޑкჴکඍזǹԜѦ෯Դ ৣৎޑᏢߏॺۆΨࡐᖴᖴգॺ๏ޑךᔅշǴόᆅࢂӧჴᡍࢂ܈ғࢲǴεᓐᏢ ߏǵλϺᏢߏǵਜჱǵਁሎགᖴգॺᡣزࣴޑךғఱوள׳уճѳᛙǴᗋԖᖴ ᖴᏢᏂǴᖴᖴգᜫཀ᠋ךϩ٦ࣴزғఱޑϺǴഉوךၸ܌Ԗόᆅࢂઢᗋࢂ ఽНޑВηǴࡐޑᖴᖴգǶ നࡕךाձགᖴޑךৎΓǴᖴᖴݿ༰ჹޑךЍǴགᖴாॺᕴࢂӧךङࡕ ᓨᓨޑЍךǴ๏҅ךय़ޑΚໆǴாॺჹޑךхᆶႴᓰࢂֹךԋᅺγᏢޑ നεচΚǴᗋԖךനངߓޑᓽǴᖴᖴாਔόਔޑᜢЈޑךғࢲǴᜢЈޑךፐǴ ᡣךӧѠύΨགډڙৎΓჹޑךᜢᚶྕکཪǴߚதགᖴךғڮύޑঁΓǴӢ ࣁԖգॺךωૈճֹޑԋᏢǴᖴᖴգॺǶ. Ŋŗ.
(6) ύЎᄔा!)Bctusbdu!jo!Dijoftf*! ԔఎࢂШࣚനதЇଆΓᜪဎᘞޑठੰϐǴѬёаӧΓᡏύЇଆ ӭόӕޑ੯ੰǴхࡴगݹǵဉगݹǵ௳Ոੱکᝄख़ޑઓس੯ੰǴٯӵ Guillian-Barré ੱংဂǶӧԔఎޑӭठੰӢηύǴҞаಒझठԝဍࢥ ન (cytolethal distending toxin, CDT)ࣴޑزനࣁᄇǴCDT ӧਡಒझύ ԋಒझޑဍǴԶᇨᏤಒझຼයଶᅉӧ G2 ਔයനࡕ٬ளಒझوӛΫޑᐒ ڋǶӃزࣴޑჴ CDT ࢂҗΟঁԛൂϡ܌ಔԋǴϩձࣁ CdtAǵCdtB کCdtCǴ CdtA کCdtC ೭ঁٿԛൂϡࢂתᄽ่ӝډಒझጢ߄य़ޑфૈǴԶ CdtB ࣁಒझ ठԝဍࢥનύॄೢሇનࢲޑ܄ԛൂϡǴCdtB ڀԖૈ٬ DNA ཞ ޑDNase IǴ٠Ъૈ٬ಒझຼޑයኩଶǶ ӧҁࣴزύޑќঁЬڼࢂفԯᗭಈǴڼԯᗭಈကۓޑကࢂځελѸϟ ܭ0.1-100nm ϐ໔ǴԶڼԯᗭಈӧ߈ԃٰቶޑݱᔈҔӧӭόӕޑሦୱύǴх ࡴΑғނᙴᏢǴӀᏢکႝηሦୱǴ҅ࢂӢࣁѬڀԖޑወӧૈΚߚதёᢀǴӢԜӧ ӭޑᙴᏢࣴزύࢂ׳ճҔΑѬ༾λаϷૈឫᛰ ࢂ܈ނsiRNA ૈޑΚٰ ׳ుΕޑᔈҔǶ ҁጇჴᡍύǴॺךճҔڼԯᗭಈࣁඹж CdtA کCdtC ೭่ঁٿӝԛൂϡ ٰၮଌ CdtB ΕಒझਡύǴӧჴᡍύ္ॺךҔΑႜඔӅ೫ขᡉ༾᜔ (confocal laser scanning microscopy)ᢀჸڼԯᗭಈхᙟ CdtB ӧಒझύޑϩѲǴว ΑԖ CdtB ڼޑԯᗭಈޑዴԖᆶಒझਡख़᠄ޑຝౢғǴԶќѦӧࢬԄಒझ ሺޑϩॺךวΑڼԯᗭಈхᙟ CdtB ޑዴჴԋΑಒझ DNA ޑᘐǴԶᏤ ठಒझຼයଶᅉӧ G2/M ਔයǴќѦӧՋБᙯᅄݤаϷࢬԄಒझሺޑϩϐΠ׳ วΑԖڼԯᗭಈхᙟ CdtB നࡕᏤठΓᜪगҜಒझوӛΫޑ৩ǴԶ ЪКၨಒझೀ CDT ӄࢥનԶقǴԖ׳ӳࢥޑఠᕎಒझϐਏΚǴӢԜҁፕЎΨ ჴڼԯᗭಈхᙟ CdtB ёᔈҔܭဍዦಒझݯޑᕍǶ ŗ.
(7) Abstract Campylobacter jejuni (C. jejuni) is one of the most common cause of infectious diarrhea world-wide. This bacterium can induce various diseases in human including gastritis, gastroenteritis, septicemia, and serious neurological disorder like Guillian-Barré. syndrome.. The. most. important. virulence. factor. of. C.. jejuni—cytolethal distending toxin (CDT), which can cause cell distending and induce cell-cycle arrest as well as apoptosis in eukaryotic cells. Previous studies have been demonstrated that CDT was composed by three subunits, CdtA, CdtB, and CdtC. Among those three subunits, CdtA and CdtC were served as the binding unit which associated with the cell surface. While the catalytic subunit CdtB, which was homology to type I deoxyribonuclease (DNase I) and phosphatidylinositol 3, 4, 5-triphosphate phosphatase enzymes, have the ability to degrade DNA. Translocation of CdtB into nucleus induced cell cycle arrested at G2/M phase. However, none of report explored the molecular mechanisms of CDT in its biological applications. Nanoparticle is defined as a microscopic particle with at least one dimension less than 100nm. Nanoparticle is widely used in researches, due to its wide variety of potential applications in various areas including biomedical, optical and electronic fields. Current researches indicated that nanoparticle could act as a carrier or encapsulated some drugs or siRNA into the target cell. In our preliminary investigation, we use chitosan/heparin nanoparticles to replace the binding subunit CdtA and CdtC for encapsulation of CdtB subunit and delivery nito host cells to achieve the same delivery effect as CdtA-CdtC complex. We developed novel pH-responsive CdtB/chitosan/heparin nanoparticles in the therapeutic effects in gastric cancer cells. The delivery efficiency of CdtB-loaded nanoparticles for tumor ŗŊ.
(8) therapy is currently under investigating.. ŗŊŊ.
(9) Introduction Campylobacter spp. is a bacterium that was first recognized as a cause of human gastrointestinal illness in 1975 (1). Previous report indicated Campylobacter spp. is one of the major cause of infectious diarrhea world-wide, ahead of salmonella and shigella (2), and it’s the most commonly reported bacterial cause of food-borne illness in the United States (3). Campylobacter spp. infection is also an important pre-condition for Guillian-Barré syndrome (4). This bacterium can gain the entry into host intestinal epithelial cells, which was thought to be important for its persistent infection and induction of clinical outcomes both in human and animals (Table 1) (5).. Characteristics and epidemiology of Campylobacter jejuni Campylobacter spp. is a Gram-negative bacterium which is curved, rod-shaped, and non-spore forming bacteria. Apart from the genus Campylobacter, the group also contains Arcobacter and Helicobacter. Arcobacter are closely related to Campylobacter, and can cause intestinal infection in human, too. Helicobacter pylori is well known as major causative pathogen for gastritis and peptic ulcer disease (6). The natural habitat for Campylobacter spp. is the intestine of birds and warm-blooded animals including sea gulls and other wild animals or poultry. In addition, different types of Campylobacter spp. can infected with different hosts. For example, Campylobacter jejuni can cause disease not only in human but also in beast animal and pets. Furthermore, Campylobacter fetus was found can infect of beast animals such as cattle and sheep. It has also been reported that this bacteria can induce various types of clinical outcomes in human including gastritis, gastrointestinal, septicemia, and serious neurological disease like Guillian-Barré syndrome (7). 1.
(10) Campylobacter jejuni is a microaerophilic pathogen, which requires an environment containing a reduced concentration of 5-7% oxygen and 10% carbon dioxide with optimal growth temperature 37-42°C. The width and length of the cells varies from 0.2-0.5Pm and 1.5-1.6 Pm, respectively. The motility of C. jejuni is mediated by single polar flagellum. They do not metabolize sugars and use intermediates of the TCA cycle as source of energy (8). When C. jejuni exposed in some special environment such as high oxygen-containing or other improper environment may leads C.jejuni to become coccoid form, that will trigger C. jejuni to enter viable but none-culturable (VNC) state (9). The routes of Campylobacter transmission include person-to-person, fecal-oral, unpasteurized raw milk and waterborne (such as contaminated water). Consumption of improperly cooked, contaminated foodstuffs or food products which from infected animals also can transmits of Campylobacter organisms to human (Figure 1) (10).. Virulence factors of Campylobacter jejuni Most of the bacteria can infect human or animals and cause severe disease. The mechanisms they use to infect host is usually linked to their virulence factors. The virulence mechanisms is contributing to the pathogenesis of the disease. In general, the virulence factors of C. jejuni used including:! (1) Flagella Flagella is the most important factor associated with bacteriaum motility, and it’s also playing an essential role in C. jejunis’ adhesion and colonization of the host intestinal epithelial cells (11). C. jejunis’ flagella was controlled by two important gene, flaA and flaB, the major component of the flagella is flagellin, which was encoded by flaA and flaB (12).!C. jejuni have one or both ends unsheated single flagella, which can help C. jejuni attaching to intestinal 2.
(11) epithelial cells, thus promote the invasion of C. jejuni. Base on 1999 Wassenaars’ research, the authors suggested that the ability of C. jejunis’ adhesion and colonization has obvious decrease when flaA and flaB gene were mutated (13). Thus, indicating that flagella may play an important role for bacterial-induced pathogenesis of host. (2) Enterotoxin Enterotoxin is a protein toxin which secreted by several bacterial microorganisms. This toxin is a small molecular with heat stable and water-soluble characters. It’s comprises of two subunits: subunit A and subunit B. The larger subunit A has enzymatic activity, and the smaller subunit B is a pentamer, which is receptor binding-related. After toxin binding to the receptor, the activity subunit A will be transported into the host cell and promotes signaling responses, subsequently increase the level of intracellular cyclic AMP, resulted in ions and water exffluxed from epithelial cells. This may cause watery diarrhea, and has been demonstrated by exposed cultured Chinese hamster ovary (CHO) or rounding of mouse adrenal tumor cell (Y-1) (14). (3) Lipopolysaccharide (LPS) Lipopolysaccharide is a major component in the outer membrane of gram-negative bacteria cell wall. LPS classified as an endotoxin which can improve pathogens infection to the host cells and trigger a severe immune response. This toxin consisted of a hydrophobic domain lipid A and a hydrophilic domain polysaccharide. The lipid A is composed by a long-chain fatty acid which is an important factor for induction of inflammatory responses. The polysaccharide domain consists of two regions, one core domain and one O-antigen. The core structure has a high reservation formed by a hexose include a octose. In addition, the O-antigen has a high variability which has the different 3.
(12) components in different species (15). After microorganisms infection of the host cells, LPS can secret from the bacterial cell wall and induce serious disease such as sepsis, fever and eventually shock (13). (4) Cytotoxin C. jejuni can produce several cytotoxins which were reported and summarizes in an article by Wassenaar in 1997 (14) including: (1) 70-kDa cytotoxin, (2) cytolethal distending toxin (CDT), (3) Shiga-like toxin,. (4). hemolytic cytotoxin, and (5) hepatotoxin. Cytolethal distending toxin and hemolytic cytotoxin are well investigated in recent years. First introduce the hemolytic cytotoxin, in 1990 Arimi S.M. found that C. jejuni can secret hemolysin which has the ability to destruct the erythrocytes, current research indicating. this. behavior. was. cause. by. the. phospholipase. A and. siderophore-binding protein which can hydrolysis the cell membrane and then disintegrate the cell membrane, finally destruction of the cells (16,17).. Cytolethal distending toxin (CDT) Several virulence factors in Campylobacter were found to contribute the bacteria survival and establishment of disease in the host. Our current study is focuing on one of C. jejuni’s virulence factor—cytolethal distending toxin (CDT). CDT was first published in 1988 by Johnson and Loir, who indicated this toxin secreted by E. coli and different from heat-labile toxin, heat-stable toxin, verotoxin, and hemolysin (18). CDT can cause Chinese hamster ovary cells (CHO cells) to be obviously distending. At the same time, CDT has been found in C. jejuni (19), and then CDT was continually found in other gram-negative bacteria such as Actinobacillus actinomycetemcomitans (20,21), shigella dysenteriae (22), haemopholus ducreyi (23), and subsets of Helicobacter species (24,25), Interesting, all of these bacteria are 4.
(13) belong to diarrheal disease- causing enteropathogens. CDT is a tripartite protein toxin encode by three genes- cdtA, cdtB and cdtC, with molecular weights of 30, 28 and 21 kDa, respectively (26), CDT holotoxin appears to function as an AB2 toxin in which CdtA and CdtC serve as the binding units which associate with the cell surface and delivering of CdtB into the target cells. CdtB is the activate unit which can enter the host cell and induce genotoxic effectsġ (27,28). Indeed, a wide range of CDT can induce genotoxic effects including CHO cells, HeLa cells, Hep-2 cellġ (human epidermoid cancer cells), Vero cell (African green monkey kidney cell), and CaCO-2ġ (human kerationcyte cell line). (18-20). Previously study also shown that lymphocytes are the most sensitive cells upon CDT treatment (29). CDT not only can cause cell distending but also can induce chromatin condensation and cleavageġ(30). Previous study described the CDT can mediate secretion of interleukin-8 (IL-8) from intestinal epithelial cellsġ(31,32) as well as induce cell cycle arrest at G2/M phase (20,33,34), Since CDT toxicity is associated with cell cycle arrest, subsequently may cause activation of the apoptotic cascade (35,36). CdtA and CdtC are not only required for the toxin to associate with cells but also necessary to localize the toxin to lipid membrane microdomains (29,37). These two subunits increase the ability of CdtB to associate with host cell and greatly enhanced intoxication (38,39). The catalytic subunit CdtB has homology to type I deoxyribonuclease (DNase I) and phosphatidylinositol 3,4,5-triphosphate phosphatase enzymes which was found can degrade DNA (28,40). Upon CdtB entering into host cells, CdtA and CdtC remain associated with the cell surface. The translocation of CdtB into the nucleus subsequently induces cell cycle arrest at the G2/M phase. Thus, resulting in cellular distension and ultimately cell death (41). In 1998, Whitehouse indicate that C. jejuni can trigger cells to accumulate the inactivated, phosphorylated from of cell-division cycle 2(CDC2) and thus to become irreversibly block in the 5.
(14) G2/M phase of the cell cycle (42). However, CdtB without binding subunit CdtA and CdtC, this is not able to cause cell cycle arrest (43,44). Further study demonstrated that mutation of the conserved sites which is necessary for CdtB catalytic activity will prevent the induction of double-strand breaks as well as chromatin disruption. (30) According to the previous studies, we thus considered CdtB could play an important role in CDT holotoxin in the induction of genotoxic effects of host cells.. Characteristics of nanoparticles Nanoparticles (NPs) are defined as microscopic particles with at least one dimension less than 100nm, which with a positive surface charge and were stable at pH 1.2-2.5 (45,46). Recently, nanoparticle is widely used in a lot of research, due to a wide variety of potential applications in areas including biomedical, optical and electronic fields. Several previous studies have been described that the mechanisms of nanoparticles in the cancer therapy (47-51). Moreover, nano-drug carriers have been widely used in biology and medicine. Current researches indicated that nanoparticles could be a carrier or encapsulated some drugs or siRNA into the target cell (50,52,53). The nanoparticles consist of chitosan and heparin can protect the drug form destruction by gastric acids and increase the ability to adhere to the gastric cells (54). Nanoparticles containing a positive surface charge which can penetrate into the gastric epithelial cell through the mucus layer and become unstable and disintegrates because of its pH sensitivity. When delivering into cells, the carried drug will release from the nanoparticles, therefore, to achieve the complete therapy (54). Chitosan is a hydrophilic biopolymer with a polycationic, non-toxin, biodegradable polysaccharide and mucoadhesive polymer. The property of chitosan is safe for human and stable in natural environment (55,56). The other component in nanoparticles is heparin, which is a polyanionic mucopolysaccharide with low 6.
(15) molecular weight around 15kDa. Recently, heparin is becoming a famous anticoagulant which have the ability to stimulate gastric ulcer recover, and it’s also associated with mucosal regeneration, proliferation, and angiogenesis (57-59). Gastric cancer is the second most common cause of cancer-related death in the world. In 1994, H. pylori is declared as a group I carcinogen for gastric cancer, and the 4th leading cause of cancer death in Taiwan (60). The correlation of H. pylori etiology and gastric cancer was virtually certain. In addition, inherited predisposition, environmental factors, smoking, drunk, diet, as well as pressure were thought to be associated with gastric cancer. Because of the high prevalence of gastric cancer in Asian has been became a severe issue worldwide. Development of effective therapeutic methods and low manufacture costs for the eradication of gastric cancer is urgently required. Combination with these features, in the present study we utilized the nanoparticle to substitute the CDT binding subunit (CdtA and CdtC) for delivering the activity subunit (CdtB) into host cells. Our current study indicated that nanoparticle-loaded CdtB harboring activity to induce the genotoxic effects in human gastric adenocarcinoma cells.. 7.
(16) Materials and methods Antibodies Antibodies specific for Bcl-2 family including Bax, Bak and Bcl-2 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-caspase-3 and anti-Poly(ADP-ribose) polymerase (PARP) were purchased from BioLegend (San Diego, CA), anti-caspase-9, phospho-ATM, phospho-H2A.X, phospho-Chk2 was purchased from Cell Signaling (Danvers, MA).. Bacterial strain and culture C. jejuni strain 7729 was isolated from patients’ feces, identified, and stored at the Chang Gung Memorial Hospital (Taoyuan, Taiwan) (61). The bacterial strain was grown on Brucella blood agar plates (Becton Dickinson, Franklin Lakes, NJ) supplemented with 10% sheep blood and 1.5% agar in a microaerophilic atmosphere at 37°C for 1 to 2 days.. In vitro cell culture system The AGS cell line (ATCC CRL 1739; human gastric adenocarcinoma cell) purchased from Food Industry Research and Development Institute. The cell were cultured in F12 medium (Invitrogen, CA, USA) supplemented with 10% Fetal bovin serum (HyClone, Logan, UT, USA), penicillin (100U/mL), and streptomycin (100Pg/mL) (GIBCO BRL) were add in culture medium after nanoparticle treatment and maintained under 37°C under 5% CO2 condition.. !. 8.
(17) Construction and protein purification of CDT subunits Recombinant His-tagged CDT subunits were cloned following standard protocols. DNA fragments of cdtA, cdtB, and cdtC were derived from PCR amplification of C. jejuni 7729 genomic DNA. The forward and reverse oligonucleotide primers were cdtA-F (CATGCCATGGCTTGTTCTTCTAAATT TGAAAATGT) and cdtA-R (CCGCTCGAGTCGTACCTCTCCTTGGCGATATA) for PCR amplification of the cdtA sequence; cdtB-F (CATGCCATGGCTAATTTAGAAAATTTTAATGTTG GC) and cdtB-R (CCGCTCGAGAAATTTTCTAAAATTTACTGGAAA) for cdtB sequence; cdtC-F (CATGCCATGGCTACTCCTACTGGAGATTTGAAAGA) and cdtC-R (CCGCTCGAGTT CTAAAGGGGTAGCACTG) for cdtC sequence. Each cdt fragment was inserted into pET21d (Invitrogen, CA, USA) using NcoI and XhoI. Briefly, cdtA was amplified using primers cdtA-F and cdtA-R by PCR at 95°C 10 min for one cycle; 35 cycles at 95°C for 1 min, 55°C for 1min, and 72°C for 2 min; and a final extension 72°C for 20 min. The NcoI/XhoI fragment was then ligated into pET21d to create the CdtA expression plasmid. Similar protocols were used to obtain the CdtB and CdtC expression plasmids from C. jejuni 7729 using primer pairs: cdtB-F and -R, and cdtC-F and -R, respectively. The PCR program used to amplify cdtB and cdtC were the same as cdtA. The nucleotide sequence of each cdt constructs were verified using the ABI Prism Dye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer Corp, Norwalk, CT) in an automated DNA sequencer (model 377-96; Perkin-Elmer Corp). Sequence analysis was performed by the University of Wisconsin Genetics Computer Group (Madison, WI) package. E. coli BL21-DE3 cells harboring either cdtA, cdtB, or cdtC expression plasmid was induced at OD600 of 0.8 by 0.5 mM of isopropyl β-D-thiogalactopyranoside (IPTG) at 37°C for 3 h. The expressed His-tagged CdtA, CdtB, and CdtC fusion proteins were. 9.
(18) purified by metal affinity chromatography (Clontech, Palo-Alto, CA) and assessed by SDS-PAGE.. Generation of anti-serum against each CDT subunit Each purified CDT subunit (1 μg) was used to immunize a 6-week-old BALB/C mouse. All of the mice were purchased from the National Laboratory Animal Center (Taipei, Taiwan). The mice were immunized at weeks 0, 2, 4, 6, 8, 10, and 12, and the titer of the antiserum was detected at weeks 7, 9, 11, and 13. Mice were maintained in the animal center of China Medical University (Taichung, Taiwan). All procedures were performed according to the “Guide for the Care and Use of Laboratory Animals” (National Research Council, USA) and were approved by the animal experiment committee of China Medical University (Taichung, Taiwan). The titers of antibodies against the CDT subunits in the serum were determined by Enzyme-linked immunosorbent assay (ELISA). Ninety-six-well plates were coated with 500 ng of purified recombinant CDT subunits and blocked with 2% BSA in TBS (0.1 M Tris-HCl pH 7.5, 0.03 M NaCl). Serial dilutions of the antiserum (1:1,000, 1:2,000, 1:4,000, 1:8,000, and 1:16,000) in TBS-Tween 20 were added to each well. Bound antibody was detected by HRP-conjugated secondary antibodies (Invitrogen, CA, USA) and quantified by measuring the optical density at 450 nm after development with the TMB substrate buffer system (Kirkegaard & Perry Laboratories, Gaithersburg, MD).. Protein concentration and quantification Each recombinant protein was concentrated using centrifugal filter (Millipore, MA, USA) 4000 rpm. at 4°C. After centrifuge for 2 h, the purified protein was. harvested and added PMSF (0.2 mM) to prevent protein degradation. The 10.
(19) concentration of each CDT subunit was then quantified using Pierce BCA Protein Assay Kit (Thermo, IL, USA) following by manufacturer’s manual protocol.. Preparing of chitosan/heparin nanoparticles The nanoparticles were prepared by a simple ionic gelation method with magnetic stirring at room temperature. In brief, aqueous heparin (1.0 mg/mL, 2 mL, pH 7.4) will add by flush mixing with a pipette tip into aqueous chitosan at various concentrations (0.3, 0.6, 0.9, 1.2 or 1.5 mg/mL, 10 mL, pH 6.0). The nanoparticles produced will be collected by ultracentrifugation at 15000 rpm for 50 min. The supernatant will be discarded and the nanoparticles will be resuspended in deionized water for further studies. The size distribution and zeta potential of the particles in deionized water, will then be determined with a Zetasizer (Malvern Instruments Ltd., Worcestershire, UK) (62,63) and the morphology of the prepared nanoparticles will be examined by transmission electron microscopy examination. The nanoparticle suspension will be placed onto a 400 mesh copper grid coated with carbon. About 2 min after deposition, the grid will be tapped with a filter paper to remove surface water and positively stained with an alkaline bismuth solutionġ(64).. Preparing of CdtB-loaded nanoparticles To study the loading efficiency of CdtB from test samples (chitosan/heparin nanoparticles), the cdt–encapsulated nanoparticle system will be prepared. The 0.1 mL of CdtB at various known concentrations (24.0, 12.0, 6.0, and 3.0 by mg/mL) was premixed with a heparin solution (2.0 mg/mL 0.1 mL) and added to a chitosan solution (1.2 mg/mL, 1.0 mL) under magnetic stirring as described before (n = 5). To determine the loading efficiency, the CdtB-loaded nanoparticles will be collected by ultracentrifugation at 15,000 rpm, 4ɗ for 50 min, and the concentration of free CdtB in 11.
(20) the supernatant will be determined by Elisa analysis. The CdtB loading efficiency of nanoparticles will be determined as described in the literature and calculated from the following equation (65,66):. Total amount of protein – free protein Loading efficiency =. Total amount of protein. u 100%. Western blot analysis AGS cells were treated with CDT holotoxin or NP-CdtB for the indicated periods, the cells were washed with PBS and added 1mL lysis buffer for 10 min at 4°C. Cell lysates were then collected and subjected to Western blot analysis. The samples were then resolved by 12% SDS-PAGE and transferred onto polyvinylidene difluoride membranes (Millipore, MA, USA). The membranes were incubated with primary antibodies, and then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Invitrogen, CA, USA). The proteins of interest were visualized using the ECL Western Blotting Detection Reagents (GE Healthcare, Piscataway, NJ) and detected using X-ray film (Kodak, Rochester, NY).. Cell viability assay The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay was used to test the cytotoxicity of CDT holotoxin or NP -CdtB in AGS cells. AGS cell were seeding in 96 well culture plate (4Ø104/200Pl/well) overnight allow the cell to attach to the wells, the medium was replaced with HBSS solution (containing 50mM glucose, pH 6.5) that contained various concentrations of NP-CdtB, after 2 hours remove the NP -CdtB, wash twist with PBS. The cell incubated in new medium for 24 hours, then remove the medium, add the new medium containing MTT (final 12.
(21) concentration 5mg/mL) (Sigma-Aldrich) solution incubate for 2-4 hours allow the ability of viable cells to reduce MTT to formazan, and then dump off the liquid add 100ml 2-propanol and HCl mixture, after pipetting completely the optical density was read with the BioRad spectrophotometer at a wavelength 570nm.. In vitro cellular uptake and CLSM visualization AGS cells were seeding on 12-well plates and treated for specific times with NP-CdtB at a concentration of 0.5 mg/mL. After incubation, the cells were washed three times with PBS and solubilized with 1 mL of 0.5% Triton X-100 in 0.2 M NaOH. The cell-associated test samples were quantified by analyzing the cell lysates in a microplate spectrofluorometer. To track the internalization of the NP-CdtB, the cells were seeded onto glass coverslips at a density 3 × 105 cells/cm2 and incubated for two days. The test samples (0.5 mg/mL) were then added to the cells for specific times. After incubation, the test samples were aspirated. The cells were then washed three times with PBS before they were fixed in 3.7% paraformaldehyde. The cells were washed again three times with PBS and permeabilized with 0.2% Triton X-100 for 15 min at 37 °C. The washes were repeated and the cells were stained with DAPI, which specifically bind to the nucleus. The stained cells were examined with excitation at 340, 488 and 543 nm, under a CLSM (Confocal laser scanning microscopy). The images were superimposed with the LCS Lite software (version 2.0).. Flow cytometry analysis AGS cells treated with CDT holotoxin or NP-CdtB were analyzed by flow cytometry. Cells were pretreated with HBSS for 1 h, washed, and exposed to CDT holotoxin or NP-CdtB subunit for an additional various time points. Cells were 13.
(22) harvested and fixed with ice-cold 70% ethanol for 1 h. Cells were then stained with 20 μg/ml propidium iodide (Sigma-Aldrich) containing 1 mg/ml RNase (Sigma-Aldrich) for 1 h. The stained cells were analyzed with an FACScalibur flow cytometer (Becton-Dickinson, San Jose, CA). The data were collected using 10,000 cells from each sample, and analyzed using Cell Quest software WinMDI (Verity Software House, Topsham, ME). All samples were examined in triplicate from at least three independent experiments. The data represent one of three independent experiments.. Contrast microscopy In this study the contrast microscopy was utilized to observe the cell morphology after treatment of cells with CDT holotoxin or NP-CdtB. AGS cells were seeded at 4x105 in the 6 well plates for 48 h. AGS cells were rinsed three times with pre-warmed HBSS solution (Invitrogen, CA, USA, containing 50mM glucose, pH6.5) and incubated for another 30 min at 37°C. The cells were then incubated with HBSS (containing 50mM glucose, pH6.5) containing NP-CdtB at 37°C. After 2 h incubation, the culture supernatant was carefully removed and replaced with fresh culture medium containing penicillin (100U/mL), and streptomycin (100Pg/mL) (AMRESCO, Solon OH, USA) for 24-72 hours. The cell morphology was observed by contrast microscope (Carl Zeiss, Göttingen, Germany). The images were captured and analyzed by the Axiovision software (Carl Zeiss).. Determination of the mitochondrial membrane potential AGS cells were first seeding in 6-well culture dishes and treated with CDT holotoxin or NP-CdtB for 24 hours. The mitochondrial membrane potential (ΔΨm) was assessed using a fluorometric probe JC-1 (Calbiochem, CA, USA), with a positive charge of a mitochondrial-specific fluorophore, indicated by a fluorescence 14.
(23) emission shift from green (525 nm) to red (610 nm). After incubation, cells were stained with JC-1 (5 μg/ml) for 30 min at 37oC. Samples were analyzed by FACScan using an argon laser (488 nm). Mitochondrial depolarization is specifically indicated by a decrease in the red to green fluorescence intensity ratio and analyzed by a FACScan and the Cellquest program (Becton Dickinson; Lincoln Park, NJ, USA).. Measurements of reactive oxygen species (ROS) In order to determine the quantify of ROS produced by the AGS cells, the H2O2 concentration. within. the. AGS. cells. were. measured. by. 10. μM. 2,. 7-dichlorodihydrofluorescein diacetate (H2DCFDA; Molecular Probes Inc., Eugene, OR, USA) for 30 min. The fluorescence intensities were obtained by recording the FITC fluorescence. AGS cells were washed twice with cold PBS and incubated in cold PBS containing 10 μM H2DCFDA at 37oCġġ after 30 mins, cells were collected and analyzed by a FACScan and the Cellquest program (Becton Dickinson; Lincoln Park, NJ, USA).. Statistical analysis The in vitro statistical analysis between two samples was performed using Student’s t-test. In vitro statistical comparisons of more than two groups were performed using one-way analysis of variance (ANOVA) test. The statistical software was the SPSS program (version 12.0 for Windows, SPSS Inc., Chicago, Illinois, USA). In all cases, p < 0.05 was considered as significant.. 15.
(24) Results 1. Preparation of chitosan/heparin nanoparticles Nanoparticles were prepared by the ionic gelation of positively charged chitosan with negatively charged heparin. As shown in Table 2, chitosan:heparin in distinct chitosan concentration (0.3, 0.6, 0.9, 1.2, 1.5 mg/ml; 12.0 ml) and heparin (1.0 mg/ml; 2.0 ml) formed complexes on the nanometer scale. The mean particle sizes of the prepared nanoparticles were in ranges of 200–300 nm, with positive zeta potentials, depending on the relative concentrations of chitosan and heparin used. The amount of positively charged chitosan significantly exceeded that of negatively charged heparin, because some of the excessive chitosan molecules were entangled on the surfaces of the nanoparticles produced. A chitosan concentration was 1.2 mg/ml and appeared to enlarge the particle size (273.1 r 10.6 nm) with a significantly zeta potential of 37.4 r 1.9 mV (Table 2). Therefore, the nanoparticles prepared with this specific composition were used for our further study.. 2. Preparation of CdtB-loaded nanoparticles CdtB loaded in chitosan/heparin nanoparticles were prepared by the ionic gelation of negatively charged protein mixed heparin, and then added into positively charged chitosan. As shown in Table 3, the chitosan (1.2 mg/ml, 1.0 ml) and the CdtB:heparin in distinct compositions (12.0:1.0, 6.0:1.0, 3.0:1.0, and 1.5:1.0 by mg/ml, 0.2 ml) had mean size ranges of 2800–300 nm, with different positive zeta potentials, depending on the relative concentrations of protein used. In addition, the polydispersity index of nanoparticles measured by a dynamic light scattering analyzer revealed a narrower distribution (polydispersity indices: 0.31 ± 0.08), when the CdtB:heparin composition 16.
(25) at 1.5:1.0 (mg/ml) was used (Figure 2). The result obtained by the transmission electron microscopy examination showed that the morphology of the prepared CdtB-loaded in chitosan/heparin nanoparticles remained spherical and smooth shaped (Figure 2).. 3. Expression and characterization of recombinant CdtB Since CdtB played a crucial role in the cytotoxicity of cells, we thus constructed C. jejuni cdtB and ligated into pET21d for CdtB protein expression. Recombinant CdtB was then purified and analyzed by SDS-PAGE (Figure 3). The purified recombinant CdtB was readily detected by western blot using monoclonal anti-His (Figure 3). Western blotting was carried out to determine whether polyclonal antibodies generated against each subunit could recognize the CdtB subunit when assembled and associated with cells. As shown in Figure 3C, the individual recombinant CdtB proteins were recognized by the respective polyclonal CdtB antiserum at 28 kDa. .. 4. Confocal images of cells with internalized FITC-CdtB solution or FITC-CdtB/Cy3-chitosan/heparin nanoparticles CdtB subunit was found to be an activity subunit of CDT holotoxin which was delivery by the binging subunits CdtA and CdtC. We next used confocal microscopy to visualize the delivery efficiency of NP-CdtB. AGS cells were incubated with FITC-cojugated NP-CdtB and FITC-CdtB at 37°C for the indicated times. The cells were then stained with 4',6-diamidino-2-phenylindole (DAPI) to visualize the nucleus. As shown in Figure 4 (1st row), no CdtB fluorescence could be detected on the plasma membrane upon cells treated with only FITC-conjugated CdtB. When AGS cells were treated with NP-CdtB at 37°C for 2 h, CdtB (green) was co-localized with Cy3-chitosan around the plasma membrane (Figure 4, 2nd row). After treatment of cells with 17.
(26) FITC-conjugated CdtB for 4 h, NP-CdtB was found localized in the nucleus (Figure 4, 3rd row). The results from confocal microscopy suggests that NP-CdtB has activity to localized into the nucleus.. 5. Detection of NP-CdtB by western blot analysis A previous study by Lin et. al.suggested that chitosan/heparin nanoparticle was an efficient carrier for antibiotic drug delivery (54). We thought to investigate whether the nanoparticle have ability to deliver CdtB into the AGS cells. To detect the efficiency of CdtB or NP-CdtB into the AGS cells, we treated the AGS cells with CDT holotoxin (200 nM) and NP-CdtB (200 nM) for various incubation periods (1, 2, 4, 6, 8 hours) and detected by the western blot analysis using an anti-CdtB serum. As show in Figure 5, after treatment of cells with NP-CdtB, the level of CdtB was increase at 4 hours and then begin to decrease at 6 to 24 hours. However, the level of CdtB was increase at 8 hours when treated of cells with CDT holotoxin (Figure 5B). Thus, the data suggests that the delivery efficiency of NP-CdtB is higher than CDT holotoxin.. 6. Treatment of cells with NP-CdtB induces cell cycle arrested at G2/M A previous research indicated that CDT not only causes cell distending but also induces chromatin condensation and cleavage, as well as induce cell cycle arrest at G2/M phase (42). It has also been suggested that CDT toxicity is associated with cell cycle arrest and eventually cell death resulting from activation of the apoptotic cascade (23). We next thought to detect whether NP-CdtB has ability to induce G2/M arrest and cell death in AGS cells. As shown in Figure 6A, NP-CdtB induced G2/M arrest shown gradually increased in a time-dependent manner. The statistical analysis showed that G2/M arrest was significantly increased after AGS cells were treatment 18.
(27) with NP-CdtB for 2 hours as compare with the negative control (only AGS and NP). The results from this study demonstrated that NP-CdtB not only delivery into the cell nucleus but also have ability to induce cell cycle arrest at G2/M phase.. 7. Observation of cell morphology CDT holotoxin can induced genotoxic effect in AGS cells including cell cycle arrest at G2/M phase and leading to cell change the morphology finally cause cell apoptosis, in this data we detection weather the NP-CdtB can cause cell death, the data was shown in Figure 6, to further determine the effects of CDT holotoxin or NP-CdtB, we observed the cell morphology by using the contrast microscopy. This data indicated the cell detachment was observed the AGS cell exposed to the CDT holotoxin or NP-CdtB at 24 hours (Figure 7), then the cell was detached more after cell was incubated with CDT holotoxin or NP-CdtB for 72 hours. Otherwise, the normal cell or the cell treat with nanoparticle only was not significant effect in this data. As the results, the AGS cell was dead by the effects of CDT holotoxin or NP-CdtB, but not by nanoparticle treatment only.. 8. NP-CdtB induced apoptosis in AGS cells CDT toxicity is associated with cell cycle arrest and eventually cause cell death through the activation of apoptotic cascade (35,36). Our preliminary data showed that cell cycle was arrested at G2/M phase after treatment of cells with NP-CdtB by using flow cytomerty analysis (Figure 7). We next detected the cell viability after cell was treatment with NP-CdtB for 24 hours by using MTT assay. As shown in Figure 8, cell viability was decrease with a dose-dependent manner when AGS cells were treated with variety concentrations (20nM, 200nM, 500nM and 1000nM) of NP-CdtB for 24 hours. We also detected sub-G1 population using flow cytometry to confirm the our 19.
(28) observation. When AGS cells were treated with NP-CdtB for different incubation times (24, 48, 72 hours), the population of the sub-G1 shown increased in a time-dependent manner (Figure 9A). Our results showed that NP-CdtB-induced cell apoptosis at 24-72 h with a significant increase when compare to control groups (Figure 9B). It has been reported that several molecules were involved in the apoptosis pathway, including the Bcl-2 families, caspase families, p53 (67-69). The Bcl-2 families function as an anti-apoptosis which included Bcl-2 and Bcl-xl. On the other hand, the Bax, Bak, Bad, and Bid were molecules that involved in pro-apoptotic. We next assessed whether the cell apoptosis induced by NP-CdtB in the AGS cells was associated with an anti-apoptosis family. As show in Figure 10, the levels of the Bax and Bak were increased after treatment of cells with CDT holotoxin or NP-CdtB when compared with control groups (only AGS cell and only nanoparticle). Additonally, the expression of anti-apoptosis molecular, Bcl-2, was decreased. This result suggested that NP-CdtB has the ability to delivery CdtB subunit enter the AGS cell nucleus and then activate the apoptotic cascade. The results from this study suggested that NP-CdtB has ability to delivery into the host cell nucleus and thus induced cell cycle arrest at G2/M phase and cell apoptosis (Figure 11).. 20.
(29) Discussion Campylobacter jejuni is one of the major cause of infection diarrhea world-wide as well as the most commonly reported bacterial cause of food-borne illness in the United States (3), C. jejuni was found can cause disease in different hosts including human, beast animal, and pets. This bacterium can also induce several types of diseases in human including gastritis, gastroenteritis, septicemia and serious neurological disease like Guillian-Barré syndrome. Recently, the infection of C. jejuni was became a seriously problem around the word. The cytolethal distending toxin (CDT) is one of the important virulence factors secreted by C. jejuni. CDT also contributes to survival and establishment of disease in the host cells. One of the most important function of CDT is to induce cell distending and lead to a severe genotoxin effects on host (19). The earlier study indicated that CDT is a family of heat-labile protein cytotoxin found in various gram-negative bacteria pathogens of human (70,71). CDT is typically compose by three subunits, including CdtA, CdtB and CdtC (72). CDT holotoxin function as an AB2 toxin in which CdtA and CdtC serve as a binding subunits, and CdtB plays an important role in destruction of the host DNA. Once CDT holotoxin get into the host cell from the plasma membrane, CdtB using an endoplasmic pathway through Golgi and ER, after which CdtB translocated into the nucleus (73). The catalytic subunit CdtB has DNase-I like activity, whereas CdtA and CdtC serve as the binding subunit which associate with the cell surface and delivering of CdtB into the target cell lead to cell apoptosis (74). The research in 2001 by Lara-Tejero et al. indicated that Cdt activity requires the function of three subunits, when applied individually, purified CdtA, CdtB or CdtC doesn’t exhibit toxic activity in the host cells (75). Moreover, several 21.
(30) groups have shown that CdtA-CdtC complex can inhibit subsequent intoxication by holotoxin (76,77). The results from these studies suggested that the binding subunits CdtA and CdtC play a crucial role in the association with the host cell membrane. Thus we attempt to utilize other substances to substitute as the binding subunits and achieve the same results. Nanoparticle is a microscopic particle which contains biodegradable and safety used in vivo. Nanoparticle has a widely potential application in several fields. Recent years, nanoparticle was commonly used in cancer therapy due to its ability to conjugate and inject some bacterial toxins as well as delivery of drugs into target cells which may induce the toxin effects (51). In 2007 Townsend et al. who used nanoparticle to directly deliver therapies to neurons in the central nervous system, which is protected by blood-brain barrier (BBB). However, nanoparticle has ability to bypass the blood-brain barrier (BBB) because of its small volume, (50). Due to the widely utilized of nanoparticle, the major object of this study is to develop a novel nanoparticle encapsulated bacterial toxin for gastric cancer therapy. The acidic environment in gastric probability cause drug decomposition or loss of their function. Thus, this is one of the problems we consider in this study: the nanoparticle used in this study was consisted of chitosan and heparin. Chitosan has structural characteristics similar to glycosaminoglycans which is non-toxin and biodegradable. (78).. low-moelcular-weight. Heparin about. is. a. 15kDa.. well-know Heparin. anticoagulant harbors. a. and. has. polyanionic. mucopolysaccharide which has ability to bind to cell receptors and associate with mucosal regeneration, angiogenesis, and proliferation (59,79), Recently, polymer nanoparticle was wide application in target therapy in which serve as a carrier for drug delivery. Those two components has a pH sensitivity characteristic that are stable at pH 1.2-2.5 but unstable and break apart at pH 7.0. A previous study also indicated 22.
(31) that the drug was release by nanoparticle at pH 1.2 (35%) and at pH6.8 (80%). This result acknowledges that the nanoparticle can protect drugs from destruction by gastric acids (54). The current study created a system which has ability to encapsulate CdtB and deliver CdtB into the AGS cells. This system was substituted CDT holotoxin for nanoparticle to achieved the same results. The nanoparticle-encapsulated drug for delivery into the cells must be smaller than 200 nm to be taken up by epithelial cells (54,80). Figure 2 shows the size of NP-CdtB is between 200nm and 300nm. This is not in the range from previous study. Thus, we first determined whether the NP-CdtB have ability to enter the AGS cells. As show in Figure 4, the images from CLSM indicated that upon treatment of cells with NP-CdtB for 2 hours, NP-CdtB was located in intercellular spaces and cell cytoplasm. When changes the fresh medium and incubation for further 4 hours, NP-CdtB was found co-localized with the cell nucleus. This result suggests that nanoparticle play an important role in the delivery of CdtB subunit into the cell nucleus, In addition, the western blot results from Figure 5 also indicated the maximum of NP-CdtB get into the AGS cell is around 4 hours. This is better than 8 hours after CDT holotoxin treatment. Thus, the results from these studies suggest that NP-CdtB has better efficiency then CDT holotoxin in the delivery of CdtB into the AGS cells. Several groups have been utilized nanoparticle as a delivery system which has been approved can translate in vivo for cancer therapy (50,51,81). In this study we used the bacterial toxin CDT to destroy the gastric cancer cells. CdtB function as a phosphatidylinositol-3,4,5-triphosphate phosphates which is analogous to the tumor suppressor phosphatases, PTEN and SHIP 1 (40,82). CdtB cause cell cycle arrest at G2/M phase on host cell was reported in 1997 (33). In our current study, as shown in Figure 6, the cell cycle analysis indicated that NP-CdtB not only has ability to deliver 23.
(32) into the host cells, but also cause cell cycle arrest at G2/M phase (83). The data from these studies also indicated that nanoparticle cannot cause cell cycle arrest in AGS cells. Upon cells treated with CDT holotoxin and NP-CdtB for 24 hours,. the cell. viability was significantly decrease in a dose-dependent manner (Figure 8). In addition, CDT holotoxin cause cell cycle arrest at G2/M phase then induced cell death via the apoptosis pathway. We thus detected the cell apoptosis after treatment of cells with NP-CdtB. The population of apoptotic cells was graduated increased with a time-dependent manner. CDT holotoxin can be produced by some Gram-negative bacteria, which may associate with double-stranded DNA breaks resulting in cell cycle arrest at G2/M phase and leading to cell apoptosis via the mitochondrial-dependent apoptosis pathway (84). Our study by western blot analysis suggests that the expression level of the Bax and Bak was increase after AGS cells treated with Cdt holotoxin or nona-CdtB. This result demonstrated that the NP-CdtB have the ability in the activation of the apoptotic cascade (Figure 10). Most important, our study also found that the caspase families are not involved in NP-CdtB-induced apoptosis pathway (data not show). Because of the previously research indicated that cell exposure to CDT holotoxin can triggers activation of checkpoint responses that lead to cell DNA damage, cell cycle arrest as well as cell apoptosis. The key molecules involved in DNA double strand breaks was refered to Ataxia telangiectasia mutated (ATM) kinase. A previous study suggest that CDT holotoxin can trigger full activation of ATM and subsequent phosphorylation of its downstream effectors such as DNA repair complex (H2AX), checkpoint kinase (chk2) and the tumor suppressor gene (p53) (85). Thus, we suppose that NP-CdtB-induced cell apoptosis may through the ATM-dependent DNA damage 24.
(33) checkpoint responses. However whether those molecules involved in the NP-CdtB-induced apoptosis of AGS cells required further investigation. In conclusion, we developed a novel nanoparticle which carried heparin and chitosan for encapsulation of bacterial toxin CdtB. We also proposed that nanoparticle can successfully replaced CdtA and CdtC to deliver CdtB subunit into the AGS cells. In this study we can demonstrate that NP-CdtB can induced cell cycle arrest at G2/M phase and finally leaded to cell apoptosis in AGS cells. This system we created have a higher efficiently to delivery CdtB into the human gastric adenocarcinoma cells.. The mechanism of NP-CdtB delivery into host cell nucleus and induce cell apoptosis is described in Figure 11.. 25.
(34) References. 2.. Smibert, R. M. (1975) In Bergy's Manual of Determinative Bacteriology, 8th ed., 207-211 Altekruse, S. F., Stern, N. J., Fields, P. I., and Swerdlow, D. L. (1999) Emerg. 3.. Infect Dis 5, 28-35 Mead, P. S., Slutsker, L., Griffin, P. M., and Tauxe, R. V. (1999) Emerg Infect. 1.. Dis 5, 841-842 4. 5. 6. 7. 8. 9. 10.. Allos, B. M. (1997) J Infect Dis 176 Suppl 2, S125-128 On, S. L. (1996) Clin Microbiol Rev 9, 405-422 Kuipers, E. J. (1999) Aliment Pharmacol Ther 13 Suppl 1, 3-11 Ketley, J. M. (1997) Microbiology 143 ( Pt 1), 5-21 Beuchat, L. R. (1985) Appl Environ Microbiol 50, 934-939 Rollins, D. M., and Colwell, R. R. (1986) Appl Environ Microbiol 52, 531-538 Corry, J. E., and Atabay, H. I. (2001) Symp Ser Soc Appl Microbiol, 96S-114S. 11.. Morooka, T., Umeda, A., and Amako, K. (1985) J Gen Microbiol 131, 1973-1980. 12.. Neal-McKinney, J. M., Christensen, J. E., and Konkel, M. E. Mol Microbiol. 13. 14. 15.. 76, 918-931 Wassenaar, T. M., and Blaser, M. J. (1999) Microbes Infect 1, 1023-1033 Wassenaar, T. M. (1997) Clin Microbiol Rev 10, 466-476 Caroff, M., Karibian, D., Cavaillon, J. M., and Haeffner-Cavaillon, N. (2002). 16. 17.. Microbes Infect 4, 915-926 Park, S. F., and Richardson, P. T. (1995) J Bacteriol 177, 2259-2264 Arimi, S. M., Park, R. W., and Fricker, C. R. (1990) J Appl Bacteriol 69, 384-389. 18. 19. 20.. Johnson, W. M., and Lior, H. (1988) Microb Pathog 4, 103-113 Johnson, W. M., and Lior, H. (1988) Microb Pathog 4, 115-126 Shenker, B. J., McKay, T., Datar, S., Miller, M., Chowhan, R., and Demuth, D.. 21.. (1999) J Immunol 162, 4773-4780 Ohguchi, M., Ishisaki, A., Okahashi, N., Koide, M., Koseki, T., Yamato, K.,. 22.. Noguchi, T., and Nishihara, T. (1998) Infect Immun 66, 5980-5987 Okuda, J., Kurazono, H., and Takeda, Y. (1995) Microb Pathog 18, 167-172. 23.. Gelfanova, V., Hansen, E. J., and Spinola, S. M. (1999) Infect Immun 67, 6394-6402. 24.. Chien, C. C., Taylor, N. S., Ge, Z., Schauer, D. B., Young, V. B., and Fox, J. G. 26.
(35) 25.. (2000) J Med Microbiol 49, 525-534 Young, V. B., Knox, K. A., and Schauer, D. B. (2000) Infect Immun 68, 184-191. 26.. Pickett, C. L., Pesci, E. C., Cottle, D. L., Russell, G., Erdem, A. N., and Zeytin,. 27. 28. 29.. H. (1996) Infect Immun 64, 2070-2078 Pickett, C. L., and Whitehouse, C. A. (1999) Trends Microbiol 7, 292-297 Nesic, D., Hsu, Y., and Stebbins, C. E. (2004) Nature 429, 429-433 Shenker, B. J., Besack, D., McKay, T., Pankoski, L., Zekavat, A., and Demuth,. 30. 31.. D. R. (2005) J Immunol 174, 2228-2234 Lara-Tejero, M., and Galan, J. E. (2000) Science 290, 354-357 Hickey, T. E., McVeigh, A. L., Scott, D. A., Michielutti, R. E., Bixby, A., Carroll, S. A., Bourgeois, A. L., and Guerry, P. (2000) Infect Immun 68, 6535-6541. 32. 33.. Watson, R. O., and Galan, J. E. (2005) Cell Microbiol 7, 655-665 Comayras, C., Tasca, C., Peres, S. Y., Ducommun, B., Oswald, E., and De. 34.. Rycke, J. (1997) Infect Immun 65, 5088-5095 Sugai, M., Kawamoto, T., Peres, S. Y., Ueno, Y., Komatsuzawa, H., Fujiwara, T., Kurihara, H., Suginaka, H., and Oswald, E. (1998) Infect Immun 66, 5008-5019. 35.. Shenker, B. J., Demuth, D. R., and Zekavat, A. (2006) Infect Immun 74, 2080-2092. 36.. Bielaszewska, M., Sinha, B., Kuczius, T., and Karch, H. (2005) Infect Immun. 37.. 73, 552-562 Boesze-Battaglia, K., Besack, D., McKay, T., Zekavat, A., Otis, L.,. 38. 39.. Jordan-Sciutto, K., and Shenker, B. J. (2006) Cell Microbiol 8, 823-836 Nesic, D., and Stebbins, C. E. (2005) PLoS Pathog 1, e28 Mise, K., Akifusa, S., Watarai, S., Ansai, T., Nishihara, T., and Takehara, T.. 40.. (2005) Infect Immun 73, 4846-4852 Shenker, B. J., Dlakic, M., Walker, L. P., Besack, D., Jaffe, E., LaBelle, E., and. 42.. Boesze-Battaglia, K. (2007) J Immunol 178, 5099-5108 Thelestam, M., and Frisan, T. (2004) Rev Physiol Biochem Pharmacol 152, 111-133 Whitehouse, C. A., Balbo, P. B., Pesci, E. C., Cottle, D. L., Mirabito, P. M.,. 43.. and Pickett, C. L. (1998) Infect Immun 66, 1934-1940 Akifusa, S., Poole, S., Lewthwaite, J., Henderson, B., and Nair, S. P. (2001). 44.. Infect Immun 69, 5925-5930 Lewis, D. A., Stevens, M. K., Latimer, J. L., Ward, C. K., Deng, K., Blick, R.,. 41.. Lumbley, S. R., Ison, C. A., and Hansen, E. J. (2001) Infect Immun 69, 27.
(36) 5626-5634 45. 46.. Chithrani, B. D., Ghazani, A. A., and Chan, W. C. (2006) Nano Lett 6, 662-668 Hochella, M. F., Jr., Lower, S. K., Maurice, P. A., Penn, R. L., Sahai, N.,. 47.. Sparks, D. L., and Twining, B. S. (2008) Science 319, 1631-1635 Pridgen, E. M., Langer, R., and Farokhzad, O. C. (2007) Nanomedicine (Lond). 48.. 2, 669-680 Bisht, S., Feldmann, G., Soni, S., Ravi, R., Karikar, C., and Maitra, A. (2007) J. 49. 50. 51.. Nanobiotechnology 5, 3 Brannon-Peppas, L., and Blanchette, J. O. (2004) Adv Drug Deliv Rev 56, 1649-1659 Townsend, S. A., Evrony, G. D., Gu, F. X., Schulz, M. P., Brown, R. H., Jr., and Langer, R. (2007) Biomaterials 28, 5176-5184 Showalter, S. L., Huang, Y. H., Witkiewicz, A., Costantino, C. L., Yeo, C. J., Green, J. J., Langer, R., Anderson, D. G., Sawicki, J. A., and Brody, J. R. (2008). 52.. Cancer Biol Ther 7, 1584-1590 Wu, Y., Wang, W., Chen, Y., Huang, K., Shuai, X., Chen, Q., Li, X., and Lian,. 53.. G. Int J Nanomedicine 5, 129-136 He, X. W., Liu, T., Chen, Y. X., Cheng, D. J., Li, X. R., Xiao, Y., and Feng, Y.. 54.. L. (2008) Cancer Gene Ther 15, 193-202 Lin, Y. H., Chang, C. H., Wu, Y. S., Hsu, Y. M., Chiou, S. F., and Chen, Y. J.. 55. 56.. (2009) Biomaterials 30, 3332-3342 Kas, H. S. (1997) J Microencapsul 14, 689-711 Mansouri, S., Cuie, Y., Winnik, F., Shi, Q., Lavigne, P., Benderdour, M.,. 58.. Beaumont, E., and Fernandes, J. C. (2006) Biomaterials 27, 2060-2065 Li, Y., Wang, H. Y., and Cho, C. H. (1999) J Pharmacol Exp Ther 290, 789-796 Andersson, L. O., Barrowcliffe, T. W., Holmer, E., Johnson, E. A., and. 59.. Soderstrom, G. (1979) Thromb Res 15, 531-541 Hirsh, J., Warkentin, T. E., Shaughnessy, S. G., Anand, S. S., Halperin, J. L.,. 57.. 60.. Raschke, R., Granger, C., Ohman, E. M., and Dalen, J. E. (2001) Chest 119, 64S-94S WHO. (1994) IARC monographs on the evaluation of carcinogenic risks to humans. In: Schistosomes, liver flukes and Helicobacter pylori. in International Agency for Research on Cancer (WHO ed., WHO, Lyon, France. 61.. Wu, T. L., Su, L. H., Chia, J. H., Kao, T. M., Chiu, C. H., Kuo, A. J., and Sun,. 62.. C. F. (2002) Epidemiology and infection 129, 227-231 Li, Y., Wang, W. P., Wang, H. Y., and Cho, C. H. (2000) Eur J Pharmacol 399, 205-214 28.
(37) 63. 64.. Shu, X. Z., Zhu, K. J., and Song, W. (2001) Int J Pharm 212, 19-28 Lin, Y. H., Chung, C. K., Chen, C. T., Liang, H. F., Chen, S. C., and Sung, H.. 65.. W. (2005) Biomacromolecules 6, 1104-1112 Grenha, A., Seijo, B., and Remunan-Lopez, C. (2005) Eur J Pharm Sci 25, 427-437. 66. 67.. Ma, Z., Yeoh, H. H., and Lim, L. Y. (2002) J Pharm Sci 91, 1396-1404 Alaoui-El-Azher, M., Mans, J. J., Baker, H. V., Chen, C., Progulske-Fox, A.,. 68.. Lamont, R. J., and Handfield, M. PLoS One 5, e11714 Ohara, M., Hayashi, T., Kusunoki, Y., Nakachi, K., Fujiwara, T., Komatsuzawa,. 69.. H., and Sugai, M. (2008) Infect Immun 76, 4783-4791 Matangkasombut, O., Wattanawaraporn, R., Tsuruda, K., Ohara, M., Sugai, M.,. 70.. and Mongkolsuk, S. Infect Immun 78, 783-792 Frisan, T., Cortes-Bratti, X., and Thelestam, M. (2002) Int J Med Microbiol. 71. 72. 73.. 291, 495-499 Lara-Tejero, M., and Galan, J. E. (2002) Trends Microbiol 10, 147-152 Pickett, C. L., Cottle, D. L., Pesci, E. C., and Bikah, G. (1994) Infect Immun 62, 1046-1051 Guerra, L., Teter, K., Lilley, B. N., Stenerlow, B., Holmes, R. K., Ploegh, H. L., Sandvig, K., Thelestam, M., and Frisan, T. (2005) Cell Microbiol 7, 921-934. 74.. Montecucco, C., Papini, E., and Schiavo, G. (1994) FEBS Lett 346, 92-98. 75. 76. 77.. Lara-Tejero, M., and Galan, J. E. (2001) Infect Immun 69, 4358-4365 McSweeney, L. A., and Dreyfus, L. A. (2005) Infect Immun 73, 2051-2060 Akifusa, S., Heywood, W., Nair, S. P., Stenbeck, G., and Henderson, B. (2005). 78.. Microbiology 151, 1395-1402 Muzzarelli, R., Baldassarre, V., Conti, F., Ferrara, P., Biagini, G., Gazzanelli,. 79. 80.. G., and Vasi, V. (1988) Biomaterials 9, 247-252 Benoit, D. S., and Anseth, K. S. (2005) Acta Biomater 1, 461-470 Chang, C. H., Lin, Y. H., Yeh, C. L., Chen, Y. C., Chiou, S. F., Hsu, Y. M.,. 81.. Chen, Y. S., and Wang, C. C. Biomacromolecules 11, 133-142 Peng, W., Anderson, D. G., Bao, Y., Padera, R. F., Jr., Langer, R., and Sawicki,. 82. 83.. J. A. (2007) Prostate 67, 855-862 Dlakic, M. (2001) Science 291, 547 DiRienzo, J. M., Cao, L., Volgina, A., Bandelac, G., and Korostoff, J. (2009) R. 84.. E S EARCH L E T T E R 291, 222–231 Liyanage, N. P., Manthey, K. C., Dassanayake, R. P., Kuszynski, C. A., Oakley,. 85.. G. G., and Duhamel, G. E. Helicobacter 15, 98-107 Guerra, L., Albihn, A., Tronnersjo, S., Yan, Q., Guidi, R., Stenerlow, B., Sterzenbach, T., Josenhans, C., Fox, J. G., Schauer, D. B., Thelestam, M., 29.
(38) 86.. Larsson, L. G., Henriksson, M., and Frisan, T. PLoS One 5, e8924 Konkel, M. E., Monteville, M. R., Rivera-Amill, V., and Joens, L. A. (2001) Curr Issues Intest Microbiol 2, 55-71. !. 30.
(39) Tables. Table 1. The species of Campylobacter and the related diseases.. Species. Reservoir Host. Human Disease. Frequency. C. jejuni subsp. jejuni. Poultry, pigs, bulls,. Gastroenteritis,. Common. dogs,. septicemia,. cats,. rabbits,. birds, minks. meningitis, spontaneous abortion, proctitis, Guillain-Barrê syndrome. C. jejuni subsp. doylei. Humans. Gastroenteritis,. Uncommon. gastritis, septicemia C. coli subsp. fetus. Pigs, poultry, bulls,. Gastroenteritis,. sheep, birds. septicemia,. Uncommon. insects,. abortion, spontaneous, meningitis C. upsaliensis. Dogs, cats. Gastroenteritis,. Uncommon. septicemia, abscesses C. fetus subsp. fetus. Cattle, sheep. Septicemia,. Uncommon. gastroenteritis, spontaneous abortion, meningitis C. fetus subsp. venereal Cattle. Septicemia. Adapted from On (5). 31. Uncommon.
(40) Table 2. Particle sizes and zeta potentials of nanoparticles prepared with different chitosan and heparin concentrations in deionized water (n = 5).. Chitosan. Heparin. Concentration. Concentration. (mg/mL). (mg/mL). 0.3. Mean Particle. Zeta. Size (nm). (mV). 1.0. ●. ●. 0.6. 1.0. 208.4 r 10.6. 30.4 r 1.5. 0.9. 1.0. 248.5 r 8.7. 33.6 r 0.8. 1.2. 1.0. 273.1 r 10.6. 37.4 r 1.9. 1.5. 1.0. 298.1 r 9.6. 39.4 r 21.4. ● Precipitation of aggregates was observed.. 32. Potential.
(41) Table 3. Particle sizes and zeta potentials of the prepared bacterial toxin-loaded nanoparticles in deionized water (n = 5).. Protein:Heparin. Chitosan. Concentration. Concentration. (mg/mL). (mg/mL). 12.0:1.0. Mean Particle. Zeta. Size (nm). (mV). 1.2. 2788.1 r 300.9. 14.8 r 5.9. 6.0:1.0. 1.2. 983.5 r 163.9. 20.8 r 3.1. 3.0:1.0. 1.2. 414.3 r 8.3. 29.9 r 1.7. 1.5:1.0. 1.2. 312.4 r 15.7. 32.3 r 0.7. 33. Potential.
(42) Figures. Food processing and delivering. Livestock and wildlife. Ingestion by an impressionable host. Transmission Environment Contamination of surface water. Fecal runoff. Diarrheal disease. Passage through the stomach into the intestine. Human illness. Colonization. Cell invasion and toxin production. Inflammatory response. Figure 1. The infection routes of Campylobacter jejuni. (Adapted from Konkel (86)). 34.
(43) Figure 2. The polydispersity index (left panel) and transmission electron microscopy examination (right panel) of CdtB-loaded chitosan/heparin nanoparticles.. 35.
(44) Figure 3. Determination of CdtB by using SDS-PAGE and western bloting. CdtB was first constructed from C. jejuni and ligated into pET21d. The molecular weight was determined by using SDS-PAGE (A) and western blot analysis against His-tag (B) and CdtB (C). The molecular weight marker was denoted at the left side.. 36.
(45) Figure 4. Confocal microscopy analysis of Nanoparticle -CdtB delivery. Cells were pre-treated with HBSS (containing 50mM glucose, pH6.5) for 30 mins. After that, the cells were treated with HBSS containing NP-CdtB for 2 hours, and then remove the NP-CdtB. Cells were incubated with fresh culture medium for 4 hours, the CLSM was employed to observe the cellular uptake of NP-CdtB in cells. Fluorescent of NP-CdtB was used in the study and the distribution of Cy3-chitosan (red), NP-CdtB (green), and nuclei (blue, stained with DAPI) in the intracellular spaces was observed by a confocal microscope.. 37.
(46) (A). (B). Figure 5. Detection the efficiency of CDT holotoxin or Nanoparticle -CdtB delivered into cells. Cells were incubated with 200nM of (A) NP-CdtB or (B) CDT holotoxin for the indicated periods. The expression of CdtB was determined using western blot analysis against CdtB.. 38.
(47) (A). (B). Figure 6. Nanoparticle -CdtB induced cell cycle arrest at G2/M phase in AGS cells. AGS cells were treated with NP-CdtB (200nM) for the indicated time (1, 2, 4, 6, 7 and 24 hours). The population of cell cycle arrest was analyzesd by flow cytometry. (B) The population of G2/M phase was shown in time-cause dependent manner, the G2/M phase population was increased after AGS cells incubated with NP-CdtB for 2 hours, compare with the negative control (only AGS and nanoparticle). IRCF193 and CDT holotoxin are represented as positive controls. Result are expressed as the Mean±S.E. īp <0.05 compared with control; **p < 0.01 compared with control. 39.
(48) Figure 7. Cells were detachment after Nanoparticle -CdtB treatment for 24 to 72 hours. The cells were detached after incubation with CDT holotoxin or NP-CdtB for 24 hours. The detached cells was more obvious after treatment with NP-CdtB or CDT holotoxin for 72 hours. Representative image are show. Scale bar, 100 Pm. 40.
(49) Figure 8. The effects of Nanoparticle -CdtB on cell viability in AGS cells. AGS cells were incubated with various concentrations (20, 200, 500, 1000, 2000 nM) for 24 hours. The percentage of cell viability was analysis by MTT assay (n=3). Result are expressed as the Mean±S.E. īp <0.05 compared with control; **p < 0.01 compared with control.. 41.
(50) (A). (B). Figure 9. Nanoparticle -CdtB induced apoptosis of human gastric adenocarcinoma cells. (A) AGS cells were treated with CDT holotoxin, NP-CdtB, and nanoparticle for the indicated times (24, 48, 72 hours). The population of apoptotic cell was analyzed by flow cytometry of PI-stained cells (n=3). (B) The data represented percentage of sub-G1 cells was increase with a time-dependent manner compare with control groups (NP and control). Results are expressed as the Mean±S.E. īp <0.05 compared with control; **p < 0.01 compared with control. 42.
(51) Figure 10. Bax, Bak, Bcl-2 activation are involved in Nanoparticle -CdtB mediated cell apoptosis in human gastric adenocarcinoma cells. AGS cells were incubated with CDT holotoxin, NP-CdtB and nanoparticle for 24 hours. Expression of Bax, Bak, Bcl-2 were examined by western blot analysis. The expression of Bax and Bak were increased after treatment of cells with CDT holotoxin and NP-CdtB.. 43.
(52) Figure 11. Depiction of the mechanism of Nanoparticle-CdtB delivers into host cell nucleus and induces cell apoptosis.. 44.
(53)
數據
相關文件
臺大機構典藏NTUR (National Taiwan University 二 Repository, http://ntur.lib.ntu.edu.tw) 經驗與協助推 動臺灣學術機構典藏TAIR (Taiwan Academic Institutional Repository,
Giant cells are also seen in other diseases like giant cell granuloma of the jaws, traumatic bone cyst, aneurysmal bone cyst, and jaw tumor of
However, in HIV-positive patients, plasma cell tumors may present at unusual sites and progress rapidly to involve multiple sites, including the soft tissues and viscera [19]..
To evaluate the clinicopathologic features, prognostic factors, and management of patients in the North Chinese population with head and neck squamous cell carcinoma (HNSCC)
They could also successfully form single-cell derived colonies (Fig.. Pyogenic granuloma-derived cells. A) After the initial seeding, many cells attached to the plates in an
Abu-Ghanem S, Yehuda M, Carmel NN, et al: Elective neck dissection vs observation in early-stage squamous cell carci- noma of the oral tongue with N0 clinically apparent lymph
• Cell coverage area: expected percentage of locations within a cell where the received power at these. locations is above a
• Cell coverage area: expected percentage of locations within a cell where the received power at these. locations is above a