• 沒有找到結果。

Mitochondrial protein ATPase family, AAA domain containing 3A correlates with radioresistance in glioblastoma

N/A
N/A
Protected

Academic year: 2021

Share "Mitochondrial protein ATPase family, AAA domain containing 3A correlates with radioresistance in glioblastoma"

Copied!
1
0
0

加載中.... (立即查看全文)

全文

(1)

Mitochondrial protein ATPase

family, AAA domain containing 3A

correlates with radioresistance in

glioblastoma

Weir-Chiang You, Shiow-Her Chiou, Chih-Yang Huang, Shu-Fen

Chiang,

Cheng-Lin Yang, Janaki N. Sudhakar, Tze-Yi Lin, I-Ping Chiang,

Chiung-Chyi Shen,

Wen-Yu Cheng, Jin-Chin Lin, Shwn-Huey Shieh, and Kuan-Chih

Chow

Department of Radiation Oncology, Taichung Veterans General Hospital, Taichung, Taiwan (W.-C.Y., J.-C.L.);

Graduate Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan(W.-C.Y., C.-L.Y.,

J.N.S., K.-C.C.); Graduate Institute of Microbiology and Public Health, National Chung Hsing University,

Taichung, Taiwan (S.-H.C., C.-Y.H., S.-F.C.); Cancer Center, ChinaMedical University Hospital, Taichung,

Taiwan (S.-F.C.); Department of Pathology, China Medical University Hospital, Taichung, Taiwan (T.-Y.L.,

I.-P.C.); Department of Neurosurgery, Taichung Veterans General Hospital, Taichung, Taiwan (C.-C.S.,W.-Y.C.);

(2)

Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (C.-C.S.); Institute of

Molecular Biology, National Chung Hsing University, Taichung, Taiwan (W-Y.C.); Department of Physical

Therapy, HungKuang University, Taichung, Taiwan (W.-Y.C.); Department of Health Service Administration,

China Medical University, Taichung, Taiwan (S.-H.S.)

Background. ATPase-family, AAA domain containing 3A (ATAD3A) is located on human chromosome

1p36.33, and high endogenous expression may associate with radio- and chemosensitivity. This study was conducted to investigate the significance of ATAD3A in glioblastoma multiforme (GBM).

Methods. Clinical significance of ATAD3A expression

was assessed by immunohistochemistry in 67 GBMspecimens, and prognostic value was assessed in 32 GBM patients

statistically. To investigate in vitro phenotypic

effects of ATAD3A, cell viability was measured using a clonogenic survival assay under either knockdown or ectopic expression of ATAD3A in GBM cell lines. The effects of ATAD3A knockdown on targeted DNA

repair-associated proteins in T98G cells were evaluated using immunofluorescence and Western blotting.

Results. Clinically, high expression of ATAD3A was independent ofO6-DNAmethylguanine-methyltransferase

(3)

In vitro, high ATAD3A-expressing T98G cells were

more resistant to radiation-induced cell death compared with control and low endogenous ATAD3A U87MG cells. After silencing ATAD3A, T98G cells became more sensitive to radiation. On the other hand, enforced ATAD3A expression in U87MG cells exhibited increased radioresistance. ATAD3A may coordinate with aldo-keto

reductase genes and participate in bioactivation or detoxication of temozolomide. Surprisingly, deficient DNA

repair after irradiation was observed in T98G/ATAD3A

knockdown as a result of decreased nuclear ataxia telangiectasiamutated kinase and histonesH2AXandH3, which

was also evidenced by the sustained elevation ofpoly (ADPribose) polymerase prior to and after radiation treatment.

Conclusion. Our data suggest that high expression of ATAD3A is an independent biomarker for radioresistance in GBM. ATAD3A could be a potential target for therapy. Keywords: ATAD3A, autophagy, DNA repair,

glioblastoma multiforme, radiation.

G

lioblastoma multiforme (GBM) is one of the most aggressive brain tumors, with dismal prognosis.

More than 70% of GBM patients die within

2 years after diagnosis, even under intensivemultimodality chemoradiation with an oral alkylating agent, temozolomide (TMZ).1 Identifying and understanding the biology

(4)

behind novel chemo- and radioresistant markers in GBM would shed light on improving the current therapeutic

Corresponding Author: Kuan-Chih Chow, PhD, Graduate Institute of Biomedical Sciences, National Chung Hsing University, 250 Kuo-Kuang Road, Taichung 40227, Taiwan ([email protected]). Received June 6, 2012; accepted April 20, 2013.

Neuro-Oncology 15(10):1342–1352, 2013.

doi:10.1093/neuonc/not077

NEURO-ONCOLOGY

#The Author(s) 2013. Published by Oxford University Press on behalf of the Society for

Neuro-Oncology.

All rights reserved. For permissions, please e-mail: [email protected].

Downloaded from http://neuro-oncology.oxfordjournals.org/ at China Medical University Library on March 24, 2014

approaches. Clinically, the methylation status of the methylguanine-DNA-methyltransferase (MGMT) gene

promoter is a strong indicator of survival benefits of radiotherapy and TMZ.2 Besides,mutation at codon 132 of isocitratedehydrogenase

1,whichwas stronglyassociatedwith

codeletion of 1p or 19q,was prognostic as well for secondary GBM.3,4 However, the incidence of isolated 1p or 19q

deletions among primary GBM has been low, at 6.2% and 5.3%, respectively.5

Ataxia telangiectasia mutated kinase (ATM) responds

to DNA double-stranded breaks (DSBs) immediately following radiation exposure. In gliomas, ATMplays a critical

role in radiation resistance,6 and the expression level

(5)

Since ATM became an attractive target for tumor radiosensitization, several inhibitors of ATM activity have

been developed, aimed to improve radiotherapy. However, ATM inhibitors were reported to be effective in eliminating only cancer cells that express functional ATM protein with already compromised DNA repairs.9

Recently, ATM was found to be tightly associated with mitochondrial homeostasis, and it has been suggested that ataxia-telangiectasia could be considered as a part of mitochondrial disease.10

Mitochondria play essential roles in cancer progression, in particular in metabolically remodeled phenotypes, which predominantly use aerobic glycolysis as an

energy source (Warburg effect).11 Accumulated evidence

indicates that some nucleus-encoded mitochondrial proteins are involved in tumorigenesis.12 An altered mitochondrial

genome has been frequently found in GBM and shown to adapt to bioenergetic stress.13,14

Furthermore, mitochondrial dysfunction was reported to be associated with increasing damage to reactive

oxygen species and the onset of several neurodegenerative diseases and neoplasms.15 Therefore, mitochondrial proteins

indeed might be novel therapeutic targets to implement the existing treatments of GBM.16

The ATPase family, AAA domain containing 3A (ATAD3A; 66 kDa) is an essential mitochondrial

(6)

enzyme involved in maintaining mitochondrial functions and communication between endoplasmic reticulum (ER) and mitochondria.17–19 ATAD3A was first identified

as a tumor-specific antigen20,21 and was later shown

to have roles in lung adenocarcinoma,19 uterine cervical

cancer,22 and prostate cancer.23 Its clinical significance

was further supported by in vitro data, in which cancer cells with ATAD3A overexpression were more resistant to anticancer drugs.21 Interestingly, the ATAD3A gene

is located on human chromosome 1p36.33 and has been shown in human glioma cell lines to be correlated with cell growth and resistance to genotoxic drugs.24

Although deletion/alteration in the distal short arm of chromosome 1 (1p) has been associated with chemoand radiosensitivity in oligodendrogliomas and other

brain tumors, no specific tumor-related gene to date

has been identified as conferring this to a treatmentresistant phenotype.25,26 In this report, we demonstrate

that ATAD3A expression correlates with treatment response in a primary GBM chemoradiation cohort, implicating ATAD3A as a possible prognostic marker and therapeutic target in GBM. We also investigated the ATAD3A-associated chemo- and radioresistant mechanisms in GBM.

Materials and Methods

(7)

of ATAD3A Expression

The protocol of the study, including tissue specimen collection, pathology evaluation, and survival assessment,

was approved by the institutional review board of our hospital. Tissue microarrays of 35 American GBM samples (GL806, US Biomax) were used to compare ATAD3A expression between American and our GBM patients. Immunohistological staining was performed on paraffin sections using a labeled streptavidin–biotin method (Dako).18,19,22,23 The chromogenic reaction

was visualized by peroxidase-conjugated streptavidin

and aminoethyl carbazole (Sigma). Samples were counterstained with Mayer’s hematoxylin. Slides were evaluated

by 2 independent pathologists without knowledge of patient’s’ clinicopathological background. An immune-reaction scoring system was adapted for this study.27 Briefly, a specimen was considered to have

strong signalswhen .50% of cancer cells were positively stained; intermediate signals if 25%–50% of cells were positively stained; weak signals if ,25% or .10% of cells were positively stained; and negative signals if ,10% of cancer cells were positively stained. The

samples with strong and intermediate signals were classified as ATAD3A+; those with weak or negative signals

were classified as ATAD3A– .

(8)

Total RNA was extracted from 32 paraffin wax embedded samples of GBM patients using a standard TRIzol

protocol. RNA quantity was examined using a NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific). Total RNA was reverse transcribed using cDNA by random hexamer primers and the High Capacity cDNA Reverse Transcription Kit (Applied

Biosystems,Life Technologies) according to the manufacturers’ protocol. Real-time PCR was carried out in triplicates

in 48-well plates using the StepOne RT-PCR machine (Applied Biosystems, Life Technologies). Forward primer was GCGTTTCGACGTTCGTAGGT; reverse primer was CACTCTTCCGAAAACGAAACG; and the probe was 6FAM-AAACGATACGCACCGC GA-MGB in the assay.

Cell Culture and Alteration of ATAD3A Expression Using Lentivirus-carrying Short Hairpin RNA and Ectopic Plasmid

Human GBM cell lines U87MG (malignant glioma) and T98G were obtained from American Type Culture Collection and grown in Dulbecco’s modified Eagle’s

You et al.: ATAD3A is a radioresistant marker in GBM

NEURO-ONCOLOGY † OCTOB E R 2 0 1 3 1343

Downloaded from http://neuro-oncology.oxfordjournals.org/ at China Medical University Library on March 24, 2014

medium supplemented with 10% fetal bovine serum, 4 mM glutamine, 100 U/mL penicillin, and 100 mg/mL

(9)

streptomycin. The cells were grown to 80% confluence on the day of infection. Lentivirus-carrying ATAD3A short hairpin (sh)RNA was prepared using a 3-plasmid transfection method.28 The product lentivirus was used

to infect T98Gcells in the presence of 8 mg/mLpolybrene, and cells with ATAD3A gene knockdown (ATAD3Akd)

were selected using 1 mg/mL puromycin. For ectopic expression, pCMV-SPORT6-ATAD3A (www.Invitrogen.

com) was delivered into U87MG cells by the ECM 399 electroporation system (BTX Harvard Apparatus). Immunoblotting Analysis

The procedure for immunoblotting has been described previously.18,19,22,23 Briefly, 30 mg of total cell lysate

was separated on a 10% polyacrylamide gel with 4.5% stacking gel. After electrophoresis, proteins were transferred to a nitrocellulose membrane. The membrane

was then probed with specific antibodies. The protein was visualized by exposing the membrane to X-Omat film (Eastman Kodak) with enhanced chemiluminescent reagent (Merck). The respective primary antibodies

were mouse anti-ATAD3A, mouse anti–dihydrodiol dehydrogenase (DDH), mouse anti–Nijmegen breakage

syndrome 1 (NBS1), mouse anti–checkpoint kinase 2, mouse anti–epidermal growth factor receptor, mouse anti–human epidermal growth factor receptor 2 (HER2), mouse anti–b-actin, rabbit anti–poly (ADP-ribose) polymerase

(10)

(PARP), rabbit anti-histone H3, rabbit anti-p53, rabbit anti–light chain 3 (LC3), rabbit anti-ATM, rabbit anti–phosphorylated (phospho-) ATM (Ser1981), rabbit anti-histone H2AX, and rabbit anti–phospho-g-H2AX (Ser193). Rabbit antisera were purchased from Cell Signaling Technology. The digital images on X-Omat film were processed in Adobe Photoshop 7.0 (http:// www.adobe.com/). The blots were stripped using Restore Western Blot Stripping Buffer (Thermo Fisher Scientific) before incubation with other antibodies. The results were analyzed and quantified by ImageJ software (National Institutes of Health).

Colony-forming Assay and g-H2AX Assay

T98G/empty vector (EV), T98G/ATAD3Akd, U87MG/

EV, and U87MG with enforced ATAD3A expression (U87MG/ATAD3Aee) cells were separately treated with

3, 6, or 12 Gy of radiation (Varian Oncology Systems 21EX linear accelerator). Following radiation, cells were trypsinized and reseeded at 100, 500, 2000, and 5000 cells/well culture plates, respectively. The cells were incubated at 378C for 10 days, visible colonies that contained .50 cells were counted, and plating efficiency was determined. A semilog graph was plotted of the cell survival fractions (ratio of colonies formed by irradiated cells to colonies formed by control cells) against radiation dosage.

(11)

The g-H2AX foci were detected by antibodies specific to g-H2AX and observed by a laser scanning confocal

microscope 1 h postradiation (6 Gy). The method for immunofluorescence confocal microscopy has been described

previously.18,19,22,23 Briefly, the cells on slides

were fixed with 4% paraformaldehyde at room temperature for 15 min and permeabilized with 0.1% Triton

X-100 prior to staining with rabbit anti–g-H2AX (1 : 100). After washing off the primary antibodies, the slides were incubated with Alexa Fluor 488–conjugated goat anti-rabbit immunoglobulin G (Invitrogen). The nuclei were stained with 4′,6-diamidino-2-phenylindole

(DAPI),andthe slideswere examined undera laser confocal microscope (Olympus FV-1000). Images of the cells were analyzed by FV10-ASW3.0 software (Olympus).

Electron Microscopy

Electron microscopywas carried out using a routine protocol. Briefly, cells were fixed in situ on culture dishes with

2.5%glutaraldehyde (Sigma) in 100 mMphosphate buffered saline (PBS; pH 7.2) at 48C overnight. Cells were

washed with PBS before postfixation with1% osmium tetroxide in PBS for 1 h. After washing with distilled water,

the cells were suspended in 2% molten agarose, and the agarose blocks were trimmed and dehydrated in a serial dilution of ethanol for 15 min each. The blocks were further dehydrated 3 times using 100% ethanol for

(12)

15 min each and infiltrated with 100% ethanol/LR

white (1 : 1) mixture overnight. The blocks were changed to LR white (Agar Scientific) for continuous infiltration at 48C for 24 h before being transferred to a capsule filled with LR white. LR white was polymerized and solidified at 608C for 48 h. The resin blocks were trimmed and cut with ultramicrotome (Leica Ultracut R). Thin sections were transferred to 200 mesh copper grids and stained with 2% uranyl acetate for 15 min and 2.66% lead citrate (pH 12.0) for 15 min prior to observation with an electron microscope (JEM1400, JEOL) at 100–120 kV. Gel Electrophoretic Analysis of DNA Double-Stranded Breaks

The cells were collected by centrifugation at 3000 × g for 5 min and washed once with cold isotonic buffer (20 mM Hepes [4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid], pH 7.5; 5 mM KCl; 0.5 mM MgCl2; 0.5 mM

dithiothreitol; 0.2 Msucrose). The cells were resuspended in cold hypotonic buffer (20 mM Hepes, pH 7.5;

5 mM KCl; 0.5 mM MgCl2; 0.5 mM dithiothreitol) and

allowed to swell for 10 min on ice. The plasmamembrane was broken down by 10 strokes of a tight-fitting Dounce homogenizer. The resulting mixture was centrifuged at 2000 × g for 5 min to remove membrane debris. The nuclear pellet was resuspended in 50 mM Hepes, pH 7.5, and 10% sucrose.18 Following disruption of the

(13)

nuclear membrane by 1% NP-40 (nonyl phenoxypolyethoxylethanol) and repeated washing, the ends of DNA

fragments were labeled with fluorescein isothiocyanate (FITC)–deoxythymidine triphosphate and terminal transferase. The reaction was stopped by addition of 0.1% sodium dodecyl sulfate (SDS). The reaction

You et al.: ATAD3A is a radioresistant marker in GBM

1344 NEURO-ONCOLOGY † OCTOB E R 2 0 1 3

Downloaded from http://neuro-oncology.oxfordjournals.org/ at China Medical University Library on March 24, 2014

mixture was heated at 808C for 5 min, and the reaction products were resolved in 2% agarose gel with 0.1%

SDS. The DNA was transferred to a nitrocellulose membrane and probed by alkaline phosphatase–conjugated

rabbit anti-FITC antibodies. TheDNAfragments were visualized by exposing the membrane to X-Omat film with

enhanced chemiluminescent reagent. Statistical Analysis

Progression-free survival (PFS) and overall survival (OS) were the times from the date of diagnosis until the date of progression and death, respectively. Survival curves were plotted using the Kaplan–Meier estimator, and the statistical difference in survival between the different groups was compared by a log-rank test. A 2-tailed

t-test was used to compare clonogenic survival and clinical parameters. Differences in patients’ performance

(14)

were assessed by chi-square or Fisher’s exact test.

Analyses of the data were performed using SPSS 10.3 software. Statistical tests were 2-sided, and P , .05 was considered significant.

Results

Identification and Validation of Endogenous ATAD3A Expression in GBM

In our previous work, 66-kDa ATAD3A and 70-kDa ATAD3A were identified as serine/threonine

phosphorylated isoforms by immunoprecipitation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (Fig. 1A).19 Of note, only the 70-kDa

ATAD3A, not the 66-kDa isoform, could be detected in normal mouse brain (Fig. 1B). To determine the protein level of endogenous ATAD3A in brain tumors, a mouse glioma cell line (H4), 2 human GBM cell lines (U87MG

and T98G), and 3 humanGBMstem cell lines were investigated by immunoblotting. We observed high endogenous

ATAD3A expression in H4 and T98G, as well as

CD133+ humanGBMstem cells. Interestingly, its expression

correlated with HER2 (ErbB-2, neuro/GBMderived oncogene homolog [Neu]; Fig. 1C). Indeed, both the 66-and 70-kDa isoforms were detected in H4, U87MG, and T98G cell lines; we found that only the single 66-kDa protein band was presented in human GBM stem cells and human GBM specimens (Fig. 1D). These

(15)

results corresponded well with our previous finding in lung cancer that only the 66-kDa isoform could be found in human pathologic specimens.19

Expression ofATAD3AinGBMand Its Prognostic Value From August 2008 to October 2010, 32 GBM patients who received standard chemoradiation with daily TMZ (75 mg/m2) and adjuvant monthly TMZ (150–

200 mg/m2) were retrospectively reviewed in this study.

Demographics and treatment parameters of these patients are listed in Table 1. Using immunohistochemical staining, the expression level of ATAD3A was classified as

ATAD3A+ in 21 of 32 (65.6%) GBM patients (Fig. 2A

and B) and in 25 of 35 (71.4%) American GBM samples

Fig. 1. Identification and validation of endogenous ATAD3A expression in GBM cell lines. (A) Illustration of 66-/70-kDa ATAD3A. (B) Only

70-kDa ATAD3A could be detected in normal mouse brain tissue. (C) The endogenous ATAD3A expression was high in mouse H4 and

human T98G cells and in human GBM stem cells, especially in CD133+ stem cells, and corresponded well with HER2 expression. (D) Only

66-kDa ATAD3A could be detected in human GBM specimens. Abbreviation: GSC, glioma stem cell.

You et al.: ATAD3A is a radioresistant marker in GBM

NEURO-ONCOLOGY † OCTOB E R 2 0 1 3 1345

Downloaded from http://neuro-oncology.oxfordjournals.org/ at China Medical University Library on March 24, 2014

(P 15 .609; Figs 1F–2C). No significant correlation was found between MGMT and ATAD3A in tumor specimens. At the time of data analysis (followed at least

(16)

24 months), 5 of 11 (45.5%) ATAD3A+ patients were

alive, and 1 was progression free. TheATAD3A2 patients

had significantly better OS and PFS (P 16 .001 and P ¼ .022, respectively; Fig. 2G and H). Multivariate analysis of age, KPS,MGMTstatus,andATAD3A2demonstrated

that ATAD3A2 was an independent prognostic factor

(P 16 .005, hazard ratio 16 0.161, 95% confidence interval 16 0.045–0.57). It is worthwhile to note that the ATAD3A2 patients with methylated MGMT had

the best prognosis (Fig. 2I).

Endogenous ATAD3A Expression Correlated With Radiosensitivity and TMZ Resistance

These data raised a possibility that ATAD3A+ is a prognostic

phenotype as a result of radiation or TMZ resistance. On the basis of this hypothesis, we used the

colony-forming assay to determine the viability of GBM cells after irradiation. First, high ATAD3A-expressing T98G cells exhibited higher resistance to radiation compared with low ATAD3A-expressing U87MG cells (P 16 .001; Fig. 3A). To further investigate whether ATAD3A could modulate radiosensitivity in GBM, we used T98G/EV and T98G cells stably transfected with lentivirus-carrying shRNA (T98G/ATAD3Akd) and

U87MG/EV and U87MG cells stably transfected with ATAD3A expression vector (U87MG/ATAD3Aee). As

(17)

T98G/EV cells, which exhibited constitutive expression of ATAD3A, had increased levels of ATAD3A protein compared with U87MG/EV and T98G/ATAD3Akd

cells (Fig. 3B).

As expected, a drastic loss of colony-forming ability occurred after irradiation when T98G cells were treated with ATAD3Akd (P 17 .009; Fig. 3D). The combination

ofTMZand radiation significantly decreased the survival fraction of T98G/ATAD3Akd cells, but not T98G/EV

cells (P 17 .002). On the other hand, enforced expression of ATAD3A significantly increased radiation resistance (P 17 .005; Fig. 3E). Addition of TMZ could radiosensitize only U87MG/EV (P , .001) but not U87MG/

ATAD3Aee cells, implying that ATAD3A may have a

role in TMZ efficacy (Fig. 3C). We therefore used an oligonucleotide microarray to identify regulating genes

that could be involved in TMZ and radiation resistance of T98G/ATAD3Akd cells. As shown in Table 2, several

DNA repair-related genes, including H2AFX, Rad9B, Hus1B, MSH4, and LIG4, were affected by silence of ATAD3A but not MGMT. Most importantly, we found aldo-keto reductase (AKR) family genes that took part in resistance to cisplatin andTMZ. Markedly suppressed by ATAD3Akd were AKR1B10, AKR1B15, AKR1C1,

AKR1C3, and AKR1C4. Further immunoblotting corroborated that DDH was coexpressed with ATAD3A in

(18)

GBM cell lines (Fig. 3D), and the expression was reduced as well in T98G/ATAD3Akd cells (Fig. 3E).

Silence ofATAD3AAbated Repair of Radiation-Induced DNA Damage

Based on our results, it wasreasonable to hypothesize that modulation of radioresistance by ATAD3A in GBM was related to DNA DSB repairs. Surprisingly, our initial studies revealed that the number of g-H2AX foci in T98G/ATAD3Akd cells not only was less than wild-type

T98 cell lines, but even dropped significantly lower upon 6-Gy radiation (P , .001; Fig. 4A and B). To

ensure the status of unrepaired DSBs, gel electrophoresis

Table 1. Characteristics of patients with different ATAD3A expression levels Characteristic ATAD3A2 (n 5 11) ATAD3A1 (n 5 21) P Gender .205a M 5 15 F 6 6 Age, y 55.6+12.0 56.2+18.3 .923b KPS .391a 60 1 3 70–80 10 16

(19)

90 0 2 RTOG RPA .717a III 0 2 IV 3 4 V–VI 8 15 Surgical resection status .177a Gross total 9 20 Partial 2 0 Biopsy only 0 1 Tumor location .866 Right 7 13 Left 4 8 Frontal 4 4 Parietal 1 3 Occipital 2 4 Temporal 3 8 Others 1 2 MGMTstatus .681a Methylated 4 5 Unmethylated 7 16 Radiotherapy dose 5912.7+289.5 5840.0+408.9 .605b TMZ cycle 7.29+2.6 6.63+5.7 .773b MRI assessment Gross tumor

(20)

volume

56.6+34.9 53.9+28.9 .846b

Edematous volume

141.8+73.8 147.8+67.5 .850b

Abbreviation: RTOG RPA, Radiation Therapy Oncology Group Recursive Partitioning Analysis.

aAnalysis by Fisher’s exact test (2-tailed, trend).

bAnalysis by t-test (2-tailed).

You et al.: ATAD3A is a radioresistant marker in GBM

1346 NEURO-ONCOLOGY † OCTOB E R 2 0 1 3

Downloaded from http://neuro-oncology.oxfordjournals.org/ at China Medical University Library on March 24, 2014

assay was performed 4 h after radiation treatment and showed that silencing of ATAD3A mitigated DSB

repairs in T98G cells, corroborated by the results of g-H2AX studies (Fig. 4C). Although the immunoblotting of whole cell and nuclear protein extraction showed elevated ATM and NBS1 in T98G/ATAD3Akd cells prior

Fig. 2. Representative examples of ATAD3A expression level in GBM specimens by immunohistochemical staining (as crimson precipitates in

cytoplasm). The slides were counterstained with hematoxylin. Illustration of (A) ATAD3A2 and (B)

ATAD3A+ in our patients (original

magnification × 400). Illustration of (C) ATAD3A2 and (D) ATAD3A+ in American GBM specimens (original magnification × 50). (E) An

enlarged image of (C). (F) An enlarged image of (D) (original magnification × 400). (G) Comparison of Kaplan–Meier product limit estimates

(21)

of survival analysis in 32 GBM patients. Patients with ATAD3A+ phenotype had significantly poorer OS (P 21 .01) and (H) PFS (P 21 .013).

You et al.: ATAD3A is a radioresistant marker in GBM

NEURO-ONCOLOGY † OCTOB E R 2 0 1 3 1347

Downloaded from http://neuro-oncology.oxfordjournals.org/ at China Medical University Library on March 24, 2014

to irradiation, markedly attenuated g-H2AX, upstream phospho-ATM-S1981, ATM, and NBS1 were found after radiation treatment (Fig. 4 D). Nuclear histones

H2AX and H3 were found greatly reduced as well, supporting the status of deficient DSB repairs in T98G/

ATAD3Akd cells after irradiation (Fig. 4D).

ATAD3A Silence-Induced Mitochondrial Dysfunction Alters Nuclear ATM

Our previous studies showed that ATAD3A, an ATPase, might interact with mitofusin-2 and dynamin-related protein 1 and act together in communication between the ER and mitochondria-associated membrane (MAM).19 ATM contains a potential signal peptide

motif (analyzed by SignalP, http://www.cbs.dtu.dk/;

Supplementary material Fig. S1) and anERmembrane retention signal sequence,WKAW, at the C-terminus of the

protein (Psort II prediction, http://psort.hgc.jp/form2. html), supporting the view that ATM could be targeting to the ER and mitochondrial membrane network. It was reported as well that a fraction of ATM protein is localized in mitochondria and could be activated by mitochondrial

(22)

dysfunction.29 Knockdown of ATAD3A could

significantly affect the state of mitochondrial integrity, resulting in dysfunction of mitochondria-ER contact sites,

and thus alter ATM. Electron micrographs provided the evidence that ATAD3A silencing increased autophagylike vacuoles with encased mitochondria in T98G cells (Fig. 5A). Immunoblotting of nuclear protein extractions and confocal immunofluorescent micrographs demonstrated that nuclear ATM was decreased in T98G/

ATAD3Akd Fig. 2 Continued cells after irradiation, leaving a noticeable

Fig. 3. EndogenousATAD3Aexpression correlates with radiosensitivity inGBMcells. (A)Cell viability of wild-type T98G, wild-typeU87MG,and

T98G/ATAD3Akd cells by colony-forming assay after different radiation dose treatments. The wild-type

T98G, U87MG, and T98G/ATAD3Akd

cellswere exposed to irradiation (0, 3, 6, or 12 Gy) and incubated for 10 days until colonies appeared. Viability was assessed following staining of

colonies by crystal violet. Cell viability was evidently reduced in T98G-ATAD3Akd cells, suggesting that ATAD3A expression correlated with

radiosensitivity. (B) Validation of silencing of ATAD3A expression (ATAD3Akd) by immunoblot. Reduced cell viability of ATAD3Akd cells after

irradiation with and without TMZ (as measured by colony-formation assay). W, T98G/EV cells; †, T98G/ATAD3Akd cells. Adding 50 mM

TMZ radiosensitized T98G/ATAD3Akd (O) but not T98G/EV (△) cells. (C) Validation of enforced ATAD3A expression (ATAD3Aee) by

immunoblotting. Radioresistance by ATAD3Aee was seen in U87MG cells after irradiation with and without TMZ. B, U87MG/EV cells;

(23)

A, U87MG/ATAD3Aee cells. TMZ radiosensitized U87MG/EV cells (V) but did not affect cell viability of U87MG/ATAD3Aee cells(¯). (D) The

expression between ATAD3A and DDH is highly correlated, as shown by immunoblotting. GSC, glioma stem cell. (E) Knockdown of ATAD3A

reduced DDH expression in T98G cells.

You et al.: ATAD3A is a radioresistant marker in GBM

1348 NEURO-ONCOLOGY † OCTOB E R 2 0 1 3

Downloaded from http://neuro-oncology.oxfordjournals.org/ at China Medical University Library on March 24, 2014

amount of cytoplasmic ATM, corresponding well with immunoblotting data (Fig. 5B and C). We reasoned that in mitochondrial dysfunction and deficient DNA DSB

repair, T98G/ATAD3Akd cells would go on a classic apoptotic

pathway. We therefore examined the cytologic

effect of ATAD3A on apoptotic pathways following irradiation using sub-G0/G1 analysis. Interestingly, the increase

of sub-G1 fractions in T98G/ATAD3Akd cells

was minimal up to 72 h posttreatment compared with the wild-type cells (Fig. 5D), indicating that although ATAD3A silencing was associated with deficient DNA

DSB repairs, the status might not directly induce apoptosis. This also was supported by immunoblotting data, in

which knockdown of ATAD3A did not evidently enhance apoptosis (as determined by an increase of cleaved PARP; Fig. 5D).30 Type II autophagic cell death

(as determined by an increase of converted microtubuleassociated protein 1A/1B–LC3; Fig. 5E) seems the best

(24)

possibility.However, increased autophagy did not invariably lead to cell death. In addition, sustained elevation of PARP in T98G/ATAD3Akd cells before and after irradiation

not only indicated an activation of an alternative pathway of DSBs as a result of hindering ATM and H2AX-mediatedDNArepair, but also raised the possibility of type III necrotic cell death.

Discussion

The clinical outcomes of 32 newly diagnosed GBM cases in our study suggested that ATAD3A overexpression in GBM is independent of MGMT promoter methylation status and could be a prognostic marker in GBM. Subgroup analysis indicated not only that ATAD3A was a significant marker for survival, but that the

ATAD3A2 GBM patients with methylated MGMT had

the best prognoses. In accordance, high endogenous ATAD3A confers a radioresistant phenotype in T98G and U87MG cells in vitro. Silencing of ATAD3A enhanced radiosensitivity of radioresistant T98G cells.

Enforced expression of ATAD3A, on the other hand, increased radiation resistance of low ATAD3A-expressing

U87MG cells. It is reasonable to suspect that the worst survival of theGBM patients with high ATAD3A expression was due to a treatment-resistant phenotype.

Ourpreliminary results demonstrated that high endogenous ATAD3A expression could be a prognostic phenotype

(25)

for TMZ resistance as well. Although the

endogenous ATAD3A expression of T98G (unmethylated MGMT) happened to be higher than U87MG

(methylated MGMT), MGMT genes were not affected by silencing of ATAD3A in T98G cells. An elegant

study by Oliva et al31 showed thatTMZcould not only introduce

intranuclear DNA damage, but also alter activities of the electron transport chain in mitochondria by increasing oxidative phosphorylation via cytochrome c oxidase and reducing production of reactive oxygen species via oxidoreductase in complex I. A report by Le Calve´ et al32 showed that long-term treatment of GBM

cells with TMZ in vitro could increase drug resistance

by upregulating expressions of AKR and glucose transporter, which ultimately affect oxidative metabolism of

mitochondria. Overexpression of AKR enzymes was associated with cisplatin resistance and disease progression.

33–35 In our study, TMZ could radiosensitize only

low ATAD3A-expressing U87MG/EV and T98G/ ATAD3Akd cells but not high ATAD3A-expressing

T98G/EV and U87MG/ATAD3Aee cells. Using immunoblotting

and microarray, we speculated that

ATAD3A coordinated with DDH as well as expressions

of AKR genes and participated in bioactivation or detoxication of TMZ.

(26)

function, but also defecting radiation-induced DNA DSB repairs via manipulating nuclear ATM and H2AX compartmentalization. It is known that radiation can induce a range of DNA damage, including singlestranded breaks and DSBs that both promote genomic

as well as mitochondrial instability; and a drastic increase (2.5-fold) of mitochondrial DNA would result 48 h after irradiation in fibroblasts compared with nonirradiated

control.36 In particular, increased ATM has also been reported

in mitochondrial fractions of wild-type lymphoblastoid cells after irradiation, and ATM deficiency

would result in defects in mitochondrial biogenesis and mitochondrialDNAcontent upon radiation treatment.29

Furthermore, in the study by Watters et al,37 ATM was

recognized by ER-associated peroxisome targeting signal type 1 (PTS1) via the PTS1 receptor (Pex5p) and got imported into peroxisomes via the PTS1 pathway. The relative amount of ATM in the postmitochondrial fraction in peroxisome-disordered fibroblasts is significantly reduced compared with the norm, supporting our

Table 2. Downregulation of AKR family and DNA

repair-associated genes in ATAD3Akd T98G cells as determined by oligonucleotide microarray

Gene Name Roles in DNA Repair Process Relative Changea

(n)b

(27)

DNA damage sensors MGMT 1.094 (2)

H2AFX DNA damage response transducer

0.769 (2)

Rad9B 9-1-1 complex 0.257 (1) Hus1B 9-1-1 complex 0.572 (1) DNA damage repair

MSH4 DNA mismatch repair 0.569 (2) LIG4 DNA DSB repair 0.446 (2) Drug resistance-related gene

AKR1B10 Genotoxic stress response 0.282 (3) AKR1B15 Genotoxic stress response 0.089 (1) AKR1C1 Genotoxic stress response 0.197 (3) AKR1C3 Genotoxic stress response 0.119 (3) AKR1C4 Genotoxic stress response 0.721 (3) AKR1CL1 Genotoxic stress response 0.576 (1)

aRelative change was calculated by dividing the intensity of gene expression level detected on the oligonucleotide microarray from ATAD3Akd T98G cells with wild-type cells.

bNumber of spots in the oligonucleotide microarray.

You et al.: ATAD3A is a radioresistant marker in GBM

NEURO-ONCOLOGY † OCTOB E R 2 0 1 3 1349

Downloaded from http://neuro-oncology.oxfordjournals.org/ at China Medical University Library on March 24, 2014

results that ATM could be targeted to MAMs by ATAD3A. As shown in our study by immunoblotting

(28)

and confocal immunofluorescent micrographs, increased cytoplasmic ATM was apparently located in ER-like granular structures following irradiation, distinct from the usual dominant nuclear pattern in wild-type T98G cells. Our results also corresponded well with those in

the study by Li et al,38 showing that only nuclear, not cytoplasmic,

ATM is related to the DNA damage response.

In addition, nuclear H2AX was greatly affected after silencing of ATAD3A in the present study, indicating that

ATAD3A involves an undiscovered novel mechanism, thus targeting H2AX as well. In a recent study, Cascone

et al39 reported that both linker histone H1 and core histonesH2A,

H2B,H3,andH4bind strongly to isolated mitochondria and permeabilize the outer mitochondrial

membrane. Knockdown of ATAD3A also has been shown to significantly reduce mitochondrial integrity, mostly as a result of transport of lipids.40 Altogether our

data raised a possibility that ATAD3A silencing may

affectMAMs, thus hinderingATMtrafficking; but its underlying mechanism remains to be delineated.

ATAD3A can also be involved in a non-apoptotic death pathway in T98G cells. To be specific, even though ATAD3Akd cells displayed an inverse LC3-I/II

ratio and increased autophagy-like vacuoles in transmission electron micrographs, activation of PARP before

(29)

look through. In the study by Meador et al,41

H2AX-deficient cells showed elevated PARP-1 activity in response to DNA damage, supporting our observation in T98G/ATAD3Akd cells. Despite the numerous controversies

on the role of autophagy inmammalian cells, it essentially is a self-limited process to maintain bioenergetics

for survival.42 The autophagic cells will eventually die of

necrosis as long as their internal resources are exhausted. ExtensiveDNAdamage by irradiation is attributed to the fact thatPARPactivation could lead to the rapid depletion of nuclear and cytoplasmic NAD.43 As a consequence,

T98G/ATAD3Akd cells dependent on glycolysis for

ATP quickly became ATP depleted following PARP activation and died by necrosis.

In conclusion, our data clearly demonstrated that ATAD3A takes part in both the nuclear translocation of ATM and a non-apoptotic pathway. A recent study42 of

mitochondrial dysfunction echoes our findings that ATM is directly associated with mitochondria and is easily detectable in mitochondrial fractions of human

Fig. 4. Silencing of ATAD3A attenuated DNA repairs before and after irradiation. (A, B) Comparison of the average g-H2AX foci number (red

fluorescence) between wild-type and T98G/ATAD3Akd cells before and after 6-Gy radiation. Prior to 6-Gy radiation treatment, the number

of g-H2AX foci was marginally reduced in T98G/ATAD3Akd cells and was significantly decreased 1 h postirradiation compared with

(30)

wild-type cells, ***P , .001. (C) Gel electrophoresis assay for DSBs. Compared with control and vector-transfected cells, DNA DSBs were

more frequent in ATAD3Akd T98G cells prior to radiation. Four hours postradiation (6 Gy), DSBs remained evident in T98G/ATAD3Akd cells,

whereas those in the control and vector-transfected cells were mostly mended. (D) Immunoblotting of whole cell and nuclear protein

extraction of wild-type and T98G/ATAD3Akd cells. Attenuated g-H2AX was evident in T98G/ATAD3Akd

cells before and after radiation

treatment. Autophosphorylation of ATM on Ser1981 in response to irradiation was diminished in T98G/ATAD3Akd cells, as well as ATM and

NBS1 compared with those in the wild-type T98G cells, indicating that DNA repairs might be affected. Chk2, checkpoint kinase 2.

You et al.: ATAD3A is a radioresistant marker in GBM

1350 NEURO-ONCOLOGY † OCTOB E R 2 0 1 3

Downloaded from http://neuro-oncology.oxfordjournals.org/ at China Medical University Library on March 24, 2014

fibroblast. Although the size of the patient population was small in our study, our results provide a novel link of ATAD3A to the phenotype of radioresistance in GBM.

Supplementary Material

Supplementary material is available online at

Neuro-Oncology (http://neuro-oncology.oxfordjournals. org/).

Conflict of interest statement. None declared.

Funding

This work was supported by grants from Taichung Veterans General Hospital Clinical Research

(31)

(101DHA0500377); the Department of Health, Executive Yuan, Taipei, Taiwan, to the China Medical University Hospital, Cancer Research of Excellence program (DOH101-TD-C-111–005); and the National Science Council (NSC 101-2320-B-005-002).

References

1. Stupp R, Hegi ME, MasonWP, et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in

glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol. 2009;10:459–466.

2. Andreana LR, Christopher EP,Mark R, et al.MGMTpromotermethylation is predictive of response to radiotherapy and prognostic in the absence of adjuvant alkylating chemotherapy for glioblastoma. Neuro Oncol. 2010;12:116–121.

3. Nobusawa S,Watanabe T, Kleihues P, Ohgaki H. IDH1 mutations as molecular signature and predictive factor of secondary glioblastomas. Clin

Cancer Res. 2009;15:6002–6007.

4. Labussie` re M, Idbaih A, Wang XW, et al. All the 1p19q codeleted gliomas are mutated on IDH1 or IDH2. Neurology. 2010;74(23): 1886–1890.

5. Kaneshiro D, Kobayashi T, Chao ST, Suh J, Prayson RA. Chromosome 1p and 19q deletions in glioblastoma multiforme. Appl Immunohistochem Mol Morphol. 2009;17(6):512–516.

6. Squatrito M, BrennanCW, Helmy K, Huse JT, Petrini JH, Holland EC. Loss of ATM/Chk2/p53 pathway components accelerates tumor development and contributes to radiation resistance in gliomas. Cancer Cell.

(32)

2010;18(6):619–629.

Fig. 5. Type of cell death after irradiation in T98G/ATAD3Akd cells. (A)ATAD3Akd increased autophagy-like vacuoles (black arrows), as shownin

transmission electronmicrographs. (B) Decreased nuclearATMand a noticeableamountof cytoplasmicATMwere observed inT98G/ATAD3Akd

cells after irradiation by confocal immunofluorescent micrographs. (C) Immunoblotting confirmed attenuated ATM in T98G/ATAD3Akd cells

after irradiation. (D) Irradiation did not increase apoptotic cell death as assessed by sub-G1 population in T98G/ATAD3Akd cells. (E) No

difference of cleaved PARP but markedly activated PARP-1 before and after irradiation was noted in T98G/ATAD3Akd cells. Instead,

conversion of LC3-I to LC3-II was evident after irradiation. LC3-II/LC3-I ratio was normalized with corresponding b-actin level.

You et al.: ATAD3A is a radioresistant marker in GBM

NEURO-ONCOLOGY † OCTOB E R 2 0 1 3 1351

Downloaded from http://neuro-oncology.oxfordjournals.org/ at China Medical University Library on March 24, 2014

7. Roy K,Wang L, MakrigiorgosGM,Price BD. Methylation of theATMpromoter in glioma cells alters ionizing radiation sensitivity. BiochemBiophys Res Commun. 2006;344(3):821–826.

8. Tribius S, Pidel A, Casper D. ATMprotein expression correlates with radioresistance in primary glioblastoma cells in culture. Int J Radiat Oncol Biol

Phys. 2001;50(2):511–523.

9. Choi S,GamperAM,White JS, Bakkenist CJ. Inhibition ofATMkinase activity does not phenocopy ATMprotein disruption: implications for the clinical utility of ATM kinase inhibitors. Cell Cycle. 2010;9(20):4052–4057.

(33)

in ataxia-telangiectasia. Blood. 2012;119(6):1490–1500.

11. Vander Heiden MG, Cantley LC, Thompson CB. Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science. 2009;324:1029–1033.

12. Modica-Napolitano JS, Kulawiec M, Singh KK. Mitochondria and human cancer. Curr Mol Med. 2007;7:121–131.

13. Dmitrenko V, Shostak K, Boyko O, et al. Reduction of the transcription level of the mitochondrial genome in human glioblastoma. Cancer Lett. 2005;218:99–107.

14. Kirches E, Krause G,Warich-KirchesM,et al. High frequency ofmitochondrial DNA mutations in glioblastoma multiforme identified by direct sequence. Int J Cancer. 2001;93(4):534–538.

15. de Moura MB, dos Santos LS, Van HB. Mitochondrial dysfunction in neurodegenerative diseases. Environ Mol Mutagen. 2010;51(5):391–405.

16. Griguer CE, Oliva CR. Bioenergetics pathways and therapeutic resistance in gliomas: emerging role of mitochondria. Curr Pharm Des.

2011;17(23):2421–2427.

17. Gilquin B, Cannon BR, Hubstenberger A, et al. The calcium-dependent interaction between S100B and the mitochondrial AAA ATPase ATAD3A

and the role of this complex in the cytoplasmic processing of ATAD3A. Mol Cell Biol. 2010;30:2724–2736.

18. Chiang SF, Huang CY, Lin TY, Chiou SH, Chow KC. An alternative import pathway of AIF to the mitochondria. Int J Mol Med. 2012;29:365–372. 19. FangHY, Chang CL, Hsu SH, et al. ATPase family AAAdomain-containing 3A is a novel anti-apoptotic factor in lung adenocarcinoma cells. J Cell Sci. 2010;123:1171–1180.

(34)

20. Geuijen CA, Bijl N, Smit RC, et al. A proteomic approach to tumour target identification using phage display, affinity purification and mass. Eur J Cancer 2005;41:178–187.

21. Gires O, Munz M, Schaffrik M, et al. Profile identification of

disease-associated humoral antigens using AMIDA, a novel proteomicsbased technology. Cell Mol Life Sci. 2004;61:1198–1207.

22. ChenTC,HungYC,LinTY, et al.Humanpapillomavirus infectionandexpression of ATPase family AAA domain containing 3A, a novel anti-autophagy

factor, in uterine cervical cancer. Int JMolMed. 2011;28:689–696. 23. Huang KH, Chow KC, Chang HW, Lin TY, Lee MC. ATPase family AAA domain containing 3A is an anti-apoptotic factor and a secretion regulator of PSA in prostate cancer. Int J Mol Med. 2011;28:9–15.

24. Hubstenberger A, Labourdette G, Baudier J, Rousseau D. ATAD 3A and ATAD 3B are distal 1p-located genes differentially expressed in human glioma cell lines and present in vitro anti-oncogenic and chemoresistant properties. Exp Cell Res. 2008;314:2870–2883.

25. Smith JS, Alderete B, Minn Y, et al. Localization of common deletion regions on 1p and 19q in human glioma and their association with histological subtype. Oncogene. 1999;18(28):4144–4152.

26. Stupp R, Hegi ME, van den Bent MJ, et al. Changing paradigms—an update on the multidisciplinary management of malignant glioma. Oncologist. 2006;11(2):165–180.

27. RemmeleW, Schicketanz KH. Immunohistochemical determination of estrogen and progesterone receptor content in human breast cancer.

Computer-assisted image analysis (QIC score) vs. subjective grading (IRS). Pathol Res Pract. 1993;189:862–866.

(35)

28. Challberg MD, Kelly TJ, Jr. AdenovirusDNA replication in vitro: origin and direction of daughter strand synthesis. J Mol Biol. 1979;135(4):

999–1012.

29. Ambrose M, Goldstine JV, Gatti RA. Intrinsic mitochondrial dysfunction in ATM-deficient lymphoblastoid cells. Hum Mol Genet. 2007;16(18):

2154–2164.

30. Tentori L, Portarena I, Torino F, Scerrati M, Navarra P, Graziani G. Poly(ADP-ribose) polymerase inhibitor increases growth inhibition and reduces G(2)/Mcell accumulation induced bytemozolomide in malignant glioma cells. Glia. 2002;40:44–54.

31. Oliva CR, Nozell SE, Diers A, et al. Acquisition of temozolomide chemoresistance in gliomas leads to remodeling ofmitochondrial electron transport

chain. J Biol Chem. 2010;285:39759–39767.

32. Le Calve´ B, Rynkowski M, Le Mercier M, et al. Long-term in vitro treatment of human glioblastoma cells with temozolomide increases resistance in vivo through up-regulation of GLUT transporter and aldoketo reductase enzyme AKR1C expression. Neoplasia. 2010;12:

727–739.

33. Chen J, Emara N, Solomides C, Parekh H, Simpkins H. Resistance to platinum-based chemotherapy in lung cancer cell lines. Cancer Chemother Pharmacol. 2010;66(6):1103–1111.

34. Deng HB, Parekh HK,ChowKC, Simpkins H. Increased expression of dihydrodiol dehydrogenase induces resistance to cisplatin in human ovarian

carcinoma cells. J Biol Chem. 2002;277:15035–15043.

35. Hung JJ, Chow KC,WangHW,Wang LS. Expression of dihydrodiol dehydrogenase and resistance to chemotherapyand radiotherapy in adenocarcinoma

(36)

cells of lung. Anticancer Res. 2006;26:2949–2955. 36. Eaton JS, Lin ZP, Sartorelli AC, Bonawitz ND, Shadel GS.

Ataxia-telangiectasia mutated kinase regulates ribonucleotide reductase and mitochondrial homeostasis. J Clin Invest. 2007;117(9):2723–2734. 37. Watters D,KedarP, Spring K, et al. Localization of a portion of extranuclear ATM to peroxisomes. J Biol Chem. 1999;274(48):34277–34282.

38. Li J, Han YR, Plummer MR, Herrup K. Cytoplasmic ATM in neurons modulates synaptic function. Curr Biol. 2009;19(24):2091–2096.

39. Cascone A, Bruelle C, Lindholm D, Bernardi P, Eriksson O. Destabilization of the outer and inner mitochondrial membranes by core and linker histones. PLoS One. 2012;7(4):e35357.

40. Rone MB, Midzak AS, Issop L, et al. Identification of a dynamic mitochondrial protein complex driving cholesterol import, trafficking, and metabolism to steroid hormones. Mol Endocrinol. 2012;26(11):1868–1882. 41. Meador JA, Zhao M, Su Y, Narayan G, Geard CR, Balajee AS. Histone H2AX is a critical factor for cellular protection against DNA alkylating agents. Oncogene. 2008;27(43):5662–5671.

42. Rabinowitz JD, White E. Autophagy and metabolism. Science. 2010;330:1344–1348.

43. Ha HC, Snyder SH. Poly(ADP-ribose) polymerase is a mediator of necrotic cell death by ATP depletion. Proc Natl Acad Sci U S A.

1999;96(24):13978–13982.

You et al.: ATAD3A is a radioresistant marker in GBM

1352 NEURO-ONCOLOGY † OCTOB E R 2 0 1 3

參考文獻

相關文件

the prediction of protein secondary structure, multi-class protein fold recognition, and the prediction of human signal peptide cleavage sites.. By using similar data, we

In this paper, the author found out the fact that as traditionally Buddhist clerics were exempted from tax paying and national service fulfiling in

Corollary 13.3. For, if C is simple and lies in D, the function f is analytic at each point interior to and on C; so we apply the Cauchy-Goursat theorem directly. On the other hand,

Corollary 13.3. For, if C is simple and lies in D, the function f is analytic at each point interior to and on C; so we apply the Cauchy-Goursat theorem directly. On the other hand,

The predicted expression profiles of 24 chemokines and immunosuppressive biomarkers for SCC4, SCC15, and SCC25 were used in a decision tree format to sort cell lines into those

In the control specimen, IGF2 protein was more highly expressed in the longitudinal sections com- pared with the transverse sections, and the staining pattern or intensity did not

The current study found that high-grade MECs had the highest incidence of strong MUC1 expression in mucous cells, with intermedi- ate- and low-grade tumours showing the

The e xfoliated oral buccal cells and blood samples were collected for the assay of micronucleus frequency (MNF) and comet assay.. We find that there are higher MNF