Induction of differentiation and mineralization in rat tooth germ cells on PVA through inhibition of ERK1/2

(1)

Induction of differentiation and mineralization in rat tooth germ cells on PVA

through inhibition of ERK1/2

Rung-Shu Chen

a

, Min-Huey Chen

b

,

c

,

**

_{, Tai-Horng Young}

a

,

*

a_{Institute of Biomedical Engineering, College of Medicine and College of Engineering, National Taiwan University, #1, Sec. 1, Jen-Ai Road, Taipei 100, Taiwan} b_{Department of Dentistry, National Taiwan University Hospital, Taipei 100, Taiwan}

c_{School of Dentistry, College of Medicine, National Taiwan University, Taipei 100, Taiwan}

a r t i c l e

i n f o

Article history: Received 23 July 2008 Accepted 30 September 2008 Available online 9 November 2008 Keywords:

Poly(vinyl alcohol) (PVA) Tooth germ (TG) cells Differentiation Mineralization

Extracellular signaling-regulated kinase1/2 (ERK1/2)

a b s t r a c t

Poly(vinyl alcohol) (PVA) has been widely used in the ﬁeld of biomedical applications because of its hydrophilic properties for desired functions. Nonetheless, the role of PVA in tooth germ (TG) cell differentiation and mineralization has seldom been explored. To test the capacity of PVA in regulating TG cell differentiation and mineralization, TG cells obtained from 4-day-old Wistar rats were cultured on the PVA substrate. It was found that PVA was able to promote TG cell exhibiting high levels of alkaline phosphatase (ALP) activity, mineralization, and mRNA expression of osteocalcin (OCN), osteopontin (OPN), dentin matrix protein 1 (DMP1) and enamelin. Even when the additives routinely administrated in the differentiation medium such as dexamethasone,

b-glycerophosphate and ascorbic acid were

removed from the culture system, PVA itself still stimulated TG cells with the differentiation and mineralization ability. By showing the direct suppression of extracellular signaling-regulated kinase1/2 (ERK1/2) of TG cells treated with U0126, known to suppress the activation of ERK1/2, and signiﬁcant synergistic effects between PVA and U0126, we demonstrated the suppression of ERK1/2 pathway is one of the effects of PVA-promoted TG cell differentiation and mineralization. Taken together, this study demonstrated a novel role of PVA in promoting the differentiation and mineralization of TG cells through ERK1/2 acting as a negative regulator.

1. Introduction

The tooth germ (TG), sometimes called the tooth bud,

contains a heterogeneous population of cells including

amelo-blasts, odontoblasts and dental pulp cells. During tooth

devel-opment, TG cell differentiation and mineralization proceed

synchronously eventually forming a tooth

[1]

. Thus, similar to

other osteoblast-like cells

[2–4]

, TG cells also can serve as

a model to elucidate the cell differentiation and mineralization

in vitro and to determine the effects of growth factors,

cyto-kines, and mechanical stimulus implicated in cell differentiation

and mineralization.

We recently reported that the adhesion and proliferation of

TG cells were sensitive to changes in surface hydrophilic

prop-erties of biomaterial

[5]

. Especially, the very hydrophilic

bioma-terial poly(vinyl alcohol) (PVA) could maintain TG cells with

a three-dimensional spherical structure, resembling in vivo

physiological condition. It is well known that cell behavior on

biomaterial is crucial to many biomedical applications, yet the

molecular pathways responsible for converting PVA signals into

TG cell responses are still being elucidated. Therefore, the

purpose of the study was to investigate the effect of PVA on TG

cell differentiation and mineralization, and the possible signaling

pathway involved in regulating TG cell change in response to

PVA biomaterial.

The

mitogen-activated

protein

kinase

(MAPK)

signaling

pathway is tightly related to the regulation of cell proliferation,

differentiation, motility and death

[6,7]

. Three central elements of

the MAPK family have been identiﬁed in mammalian cells, referred

to as extracellular signal-regulated kinase1/2 (ERK1/2), p38 kinase,

and c-Jun-N terminal kinase (JNK)

[8–10]

. This study made use of

Western blot analysis to examine the role of individual MAPK

pathway in enhancing alkaline phosphatase (ALP) activity and

mineralization of TG cells by blocking the pathway using speciﬁc

inhibitor. To our knowledge, TG cells were not employed to

examine how MAPK signaling pathways can be triggered by PVA.

Our ﬁndings show PVA is an effective substrate that promotes TG

cell differentiation and mineralization and the ERK1/2 dependent

*Corresponding author. Tel.: þ886 2 2312 3456; fax: þ886 2 2394 0049.

**Corresponding author. Department of Dentistry, National Taiwan University Hospital, Taipei 100, Taiwan.

E-mail address:[email protected](T.-H. Young).

Contents lists available at

ScienceDirect

Biomaterials

j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / b i o m a t e r i a l s

(2)

pathway plays an important role in negatively mediating function

of TG cells.

2. Materials and methods 2.1. Preparation of PVA substrate

A 5 wt% solution of PVA (Chemika Fluka, MW ¼ 72,000 g/mol, Switzerland) was prepared by dissolving PVA in distilled water at 95_{C. For preparing PVA-coated}

wells, 140ml of PVA solution was added into 24-welled tissue culture polystyrene (TCPS) plates (Costar, USA). The solution was then allowed to dry at 60_{C for 24 h to}

form a thin membrane. Before cell culture, the PVA-coated wells were sterilized in 70% alcohol overnight and rinse extensively with phosphate buffered saline (PBS). As controls, uncoated TCPS wells were treated by the same way as PVA-coated wells. 2.2. Cell culture

The animal study was performed according to a protocol approved by the Review Committee of College of Medicine, National Taiwan University. The method for isolating TG cells from rat mandibular molar TG was described previously[5]. In brief, rat mandibular molar TG was removed from 4-day-old Wistar rats using the explant outgrowth technique without collagenase treatment. Ten ﬁrst molar TGs in total were isolated from ﬁve rats from both sides of lower jaws of each rat. The TGs were placed in PBS and then were cut into small fragments about 1 mm3_{in size, in}

which the TG cells were released. Subsequently, the excised fragments of TG and released cells were placed into a 15 ml centrifuge tube and centrifuged at 900 rpm for 5 min. After removal of the upper layer solution, cells with tissue fragments were mixed with 10 ml Dulbecco’ s modiﬁed Eagle medium (DMEM, Chemicon, USA) supplemented with 10% fetal calf serum (Gibco-RBL Life Technologies, UK), antibi-otic/antimycotic (penicillin G sodium 100 U/ml, streptomycin 100 g/ml, amphoter-icin B 0.25 g/ml, Gibco-BRL Life Technologies, UK) placed in a 100-mm cell culture dish (Costar, USA) and then cultured at 37_{C with 5% CO}

2atmosphere in a

humid-ified incubator. TG cells released from the tissue fragments were grown to conflu-ence in approximately 6–8 days. At approximately 90% confluconflu-ence, tissue fragments were removed and used for another culture to release more TG cells, and sub-cultured in 100-mm cell culture dishes (Costar, USA) in fresh culture medium for another two weeks. The total number of cells obtained from each primary culture increased to approximately 1 108cells after 30 d in culture. In this work, TG cells used for the subsequent analysis were in the third passage and the medium was changed every 3 or 4 days.

2.3. ALP activity and mineralization assays

TG cells were cultured on PVA and TCPS at a density of 1 105_{cells/well for 1, 4}

and 7 days in the above medium (regarded as the regular medium) and differenti-ation medium. The differentidifferenti-ation medium was supplemented with 100 nM dexa-methasone (Sigma, USA), 10 mMb-glycerophosphate (Sigma, USA) and 50mg/ml ascorbic acid (Sigma, USA). ALP activity was assayed using p-nitrophenylphosphate as a substrate following the method described previously[11]. The amount of p-nitrophenol produced was measured spectrophotometrically at 410 nm. The degree of mineralization was measured by staining with Alizarin Red S (ARS, Sigma, USA) as described by Ratisoontorn et al.[12]. Data were expressed as units of ARS released (1 unit ¼ 1 unit of optical density at 562 nm).

2.4. MAPK inhibition studies

The role of individual MAPK pathway in ALP activity and mineralization of TG cells was assessed by blocking the pathways using speciﬁc inhibitor. The ERK1/2 pathway was blocked with U0126 (Cell signaling, USA), which inhibits MEK1/2, an upstream molecule of the ERK phosphorylation cascade[13]. The p38 MAPK was speciﬁcally inhibited with SB203580 (Sigma, USA)[14]and JNK was inhibited with SP600125 (Sigma, USA)[15]. For assessing ALP activity, mineralization and gene expression of mineralization- and differentiation-related markers, TG cells were treated with or without inhibitor for 7 days. For Western blot analysis, TG cells were cultured in the differentiation medium for 4 h followed by treatment with inhibitor for 30 min.

2.5. Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was extracted from TG cells by using Trizol (Invitrogen Life Technol-ogies, CA). The RNA (1mg) was reverse transcribed into ﬁrst-strand cDNA using the iScript cDNA Synthesis kit (BIO-RAD, CA) for RT-PCR. The oligonucleotide RT-PCR primers for glyceraldehydes-3-phosphate (GAPDH), osteocalcin (OCN)[16], osteo-pontin (OPN)[17], dentin matrix protein 1 (DMP1) and enamelin are listed inTable 1. The PCR ampliﬁcation was performed as follows: 32 cycles of denaturation at 94_C

for 45 s, annealing for 45 s, and extension at 72_{C for 30 s. The ampliﬁed products}

were analyzed by electrophoresis through 1.5% agarose gel containing 10mg/ml ethidium bromide, electrophoresed at 100 mV, and visualized on a UV trans-illuminator (Alpha Innotech, CA). All bands were scanned and analyzed using AlphaEase FC 4.0 software.

2.6. Western blot analysis

Cells were collected by gentle shaking of the wells and washed twice with PBS. Cell lysates were prepared with ice-cold lysis buffer (20 mMTris, pH 7.5, 150 mM NaCl, 1 mMEDTA, 10% glycerol, 1% Triton X-100, 1 mMNaF, 1 mMNa3VO4, 1:200

dilution of Protease Inhibitor Cocktail II; Calbiochem, Germany) for 30 min and then were sonicated at 4_{C for 15 s. Lysates were clariﬁed by centrifugation at}

14,000 rpm for 30 min at 4_{C and the resulting supernatant was saved for protein}

analysis and Western blot analysis.

Protein concentration was measured by using the commercial protein assay reagent (Bio-Rad, CA). For Western blotting, the supernatant was added to an equal volume of Laemmli sample buffer (62.5 mMTris, pH 6.8, 25% glycerol, 2% SDS, 0.01% bromophenol blue, 5% b-mercaptoethanol) and heated to 95_{C for 10 min. Proteins}

(35mg total protein per lane) were separated by SDS-PAGE on 10% polyacrylamide gels and transferred onto PVDF membranes. The membranes were blocked with 5% non-fat milk in TBST buffer (Bio-Rad, CA), probed with primary rabbit antibodies against ERK1/2 and phospho-ERK1/2 (Cell Signaling, USA) at a dilution of 1:1000, and were incubated at 4_{C overnight. After washing, the blots were incubated with}

anti-rabbit IgG-HRP conjugated secondary antibodies (Cell Signaling, USA) at a dilution of 1:5000 for 2–3 h. Finally, the proteins on the membranes were detected using the ECL Plus chemiluminescence system. Densitometric quantiﬁcation of Western blots was done using AlphaEase FC 4.0 software.

2.7. Statistical analysis

Results are presented as the mean standard deviation (SD) of 3–5 independent cultures. Statistical signiﬁcance was calculated using one-way analysis of variance (ANOVA) followed by post hoc procedure (Bonferoni analysis) (p < 0.005 was considered signiﬁcant).

3. Results

In the present study, the very hydrophilic PVA substrate with

the air–water contact angle of 54.0 2.0

_{was used to maintain TG}

cells with a three-dimensional spherical structure

[5]

. In addition,

monolayered TG cells on commercial TCPS with the air–water

contact angle of 62.7 2.4

_[5]

_{was compared.}

3.1. ALP activity and mineralization of TG cells on PVA and TCPS

To determine the effect of PVA on TG cell differentiation, ALP

activity, an early marker of odontoblasts differentiation

[18,19]

, and

ARS assay, a traditional approach for evaluating the calcium

depo-sition, were measured. In the culture system, cells were conﬂuent on

TCPS due to the high seeding density and cells formed aggregates

suspending above PVA as reported previously

[5]

(data not shown).

Fig. 1

shows both TCPS and PVA expressed increasing levels of ALP

activity and ARS assay through 7 days of culture in the differentiation

medium. Nonetheless, TG cells grown on PVA showed greater

expression and signiﬁcantly higher than those on TCPS at every time

point, regardless of ALP activity and ARS assay (p < 0.005).

Generally, culture medium was routinely changed and added

with dexamethasone,

b

-glycerophosphate and ascorbic acid, which

had been reported to be beneﬁcial to differentiation of bone-like cells

[20]

. Therefore, to further explore whether PVA per se promoted the

differentiation and mineralization of TG cells, regular medium

without dexamethasone,

b

-glycerophosphate and ascorbic acid was

Table 1

Oligonucleotide primer sequences utilized in the RT-PCR. Target cDNA Primer sequence (50_–30₎ _T hyb(C) Product size (bp) NCBI no. or Ref. GAPDH F ATGGGAAGCTGGTCATCAAC 51.8 375 NM017008 R CCACAGTCTTCTGAGTGGCA OCN F ATGAGGACCCTCTCTCTFCTC 56.3 293 [16] R GTGGTGCCATAGATGCGCTTG OPN F TCCAAGGAGTATAAGCAGCGGGCCA 58 200 [17] R CTCTTAGGGTCTAGGACTAGCTTCT DMP 1 F CTGGTATCAGGTCGGAAGAATC 55 499 NM206493 R CTCTCATTAGACTCGCTGTCAC Enamelin F CACCGTACCTTAGAGGCAATAC 54.8 463 NM000106 R GAGGTCCATGAAGGAAAGAGAG

(3)

prepared.

Fig. 2

shows TG cells grown on TCPS could not exhibit

signiﬁcant effects on production of ALP and calcium accumulation in

the absence of differentiation medium. In contrast, PVA stimulation

still resulted in increased levels of ALP activity and ARS assay with

culture time. Similar to

Fig. 1

the expression of ALP activity and ARS

assay on PVA was always signiﬁcantly higher than those on TCPS

during the culture period (p < 0.005). Therefore, TG cells could

exhibit high levels of ALP activity and mineralization on PVA,

regardless of the presence or absence of differentiation medium.

3.2. Effect of U0126 on TG cells differentiation and mineralization

It has been well documented that growth factor, cytokine, and

mechanical stimulation often induce changes in cell differentiation

and mineralization through the activation of MAPK, particularly

through ERK1/2 pathway

[21–24]

. Therefore, it is interesting to

investigate the effects of MAPK inhibitor on promoting or inhibiting

ALP activity and mineralization in TG cells. U0126, a widely used

inhibitor of MEK1/2, the upstream kinases of ERK1/2

[21]

was used

in this study.

Fig. 3

shows ALP activity and ARS assay of TG cells

grown on TCPS with differentiation medium in the presence of

U0126 ranging from 0 to 50

m

M

after culture for 7 days. Clearly,

ERK1/2 inhibitor promoted TG cell differentiation in a

dose-dependent manner and its effect was signiﬁcant for all

concentra-tion used (p < 0.005). In addiconcentra-tion, to address a possible involvement

of MAPKs other than ERK1/2 pathway, speciﬁc inhibitors for p38

and JNK were also examined. It was found that inhibition of p38 by

SB203580 (50

m

M

) and of JNK by SP600125 (50

m

M

) after culture for

7 days did not exhibit any effect on promoting ALP activity and

mineralization of TG cells (data not shown).

3.3. Synergism of PVA and U0126 on TG cell differentiation and

mineralization

Based on the above results, the possibility that U0126 inhibitor

was able to interact synergistically with PVA substrate to enhance

the differentiation and mineralization of TG cells was tested. Cells

grown on PVA with the addition of 50

m

M

of U0126 were harvested

after 7 days of incubation for analysis of ALP activity and ARS assay.

The results successfully showed that elevation of ALP activity and

mineralization of TG cells on PVA by U0126 treatment, regardless of

using regular or differentiation medium (

Fig. 4

). In addition, the

increasing degree of TG cell differentiation and mineralization

exceeded the effect of PVA and U0126 alone, indicating there was

a signiﬁcant synergism between PVA and U0126.

3.4. Gene expression of TG cells on PVA and TCPS

In order to examine the synergistic effects between PVA and

U0126 on known mineralization- and differentiation-related

time (day)

ALP activity

(nmol/mg total protein/min)

0

10

20

30

40

50 TCPS

PVA

*

time (day)

1

7 unit of ARS released

0.0

0.4

0.8

1.2

1.6

2.0 TCPS

PVA

*

4

1

4

7 a

b

Fig. 2. (a) ALP activity and (b) mineralization (ARS assay) in TG cells cultured on TCPS (closed) and PVA (open) in the regular medium without the addition of dexametha-sone,b-glycerophosphate and ascorbic acid after 1, 4 and 7 days of culture. Results represent the mean SD from 4–5 independent cultures and determinations. Asterisk denotes signiﬁcant difference (p < 0.005) compared with TCPS, determined by post hoc procedure (Bonferoni analysis).

time (day)

1 ALP activity

(nmol/mg total protein/min)

0

10

20

30

40

50

60 TCPS

PVA

*

time (day)

1

7 unit of ARS released

0.0

0.4

0.8

1.2

1.6

2.0 TCPS

PVA

*

7

4

4 a

b

Fig. 1. (a) ALP activity and (b) mineralization (ARS assay) in TG cells cultured on TCPS (closed) and PVA (open) in the differentiation medium after 1, 4 and 7 days of culture. Results represent the mean SD from 2–5 independent cultures and determinations. Asterisk denotes signiﬁcant difference (p < 0.005) compared with TCPS, determined by post hoc procedure (Bonferoni analysis).

(4)

markers, the gene expression of OCN, OPN, DMP 1, and enamelin of

TG cells cultured on TCPS and PVA with or without U0126

treat-ment for 7 days was examined by semi-quantitative RT-PCR (

Fig. 5

).

Compared to TG cells cultured on TCPS without addition of U0126,

exposure of cells to U0126 on TCPS or cells cultured on PVA without

U0126 resulted in an increase in OCN mRNA expression

[25]

,

regardless of the presence or absence of differentiation medium.

When cells cultured on PVA and exposed to U0126, the

combina-tion exhibited a more dramatic effect on increasing transcripts on

OCN. Furthermore, compared to TG cells cultured on TCPS, cells

grown on PVA also exhibited high level of expression of OPN mRNA,

no matter in the regular or the differentiation medium.

Interest-ingly, similar to the effect of PVA, exposure of TG cells to U0126

exhibited an increase expression of OPN mRNA, even cells cultured

on TCPS. This is consistent with the previous report by Higuchi et al.

that cells treated with ERK1/2 inhibitor showed increased levels of

mineralization-related markers

[26]

. In contrast, TG cells cultured

on TCPS, regardless of the presence or absence of U0126, could not

exhibit the expression of DMP 1 and enamelin mRNA, but PVA itself

still induced the mRNA levels for them. DMP 1, a dentin-speciﬁc

protein, plays an important role in controlling dentin formation

[27,28]

. Enamelin, a speciﬁc protein of enamel matrix and secreted

by ameloblasts, takes part in amelogenesis

[29,30]

. Thus, the

induction of DMP1 and enamelin mRNA further conﬁrmed the

effects of PVA on TG cell differentiation to produce dentin and

enamel mineralization. In addition, the synergistic effects between

PVA and U0126 on expression of DMP1 and enamelin mRNA of TG

cells were still could be detected. Thus, PVA alone or with U0126

inhibitor might be competent to induce the production of desired

factors by activating TG cells.

3.5. Effect of PVA on inhibiting ERK1/2 phosphorylation

Previous studies have demonstrated that the cascade of ERK1/2

pathway can be inhibited by inhibitor, U0126

[7,21]

. Therefore, if

the ERK1/2 pathway is also involved in PVA-promoted TG cell

differentiation and mineralization, it is reasonable to assume that

the ERK1/2 phosphorylation will be reduced or abolished for TG

cells cultured on PVA. Here, we examined the ability of U0126 and

PVA to inhibit ERK1/2 activation of TG cells by

immunocytochem-istry with a widely used phospho-speciﬁc ERK1/2 antibody which

recognizes the phosphorylation of the two sites known to be

responsible for the ERK1/2 pathway.

Fig. 6

shows TG cells cultured

on TCPS in the absence of U0126 for 4 h were capable of activating

the ERK1/2 phosphorylation to a high level in Western blot analysis.

Consistent with the effect of ERK1/2 inhibitor, when TG cells

cultured on TCPS for 4 h and then treated with U0126 for 30 min,

the ERK1/2 activity of TG cells was considerably decreased.

ALP activity

(umol/mg total protein/30min)

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4 *

*

0 10 20 50

unit of ARS released

0.0

0.5

1.0

1.5

2.0

2.5

3.0 *

*

U0126 ( M)

0 10 20 50

a

b

Fig. 3. Effects of ERK1/2 inhibitor U0126 on (a) ALP activity and (b) mineralization (ARS assay) of TG cells cultured on TCPS in the differentiation medium in a dose-dependent manner on the 7th day of culture. Results represent the mean SD from 4– 5 independent cultures and determinations. Asterisk denotes signiﬁcant difference (p < 0.005) compared with no inhibition, determined by post hoc procedure (Bonfer-oni analysis).

- + - + -

+

TCPS

differentiation

medium

PVA

differentiation

medium

PVA

regular

medium

TCPS

differentiation

medium

PVA

differentiation

medium

PVA

regular

medium

unit of alizarin red S

released

0.0

0.5

1.0

1.5

2.0 *

*

- + - + - +

ALP activity

(umol/mg total protein/30min)

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5 *

*

a

b

U0126 (50 M)

Fig. 4. Effects of ERK1/2 inhibitor U0126 (50mM) on (a) ALP activity and (b) mineral-ization (ARS assay) of TG cells cultured in the regular or differentiation medium on the 7th day of culture. Results represent the mean SD from 4–5 independent cultures and determinations. Asterisk denotes signiﬁcant difference (p < 0.005) compared with no inhibition, determined by post hoc procedure (Bonferoni analysis).

(5)

Interestingly, TG cells cultured on PVA for 4 h also displayed low

extent of ERK1/2 phosphorylation, while the effect of PVA was not

as stronger as that of U0126. However, synergistic effects between

PVA and U0126 were noted. No levels of ERK1/2 phosphorylation

were detected for TG cells cultured on PVA under the stimulation of

U0126. These results suggested that both U0126 inhibitor and PVA

substrate suppressed the ERK1/2 phosphorylation and the

inacti-vation of ERK1/2 activity helped to induce TG cell differentiation

and mineralization.

To further conﬁrm the role of ERK1/2 activity in TG cell

differ-entiation and mineralization, ERK1/2 activity of TG cells cultured on

TCPS and PVA with differentiation or regular medium was

measured at different time points.

Fig. 7

(a) indicated the level of

ERK1/2 phosphorylation was declined on both TCPS and PVA in the

differentiation medium. Combined with

Fig. 1

, PVA could induce TG

cell differentiation and mineralization, and could inhibit ERK1/2

activation more efﬁciently than TCPS.

Fig. 7

(b) shows that the ERK1/2

phosphorylation could still be negatively regulated when TG cells

cultured on PVA with regular medium. However, cells cultured on

TCPS without differentiation medium were unable to inhibit ERK1/2

activation, even enhanced ERK1/2 activation. Based on

Figs. 1, 2

and 7

, ERK1/2 phosphorylation negatively regulated ALP activity

and mineralization in TG cells.

4. Discussion

The effects of growth factors

[2]

, cytokines

[3]

, and mechanical

stimulus

[4]

on cell differentiation and mineralization have been

the subject of intense investigation recently. On the other hand, it is

well documented that biomaterials govern cellular responses and

ultimately affect the success of application and, therefore, might be

useful for controlling cell differentiation and mineralization. For

example, neural stem cells respond to different substrates, and

their fate determination depends on the chemical properties of the

substrates

[31]

. In addition, it has been reported that PVA had

a positive effect on HpG2 cell functionality in terms of albumin

synthesis

[32]

.

Traditionally, if cells are able to differentiate toward an

osteo-blast phenotype, culture medium will be routinely added with

dexamethasone,

b

-glycerophosphate and ascorbic acid

[33]

, which

- + - + - + - +

TCPS

PVA

- - + + - - + +

GAPDH

OCN

relative OCN expression

0.0

0.1

0.2

0.3

0.4

0.5 OPN

GAPDH

- + - + - + - +

TCPS

PVA

- - + + - - + +

relative OPN expression

(fold)

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6 GAPDH

- + - + - + - +

TCPS

PVA

- - + + - - + +

DMP1

relative DMP 1 expression

(fold)

0.00

0.05

0.10

0.15

0.20

0.25 GAPDH

U0126 (50

µµM)

differentiation

medium

U0126 (50

µM)

differentiation

medium

U0126 (50

µM)

differentiation

medium

U0126 (50

µM)

differentiation

medium

- + - + - + - +

TCPS

PVA

- - + + - - + +

Enam

relative enamelin expression

(fold)

0.0

0.1

0.2

0.3

0.4 a

b

c

_d

Fig. 5. Effects of ERK1/2 inhibitor U0126 (50mM) on mRNA expression of typical mineralization-related markers in TG cells on the 7th day of culture (a) OCN, (b) OPN, (c) DMP 1 and (d) enamelin. The bar charts show the average density SD of the PCR product from three independent experiments. GAPDH is the normalization control.

(6)

had been reported to be beneﬁcial to cell differentiation and

mineralization in the course of culture

[20,33]

. Therefore, ALP

activity and ARS assay of TG cells on TCPS were greatly reduced

with regular medium, when compared with medium containing

differentiation-induced additives (

Figs. 1 and 2

). Interestingly,

compared to TCPS, PVA provided a more preferential environment

for TG cells to express higher levels of the ALP activity and

miner-alization, no matter in the regular or differentiation medium (

Figs. 1

and 2

). These ﬁndings suggested that PVA act as an important role

to induce the differentiation and mineralization of TG cells as the

supplement of dexamethasone,

b

-glycerophosphate and ascorbic

acid

[20]

.

Several studies indicated that the MAPK signaling pathway,

particularly through ERK1/2 pathway, plays a critical role in the

regulation of cell growth and differentiation

[21–23]

. However,

there were contradictory results about the relationship between

ERK1/2 phosphorylation and osteoblast differentiation. Kono et al.

[34]

, Higuchi et al.

[26]

and Nakashima et al.

[35]

reported that

ERK1/2 activation negatively regulates the differentiation in

different cells. In contrast, Lai et al.

[36]

demonstrated that ERK1/2

inhibitor suppressed osteoblast differentiation and mineralization.

In order to investigate the direct role of ERK1/2 in the process of TG

cell differentiation and mineralization, cells were treated with

U0126, known to suppress the activation of ERK1/2. Interestingly,

direct suppression of ERK1/2 by U0126 treatment enhanced ALP

activity and mineralization of TG cells grown on TCPS (

Fig. 3

),

indicating a critical involvement of ERK1/2 and acting as a negative

regulator of the differentiation and mineralization of TG cells.

Compared to TCPS, treatment of U0126 further enhanced the ALP

activity and mineralization of TG cells grown on PVA, regardless of

the absence or presence of differentiation medium (

Fig. 4

). In each

case, the increasing expression of ALP activity and ARS assay

exceeded that of PVA or U0126 added alone, indicating that PVA

substrate and U0126 inhibitor synergistically promoted TG cell

differentiation and mineralization. In addition to enhanced ALP

activity and ARS assay, the synergistic effect was further conﬁrmed

by increased expression of OCN, OPN, DMP 1, and enamelin (

Fig. 5

).

These results suggested that TG cells, a heterogeneous population

of cells

[37]

, still had the differentiation and mineralization ability

when they cultured on PVA and treated with U0126.

Based on these results, we focused on deﬁning the speciﬁc

signaling pathway involved in PVA-promoted TG cell

differentia-tion and mineralizadifferentia-tion. Direct inhibidifferentia-tion of ERK1/2

phosphoryla-tion by the inhibitor of ERK1/2 U0126 has been related to the

osteoblast differentiation in C2C12 and MC3T3-E1 cells

[32,33]

. In

this study with TG cells, either cells on TCPS treated with U0126 or

on PVA without U0126 treatment inhibited ERK1/2

phosphoryla-tion (

Fig. 6

). Although the effect of PVA was not as stronger as that

of U0126, PVA itself still had the inhibition effect on the activation

of ERK1/2. Furthermore, cells exposed to PVA and U0126 in

combination seemed to exhibit a complete inhibition in ERK1/2

activity when compared with cells exposed to PVA or U0126 alone

(

Fig. 6

). The greater decrease in ERK1/2 activity coincides with the

synergistic effects between PVA and U0126 that TG cells exhibiting

more enhanced ALP activity and ARS assay and more increased

expression of OCN, OPN, DMP 1, and enamelin (

Figs. 4 and 5

).

Analysis of the signaling mechanism responsible for the ability of

PVA to promote differentiation and mineralization of TG cells

identiﬁed the ERK1/2 pathway play a direct and critical role, while

neither the p38 nor JNK pathway appeared to be involved (data not

- + - +

U0126 (50

µM)

TCPS

PVA

pERK1/2

ERK1/2

pERK1/2 / ERK1/2

0.0

0.2

0.4

0.6

0.8

Fig. 6. Western blots were performed with phosphorylated ERK1/2 and anti-ERK1/2 antibodies for TG cells cultured on TCPS and PVA in the differentiation medium for 4 h followed by treatment with or without U0126 for 30 min. The upper panel shows the ratio of phosphorylated to total ERK1/2, determined by band densitometry analysis. Results are mean SD from three independent experiments.

pERK1/2 / ERK1/2

0.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7 hours

4 8 12

TCPS

4 8 12

PVA

pERK1/2

ERK1/2

pERK1/2 / ERK1/2

0.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7 pERK1/2

ERK1/2

hours

4 8 12

TCPS

4 8

12 PVA

a

b

Fig. 7. Western blots were performed with phosphorylated ERK1/2 and anti-ERK1/2 antibodies for TG cells on TCPS and PVA in the (a) differentiation and (b) regular medium for 4, 8, and 12 h. The upper panel shows the ratio of phosphorylated to total ERK1/2, determined by band densitometry analysis. Results are mean SD from three independent experiments.

(7)

shown). In addition, in comparison with cells cultured on TCPS in

the regular medium, ERK1/2 phosphorylation was reduced in

a time-dependent manner for TG cells cultured on TCPS in the

differentiation medium and on PVA in the regular or differentiation

medium (

Fig. 7

). More importantly, decrease of ERK1/2 activation

was accompanied by an increase in ALP activity and mineralization

(

Figs. 1 and 2

). These results suggest that the ERK1/2 activation

negatively regulates differentiation and mineralization of TG cells

not only cultured on PVA but also treated by U0126. This study

demonstrated a novel role of PVA in promoting the differentiation

and mineralization of TG cells through ERK1/2 acting as a negative

regulator.

5. Conclusion

In summary, the exact regulatory mechanism of differentiation

and mineralization of TG cells by ERK1/2 pathways still remains

unclear. However, we demonstrated that the suppression of ERK1/2

pathway is one of the effects of PVA-promoted TG cell

differenti-ation and mineralizdifferenti-ation. PVA substrate can suppress ERK1/2

acti-vation and exposure of cells to U0126 further improves the

inhibitory effect. The results provide support for the potential

applications of PVA in TG cell investigation and the future

devel-opment of tooth regeneration.

Acknowledgement

The authors thank National Science Council of the Republic of

China for their ﬁnancial support of this research.

References

[1] Piesco NP, Avery JK. Development of tooth: crown formation. In: Avery JK, Steele PF, Avery NBFA, editors. Oral development and histology. 3rd ed. New York, USA: Thieme Medical Publishers; 2002. p. 72–106.

[2] Chaudhary LR, Hofmeister AM, Hruska KA. Differential growth factor control of bone formation through osteoprogenitor differentiation. Bone 2004 Mar;34(3):402–11.

[3] Yang X, Ricciardi BF, Hernandez-Soria A, Shi Y, Camacho NP, Bostrom MPG. Callus mineralization and maturation are delayed during fracture healing in interleukin-6 knockout mice. Bone 2007 Dec;41(6):928–36.

[4] Simmons CA, Matlis S, Thornton AJ, Chen SQ, Wang CY, Mooney DJ. Cyclic strain enhances matrix mineralization by adult human mesenchymal stem cells via the extracellular signal-regulated kinase (ERK1/2) signaling pathway. J Biomech 2003 Aug;36(8):1087–96.

[5] Chen RS, Chen YJ, Chen MH, Young TH. Cell–surface interactions of rat tooth germ cells on various biomaterials. J Biomed Mater Res A 2007 Oct;83(1):241–8. [6] Lewis TS, Shapiro PS, Ahn NG. Signal transduction through MAP kinase

cascades. Adv Cancer Res 1998;74:49–139.

[7] Cobb MH. MAP kinase pathways. Prog Biophys Mol Biol 1999;71(3–4):479–500. [8] Oh CD, Chang SH, Yoon YM, Lee SJ, Lee YS, Kang SS, et al. Opposing role of mitogen-activated protein kinase subtypes, erk-1/2 and p38, in the regulation of chondrogenesis of mesenchymes. J Biol Chem 2000 Feb 25;275(8):5613–9. [9] Watanabe H, de Caestecker MP, Yamada Y. Transcriptional cross-talk between Smad, ERK1/2, and p38 mitogen-activated protein kinase pathways regulates transforming growth factor-beta-induced aggrecan gene expression in chon-drogenic ATDC5 cells. J Biol Chem 2001 Apr 27;276(17):14466–73. [10] Stanton LA, Sabari S, Sampaio AV, Underhill TM, Beier F. p38 MAP kinase

signalling is required for hypertrophic chondrocyte differentiation. Biochem J 2004 Feb 15;378(Pt 1):53–62.

[11] Liu HC, Lee IC, Wang JH, Yang SH, Young TH. Preparation of PLLA membranes with different morphologies for culture of MG-63 Cells. Biomaterials 2004 Aug;25(18):4047–56.

[12] Ratisoontorn C, Seto ML, Broughton KM, Cunningham ML. In vitro differenti-ation proﬁle of osteoblasts derived from patients with Saethre-Chotzen syndrome. Bone 2005 Apr;36(4):627–34.

[13] Favata MF, Horiuchi KY, Manos EJ, Daulerio AJ, Stradley DA, Feeser WS, et al. Identiﬁcation of a novel inhibitor of mitogen-activated protein kinase kinase. J Biol Chem 1998 Jul 17;273(29):18623–32.

[14] Cuenda A, Rouse J, Doza YN, Meier R, Cohen P, Gallagher TF, et al. SB 203580 is a speciﬁc inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin-1. FEBS Lett 1995 May 8;364(2):229–33.

[15] Bennett BL, Sasaki DT, Murray BW, O’Leary EC, Sakata ST, Xu W, et al. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci U S A 2001 Nov 20;98(24):13681–6.

[16] Bleicher F, Couble ML, Farges JC, Couble P, Magloire H. Sequential expression of matrix protein genes in developing rat teeth. Matrix Biol 1999 Apr;18(2): 133–43.

[17] Kaneda T, Miyauchi M, Takekoshi T, Kitagawa S, Kitagawa M, Shiba H, et al. Characteristics of periodontal ligament subpopulations obtained by sequential enzymatic digestion of rat molar periodontal ligament. Bone 2006 Mar;38(3):420–6.

[18] Yokose S, Kadokura H, Tajima Y, Fujieda K, Katayama I, Matsuoka T, et al. Establishment and characterization of a culture system for enzymatically released rat dental pulp cells. Calcif Tissue Int 2000 Feb;66(2):139–44. [19] Lee DH, Lim BS, Lee YK, Yang HC. Effects of hydrogen peroxide (H2O2) on

alkaline phosphatase activity and matrix mineralization of odontoblast and osteoblast cell lines. Cell Biol Toxicol 2006 Jan;22(1):39–46.

[20] Cheng SL, Lai CF, Blystone SD, Avioli LV. Bone mineralization and osteoblast differentiation are negatively modulated by integrin alpha(v)beta3. J Bone Miner Res 2001 Feb;16(2):277–88.

[21] Julien M, Magne D, Masson M, Rolli-Derkinderen M, Chassande O, Cario-Toumaniantz C, et al. Phosphate stimulates matrix Gla protein expression in chondrocytes through the extracellular signal regulated kinase signaling pathway. Endocrinology 2007 Feb;148(2):530–7.

[22] Hata K, Ikebe K, Wada M, Nokubi T. Osteoblast response to titanium regulates transcriptional activity of Runx2 through MAPK pathway. J Biomed Mater Res A 2007 May;81(2):446–52.

[23] Lou J, Tu Y, Li S, Manske PR. Involvement of ERK in BMP-2 induced osteoblastic differentiation of mesenchymal progenitor cell line C3H10T1/2. Biochem Biophys Res Commun 2000 Feb 24;268(3):757–62.

[24] Huang TH, Ding SJ, Hsu TC, Kao CT. Effects of mineral trioxide aggregate (MTA) extracts on mitogen-activated protein kinase activity in human osteosarcoma cell line (U2OS). Biomaterials 2003 Oct;24(22):3909–13.

[25] Hunter GK, Hauschka PV, Poole AR, Rosenberg LC, Goldberg HA. Nucleation and inhibition of hydroxyapatite formation by mineralized tissue proteins. Biochem J 1996 Jul 1;317(Pt 1):59–64.

[26] Higuchi C, Myoui A, Hashimoto N, Kuriyama K, Yoshioka K, Yoshikawa H, et al. Continuous inhibition of MAPK signaling promotes the early osteoblastic differentiation and mineralization of the extracellular matrix. J Bone Miner Res 2002 Oct;17(10):1785–94.

[27] Foster BL, Nociti Jr FH, Swanson EC, Matsa-Dunn D, Berry JE, Cupp CJ, et al. Regulation of cementoblast gene expression by inorganic phosphate in vitro. Calcif Tissue Int 2006 Feb;78(2):103–12.

[28] Baba O, Qin C, Brunn JC, Wygant JN, McIntyre BW, Butler WT. Colocalization of dentin matrix protein 1 and dentin sialoprotein at late stages of rat molar development. Matrix Biol 2004 Oct;23(6):371–9.

[29] Sire JY, Davit-Beal T, Delgado S, Gu X. The origin and evolution of enamel mineralization genes. Cells Tissues Organs 2007;186(1):25–48.

[30] Wang HJ, Tannukit S, Zhu DH, Snead ML, Paine ML. Enamel matrix protein interactions. J Bone Miner Res 2005 Jun;20(6):1032–40.

[31] Hung CH, Lin YL, Young TH. The effect of chitosan and PVDF substrates on the behavior of embryonic rat cerebral cortical stem cells. Biomaterials 2006 Sep;27(25):4461–9.

[32] Wang CC, Lu JN, Young TH. The alteration of cell membrane charge after cultured on polymer membranes. Biomaterials 2007 Feb;28(4):625–31. [33] Lee HS, Huang GT, Chiang H, Chiou LL, Chen MH, Hsieh CH, et al.

Multipo-tential mesenchymal stem cells from femoral bone marrow near the site of osteonecrosis. Stem Cells 2003;21(2):190–9.

[34] Kono SJ, Oshima Y, Hoshi K, Bonewald LF, Oda H, Nakamura K, et al. Erk pathways negatively regulate matrix mineralization. Bone 2007 Jan;40(1): 68–74.

[35] Nakashima K, Zhou X, Kunkel G, Zhang Z, Deng JM, Behringer RR, et al. The novel zinc ﬁnger-containing transcription factor osterix is required for oste-oblast differentiation and bone formation. Cell 2002 Jan 11;108(1):17–29. [36] Lai CF, Chaudhary L, Fausto A, Halstead LR, Ory DS, Avioli LV, et al. Erk is

essential for growth, differentiation, integrin expression, and cell function in human osteoblastic cells. J Biol Chem 2001 Apr 27;276(17):14443–50. [37] Zhao M, Xiao G, Berry JE, Franceschi RT, Reddi A, Somerman MJ. Bone

morphogenetic protein 2 induces dental follicle cells to differentiate toward a cementoblast/osteoblast phenotype. J Bone Miner Res 2002 Aug;17(8): 1441–51.