High-level expression and characterization of two chitinases, ChiCH and ChiCW, of Bacillus cereus 28-9 in Escherichia coli

High-level expression and characterization of two chitinases,

ChiCH and ChiCW, of Bacillus cereus 28-9 in Escherichia coli

Chien-Jui Huang

_{, Chao-Ying Chen}

Department of Plant Pathology and Microbiology, National Taiwan University, Taipei 106, Taiwan Received 18 November 2004

Available online 8 December 2004

Abstract

Many chitinase genes have been cloned and sequenced from prokaryotes and eukaryotes but overexpression of chitinases in

Esch-erichia coli cells was less reported. ChiCH and ChiCW of Bacillus cereus 28-9 belong to two distinct groups based on their amino

acid sequences of catalytic domains, and in addition, domain structures of two enzymes are different. In this study, we established an

ideal method for high-level expression of chitinases in E. coli as glutathione-S-transferase fusion proteins using pGEX-6P-1 vector.

Both ChiCH and ChiCW were successfully highly expressed in E. coli cells as soluble GST-chitinase fusion proteins, and

recombi-nant native ChiCH and ChiCW could be purified after cleavage with PreScission protease to remove GST tag. Purified chitinases

were used for biochemical characterization of kinetics, hydrolysis products, and binding activities. The results indicate that ChiCW

is an endo-chitinase and effectively hydrolyzes chitin and chito-multimers to chito-oligomers and the end product chitobiose, and

ChiCH is an exo-chitinase and degrades chito-oligomers to produce chitobiose. Furthermore, due to higher affinity of ChiCW

toward colloidal chitin than Avicel, C-terminal domain of ChiCW should be classified as a chitin-binding domain not a

cellu-lose-binding domain although that was revealed as a cellucellu-lose-binding domain by conserved domain analysis. Therefore, the method

of high-level expression of chitinases is helpful to studies and applications of chitinases.

2004 Elsevier Inc. All rights reserved.

Keywords: Chitinase; Glutathione-S-transferase; Protein expression; Fusion protein technology; Escherichia coli

Chitin, an insoluble b-1,4-linked polymer of

N-acetyl-glucosamine, is the second most abundant

polysaccha-ride in nature and a major constituent of the cell walls

of many fungi, insect exoskeletons, and crustacean shells

[1,2]

. Degradation of chitin is essentially catalyzed by

chitinases

[3]

. Chitinases (E.C. 3.2.1.14) are found in

bacteria, fungi, virus, and higher plants

[4,5]

. Plant

chitinases involve in defense mechanism against

infec-tion by phytopathogenic fungi

[5]

. Fungal chitinases

are required for hyphal growth

[6]

. Furthermore,

bacte-rial chitinases are considered primarily to digest and

uti-lize chitin as a carbon and nitrogen nutrient

[3]

.

Bacillus cereus 28-9 isolated from the lily rhizosphere

can produce two chitinases, ChiCH and ChiCW. The

genes encoding two enzymes were cloned and

se-quenced, and basic biochemical properties were

charac-terized

[7,8]

. The genes homologous to chiCH and

chiCW have been found and identified in several B.

cer-eus and Bacillus thuringiensis strains

[9–14]

. In the study

of Mabuchi and Araki

[12]

, ChiA (homologous to

ChiCH) and ChiB (homologous to ChiCW) were

classi-fied into two groups based on distinct characters in their

amino acid sequences of catalytic domains that were

proposed by Watanabe et al.

[15]

. Due to distinct amino

acid sequences of catalytic domains and domain

compo-sitions of ChiCH and ChiCW, we were interested in

bio-chemical characterization of both chitinases in detail to

realize their functions. To biochemically characterize

0006-291X/$ - see front matter
2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.11.140

* _{Corresponding authors. Fax: +886 2 23656490.}

E-mail addresses: f89633001@ntu.edu.tw (C.-J. Huang),

cychen@ntu.edu.tw(C.-Y. Chen).

www.elsevier.com/locate/ybbrc Biochemical and Biophysical Research Communications 327 (2005) 8–17

both chitinases, it was necessary to purify (or partially

purify) the enzymes from B. cereus 28-9 or the

recombi-nant enzymes from Escherichia coli. However,

proteo-lytic modifications of chitinases in B. cereus and other

species and E. coli have been reported and C-termini

of chitinases have been usually cleaved

[8,12,13,16,17]

.

Therefore, the method for high-level expression and easy

purification of chitinases needs to be established to

avoid proteolytic modification when protein expression

in Bacillus species and E. coli, and in the purification

steps.

Many prokaryotic expression systems have been

developed for overexpression of proteins in E. coli.

For rapid and convenient purification of expressed

pro-tein, many expression vectors have been constructed to

fuse different affinity tags to target proteins. Up to date,

several affinity tags have been used for fusion protein

technologies such as polyhistidine tags, FLAG tags,

thi-oredoxin tags, Protein A, Strep-tag, maltose-binding

protein, chitin-binding tag, and

glutathione-S-transfer-ase (GST)

[18–20]

. However, in the studies of chitinases,

there were few reports of high-level or overexpression of

chitinases in E. coli cells using expression vectors with

affinity tags

[9,14,21–24]

, and it reveals that high-level

expression of chitinases in E. coli is difficult. Therefore,

establishing an ideal method for high-level expression of

recombinant chitinases fused to affinity tags is helpful to

studies of chitinase and recombinant chitinases can be

easily purified by affinity chromatography.

In this study, we established a better method to

highly express two chitinases of B. cereus 28-9 in E. coli

by GST-fusion protein expression system. Purified

re-combinant enzymes were used for biochemical

charac-terization including enzyme kinetics, substrate-binding

properties and hydrolysis products. In addition, we also

developed an ideal method for chitinolytic zymography

to enhance resolution and molecular size calibration.

Materials and methods

Bacterial strains, plasmid, and media. Escherichia coli XL1-Blue (Stratagene, La Jolla, CA, USA) was used as a host for gene cloning. E. coli XL1-Blue and pGEX-6P-1 (Amersham Biosciences, Uppsala, Sweden) were used to express recombinant protein. All bacterial strains were maintained on Luria–Bertani (LB) agar plate (1%

tryp-tone, 0.5% yeast extract, 0.5% NaCl, and 1.5% agar) supplemented with appropriate antibiotics. E. coli cells carrying recombinant plasmid were cultured in 2· YTG broth (1.6% tryptone, 1% yeast extract, 0.5% NaCl, and 2% glucose) with antibiotics to highly express recombinant protein.

Construction of expression vectors. Two chitinase genes of B. cereus 28-9, chiCH (GenBank Accession No.AF510723) and chiCW (Gen-Bank Accession No.AF416570), were amplified from B. cereus gen-ome by polymerase chain reaction using two primer pairs (Table 1). The amplified fragments were digested with EcoRI and XhoI, and subcloned into EcoRI and XhoI sites of pGEX-6P-1 to create re-combinant expression vectors, pGH60 and pGW59. The constructs were transformed into E. coli XL1-Blue and transformants were se-lected on LB plate containing 50 lg ml
1_{ampicillin and 12.5 lg ml}
1

tetracycline. Constructed plasmids were identified further by restric-tion enzyme mapping and DNA sequencing.

Bacterial expression of recombinant chitinases. The recombinant expression vectors were transformed into E. coli XL1-Blue for expressing the fusion target protein. Comprehensive expression tests were performed to investigate the optimal conditions of high expres-sion levels of soluble proteins. The optimal conditions were determined and applied to large-scale protein expression. Overnight cultures of E. coli XL1-Blue(pGH60) and E. coli XL1-Blue(pGW59) cells were di-luted (1:100) in fresh 2YTG broth supplemented with ampicillin and incubated at 37C with shaking until A600of the bacterial culture was

0.4–0.6. To induce expression of the recombinant protein, bacterial culture was added isopropyl-b-DEEDEE-thiogalactopyranoside (IPTG) to the final concentration of 0.5 mM and grown for further 5 h at 37C with shaking. E. coli cells were harvested by centrifugation at 8000g for 10 min at 4C and washed once with ice-cold phosphate-buffered saline (PBS, 137 mM NaCl, 10 mM Na2HPO4, 2 mM KH2PO4, and

2.7 mM KCl, pH 7.3). After centrifugation at 8000g for 10 min at 4C to remove PBS, cells could be used for protein preparation immedi-ately, or frozen and stored at
20 C.

Purification of recombinant chitinases. Two hundred milliliters cultures of E. coli XL1-Blue(pGH60) and E. coli XL1-Blue(pGW59) were induced to highly express GST-chitinase fusion proteins as de-scribed above. The E. coli cell pellet was resuspended in 20
1culture volume of ice-cold lysis buffer (PBS) supplemented with 0.1 mg ml
1 lysozyme. The cells were lysed by repeated (three times at least) freezing in liquid Nitrogen and thawing in a 37C water bath and incubated at 4C for further 30 min. Then, the cell debris was removed by centrifugation (12,000g for 30 min) at 4C and the supernatant was collected and filtered through a 0.45 lm filter (Millipore). For affinity chromatography, an AKTA FPLC (Amersham Biosciences) apparatus was used and all chromatographic steps were performed at 4C. The supernatant after filtration was loaded on a PBS-equilibrated GSTrap FF column (1 ml; Amersham Biosciences) at a flow rate of 1 ml min
1. The bound materials were washed with five column volumes of PBS. GST-chitinase fusion proteins were eluted with five column volumes of elution buffer (15 mM reduced glutathione in 50 mM Tris–HCl, pH 8.0).

PreScission protease cleavage of chitinases. The eluted GST-chitinase solution was dialyzed with PreScission cleavage buffer

Table 1

Primers used in this study

Gene Primer

Orientation Sequencea

ChiCH Forward CCCGGAATTCGCAAACAATTTAGGTTCAAAATTACTC

Reverse CCCGCTCGAGGACCATCAAAATATGTTCTATAG

ChiCW Forward CCCGGAATTCCCAAAGCAAAGTCAAAAAATTGTTGG

Reverse CCCGCTCGAGGTTTTCGCTAATGACGGTATTTAAAAG

a

(50 mM Tris–HCl, 150 mM NaCl, 1 mM EDTA, and 1 mM dithio-threitol, pH 7.5). The dialyzed protein solution was added PreScission protease (2 U for each 100 lg of fusion protein; Amersham Biosci-ences) and incubated at 4C for 12–16 h to cleave GST tag. After digestion, the protein solution was loaded on a GSTrap FF column, pre-equilibrated with cleavage buffer, to purify recombinant chitinase in start-up flow and to remove GST tag and PreScission protease by affinity chromatography on GSTrap FF column.

SDS–PAGE and chitinolytic zymography assay. SDS–PAGE was performed using a Tris–Tricine system as described previously[25]

with modification for in-gel zymography assay of chitinase activity. The gel concentration was 7.5% and the ratio of crosslinkage (bis-acrylamide to (bis-acrylamide) was 6%. For chitinolytic zymography assay, Tricine–SDS–polyacrylamide separating gel contained 0.01% glycol chitin. Protein sample was mixed with an equal volume of 2-fold concentrated, non-reducing sample buffer and boiled for 5 min before loading into the gel. Electrophoresis was performed using Hoefer SE250 mini-slab gel system (Amersham Bioscience). After electro-phoresis, the separating gel was incubated at 37C in 0.1 M sodium acetate buffer (pH 5.0) containing 1% Triton X-100 for 4 h on an orbital shaker (50 rpm). Then, the gel was stained with 0.01% Calco-flour White M2R (Sigma) in 50 mM Tris–HCl buffer (pH 8.9) for 5 min and destained with distilled water[26]. Chitinolytic zones in the Calcofluor-stained gel were visualized under a UV transilluminator. Separated proteins in the gel were stained with Coomassie blue G-250. Chitinase activity measurements and protein concentration determi-nation. A fluorometric assay was used to determine chitinase activity using 4-methylumbelliferyl-N,N0_{-chitobiose (4-MU-(GlcNAc)}

2, Sigma,

St. Louis, MO, USA) and 4-methylumbelliferyl-N,N0_,N00_-chitotriose

(4-MU-(GlcNAc)3, Sigma) as substrates for ChiCH and ChiCW,

respectively. The amount of 4-methylumbelliferone (4-MU) released was measured spectrofluorometrically by using a fluorescence spec-trophotometer (F-4500, Hitachi) with excitation at 390 nm and emis-sion at 450 nm. One unit (U) of chitinase activity was defined as the amount of enzyme required releasing 1 lmol of 4-MU per min at 37C. Protein concentration was determined by BradfordÕs method

[27]using bovine serum albumin as standard.

Kinetic property characterization. The Michaelis–Menten constant (Km) and maximal velocity (Vmax) were determined by Lineweaver–

Burk double reciprocal plot, and turnover number (kcat) and catalytic

efficiency value (kcat/Km) were further calculated.

Thin-layer chromatography. Chitooligosaccharides (from monomer to pentamer, 175 lg each; for hexamer, 70 lg) in 50 ll of 50 mM so-dium acetate buffer (pH 5.0) were hydrolyzed by ChiCH and ChiCW (4 lg each) at 37C for 2 h. After boiling the mixtures for 15 min, the hydrolysis products were analyzed by thin-layer chromatography (TLC). TLC was performed on a silica gel plate (Kieselgel 60, Merck) developed with n-butanol–methanol–28% ammonia–water (5:4:2:1). To visualize resolved chitooligosaccharides, the plate was sprayed with a diphenylamine–aniline–phosphate reagent (0.4 g diphenylamine, 0.4 ml aniline, 3 ml of 85% phosphoric acid, and 20 ml acetone) and heated at 180C for 3 min[28].

Substrate-binding assay. Insoluble polysaccharides, Avicel (Fluka) and colloidal chitin, were used in binding assays. The binding assay mixture (total volume as 250 ll) contained 2.5 lg of purified enzyme and 1 mg of insoluble polysaccharide in 20 mM sodium acetate buffer (pH 5.0). After incubation on ice for 1 h with occasional stirring, the mixture was centrifuged at 12,000g for 10 min at 4C to separate polysaccharide and bound enzyme, and the protein concentration in the supernatant was determined. The amount of absorbed enzyme was calculated from the difference between the amount of enzyme initially added and recovered in the supernatant.

Affinity electrophoresis. Affinity electrophoresis using native poly-acrylamide gels containing polysaccharide ligands was performed with the buffer system of Laemmli[29]excluding SDS in all buffers. The concentration of separating gel was 8% and three kinds of soluble polysaccharides, glycol chitin, carboxymethyl-cellulose (CM-cellulose),

and laminarin, were incorporated into the gels at a concentration of 0.1% prior to polymerization. The control gel without polysaccharide was prepared and run simultaneously. Protein samples were mixed with 2-fold loading buffer without SDS and loaded into gels. Elec-trophoresis was run at 4C and 80 V for 2 h, and proteins were visualized by staining with Coomassie blue G-250.

Results

Vector construction and expression of GST-chitinase

fusion proteins in E. coli

Fig. 1

shows that two expression vectors, pGH60 and

pGW59, were constructed for expression of

GST-ChiCH and GST-ChiCW fusion proteins, respectively,

in E. coli. Two constructs were introduced into E. coli

XL1-Blue as cloning and expression hosts, and then,

the optimal conditions, for overexpression of fusion

pro-teins were investigated.

As shown in

Fig. 2

, the expression of GST-ChiCH

fu-sion proteins in E. coli cells was induced to 7 h by

add-ing 0.5 mM IPTG at 37

C. The expression was

observed at 3 h after induction and its maximal

expres-sion was achieved at 5 h after induction and maintained

to 7 h. Furthermore, we also tested the effect of final

concentrations of IPTG to induce fusion protein

expres-sion in E. coli. No significant difference was observed

be-tween adding 0.5 and 1 mM IPTG to induce fusion

protein expression, but however, the induction level of

0.1 mM IPTG was apparent lower than that of

0.5 mM IPTG. In this condition (induction by 0.5 mM

IPTG for 5 h), most GST-ChiCH was found in the

supernatant after cell lysis and the supernatant could

be used for purification immediately (data not shown).

On the other hand, the condition to induce GST-ChiCW

expression in E. coli was the same as that to induce

GST-ChiCH expression (data not shown).

Purification of recombinant chitinases

Table 2

shows that two GST-chitinase fusion proteins

were successfully purified from cell lysate by

GST-affin-ity chromatography. From a 200 ml culture, 0.91 mg of

GST-ChiCH fusion protein was purified. However, the

amount of GST-ChiCW purified from E. coli was half

less than that of GST-ChiCH and 0.45 mg of protein

was purified. As shown in

Fig. 3

, the molecular sizes

of GST-ChiCH (63 kDa) and GST-ChiCW (98 kDa)

were estimated by SDS–PAGE and chitinolytic

zymog-raphy in Tris–Tricine buffer system and closely

corre-sponded to the values calculated from the amino acid

sequences of ChiCH (63.205 kDa) and

GST-ChiCW (98.049 kDa).

Furthermore, on-column cleavage of GST fusion

proteins performed in a GSTrap FF column (1 ml)

was not sufficient to cleave most of fusion proteins in

our preliminary test. Thus, GST-chitinase fusion

pro-teins were eluted, dialyzed in PreScission cleavage buffer,

and cleaved by PreScission protease. Two recombinant

chitinases without GST tag were purified by a second

GST-affinity chromatography and collected in start-up

flow. By SDS–PAGE analysis and chitinolytic

zymogra-phy, purified ChiCH of 37 kDa and ChiCW of 71 kDa

were identified (

Fig. 3

).

Fig. 2. Expression of GST-ChiCH fusion protein in E. coli cells. E. coli XL1-Blue harboring pGH60 was induced with 0.5 mM IPTG, and lysates were prepared after induction for 0 (lane 0), 1 (lane 1), 2 (lane 2), 3 (lane 3), 4 (lane 4), 5 (lane 5), 6 (lane 6), and 7 (lane 7) hours. Lysates were analyzed by 7.5% Tris–Tricine–SDS–PAGE and Coomassie blue G-250 staining (A) and chitinolytic zymography (B). The arrow indicates GST-ChiCH fusion protein with an estimated molecular size of 63 kDa.

Table 2

Purification of GST-chitinase fusion proteins

Protein Purification step Total protein (mg) Specific activity (U/mg) Recovery rate (%) Purification fold

GST-ChiCH Crude extract 24.50 1.49 100 1

Glutathione–Sepharose chromatography 0.91 7.48 18.7 5

GST-ChiCW Crude extract 27.40 0.73 100 1

Glutathione–Sepharose chromatography 0.45 3.69 8.2 5

Fig. 1. Schematic diagrams of constructed plasmids, pGW59 (A) and pGH60 (B), for overexpression of ChiCW and ChiCH. Each chitinase was expressed as a soluble fusion protein with Schistosoma japonicum GST at its N-terminus.

Kinetics of chitinases

As shown in

Table 3

, kinetic properties of chitinases

and GST-chitinase fusion proteins are determined and

kinetic constants are estimated. ChiCH exhibited lower

K

toward three kinds of substrates than those of

ChiCW. In contrast, k

and k

/K

of ChiCW toward

each substrate were much higher than those of ChiCH.

On the other hand, four kinetic constants of

GST-ChiCH were higher than GST-ChiCH. However, only K

and V

of GST-ChiCW were higher than ChiCW.

Although k

values of GST-fused and native ChiCW

were closed, k

/K

of GST-ChiCW was 34% of that

of ChiCW.

Hydrolysis products of chitinases

Hydrolysis products of chitooligosaccharides (from

monomer to hexamer) catalyzed by ChiCH and ChiCW,

respectively, were analyzed by TLC and presented in

Fig. 4

. N-acetylglucosamine and chitobiose were not

de-graded by both enzymes. From chitotriose to

chitohexa-ose, four substrates were hydrolyzed by ChiCH to

chitobiose as the end product although lower reaction

velocity was with chitotriose. Furthermore, when

chito-pentaose and chitohexaose were hydrolyzed by ChiCH,

intermediate chitotriose and chitotetraose were detected

except for chitobiose, respectively, due to reaction not

complete in 2 h.

On the other hand, ChiCW hydrolyzed (GlcNAc)

to chitobiose as the end product and the reaction

veloc-ity of ChiCW was lower with chitotriose. The pattern of

hydrolysis products of ChiCW with chitotetraose and

chitopentaose was similar to that of ChiCH in addition

to that chitohexaose was produced when ChiCW

hydro-lyzed chitotetraose. Furthermore, ChiCW hydrohydro-lyzed

chitohexaose completely to chitobiose and had higher

reaction velocity. In addition, chitobiose only produced

Fig. 3. Purification of GST-ChiCH and recombinant ChiCH after cleavage by PreScission protease. Sample from each step was analyzed by 7.5% Tris–Tricine–SDS–PAGE and Coomassie blue G-250 staining (A) and chitinolytic zymography (B). Lane 1, supernatant of the bacterial cell lysate; lane 2, GSTrap FF column purified GST-ChiCH; lane 3, products of GST-ChiCH cleaved by PreScission protease; lane 4, purified recombinant ChiCH; lane 5, GST following PreScission protease cleavage; and lane M, low molecular weight protein marker (Amersham Biosciences).

Table 3

Kinetics of chitinases and GST-chitinase fusion proteins

Protein Substrate Kma Vmaxb kcatc kcat/Kmd

ChiCH 4-MU-(GlcNAc)2 22.7 1.37 8.3· 10
4 3.7· 10
5 Glycol chitin 1.5 0.32 2.0· 10
4 _{1.3· 10}
4 Colloidal chitin 17.0 1.07· 10
2 4.0· 10
4 2.3· 10
5 ChiCW 4-MU-(GlcNAc)3 25.3 0.52 0.6 2.5· 10
2 Glycol chitin 4.1 2.99 3.6 9.0· 10
1 Colloidal chitin 43.6 1.6· 10
2 1.1 2.6· 10
2 GST-ChiCH 4-MU-(GlcNAc)2 158.6 44.05 4.6· 10
2 2.9· 10
4 GST-ChiCW 4-MU-(GlcNAc)3 81.6 40.80 0.7 8.2· 10
3 a _{Unit of K}

m: lM toward 4-MU-(GlcNAc)2and 4-MU-(GlcNAc)3; mg ml
1toward glycol chitin and colloidal chitin. b _{Unit of V}

max: lmol min
1mg
1toward 4-MU-(GlcNAc)2, 4-MU-(GlcNAc)3, and glycol chitin; lmol h
1mg
1toward colloidal chitin. c _{Unit of k}

cat: s
1toward 4-MU-(GlcNAc)2, 4-MU-(GlcNAc)3, and glycol chitin; h
1toward colloidal chitin. d _{Unit of k}

cat/Km: s
1lM
1toward 4-MU-(GlcNAc)2and 4-MU-(GlcNAc)3; s
1mg/ml
1toward glycol chitin; h
1mg/ml
1toward colloidal

by ChiCW could be detected by TLC when colloidal

chi-tin was hydrolyzed, respectively, by ChiCH and ChiCW

for 2 h (data not shown).

Binding activity of chitinases to polysaccharides

Fig. 5

shows that a C-terminal carbohydrate-binding

module existed in ChiCW but not in ChiCH, and two

do-mains are classified as a fibronectin type three domain and

a cellulose-binding domain according to the conserved

domain analysis

[8]

. In this study, binding activities of

re-combinant ChiCW and ChiCH were investigated.

ChiCW showed an affinity toward chitinous and

cellu-losic substrate, and 72.7% and 53.7% of ChiCW absorbed

onto colloidal chitin and cellulose, respectively. The data

indicate that the C-terminal domain of ChiCW is

pro-posed to belong to a chitin-binding domain. In addition,

ChiCH exhibited much lower binding activity (less than

30%) onto colloidal chitin and Avicel due to being

carbo-hydrate-binding domain deficient.

In the second approach, binding activities of two

chitinases to soluble polysaccharides were investigated

by native PAGE with and without polysaccharides

(

Fig. 6

). Comparison of electrophoretic behaviors of

two proteins revealed that ChiCH was not affected by

the presence of any polysaccharide ligand. In contrast,

the mobility of ChiCW in the presence of glycol chitin

was decreased in comparison of that in the presence of

CM-cellulose, laminarin, or without ligands. The results

indicate that ChiCH did not bind to any soluble

poly-saccharide ligands tested whereas ChiCW bound to

gly-col chitin, the substrate of its catalytic domain, instead

of CM-cellulose and laminarin

Fig. 7

.

Discussion

In the previous studies, high-level expression of

chitinases in E. coli cells was hardly achieved using

com-mercial expression vectors, especially expression of

fam-ily 18 chitinases. Two famfam-ily 19 chitinases were

overexpressed in E. coli. Chi35 of Streptomyces

thermo-violaceus OPC-520 was expressed as a GST-fusion

pro-tein from pGEX-6P-3 vector

[21]

and a 32-kDa

chitinase of Leucaena leucocephala was expressed as a

thioredoxin fusion protein from pET32a vector

[22]

.

After cleavage of affinity tag, recombinant native

chitin-ases could be purified. However, only ChiB of

Clostrid-ium paraputrificum M21 was a family 18 chitinase

expressed as a hexahistidine fusion protein from

pQE30 vector and purified

[23]

. Although Chi36 of B.

cereus 6E1

[14]

and Chi36 of B. thuringiensis HD-1

[9]

,

for example, could be expressed in E. coli using pET5a

and pQE32 vectors, respectively, expressed recombinant

chitinases could not be easily purified. pET5a (Novagen)

is not constructed with any affinity tag to fuse to target

protein, and expressed recombinant Chi36 of B. cereus

Fig. 4. Purification of GST-ChiCW and recombinant ChiCW after cleavage by PreScission protease. Sample from each step was analyzed by 7.5% Tris–Tricine–SDS–PAGE and Coomassie blue G-250 staining (A) and chitinolytic zymography (B). Lane 1, supernatant of the bacterial cell lysate; lane 2, GSTrap FF column purified GST-ChiCW; lane 3, products of GST-ChiCW cleaved by PreScission protease; lane 4, purified recombinant ChiCW; lane 5, GST following PreScission protease cleavage; and lane M, low molecular weight protein marker (Amersham Biosciences).

6E1 could not be purified by affinity chromatography.

On the other hand, when pQE32 vector was used to

ex-press entire Chi36 of B. thuringiensis HD-1 including

signal peptide, the N-terminal hexahistidine tag might

be removed with signal peptide of Chi36 by signal

pep-tidase of E. coli. Thus, mature Chi36 still could not be

directly purified by immobilized metal affinity

chroma-tography. Therefore, we tried to establish an ideal

meth-od for stable high-level expression of family 18

chitinases in this study and that is helpful to basic

stud-ies and applications.

To overexpress chitinase in E. coli,

hexahistidine-tagged pQE expression vector was also used in our

pre-liminary test. Two chitinase genes were subcloned into

the C-terminal hexahistidine-tagged vector, pQE60,

and the constructed expression vectors were

trans-formed into E. coli XL1-Blue and BL21 for

overexpres-sion. However, no expression was observed whether we

tested many conditions for expression (temperature,

time, medium, etc.). Therefore, other expression systems

were studied to achieve overexpression of chitinase.

Be-cause a wide range of proteins can be expressed and

Fig. 6. Thin-layer chromatography of hydrolytic products from various N-acetylchitooligosaccharides. Lane st, standard N-acetylchitooligosac-charides; N-acetylglucosamine (G1); N-acetylchitobiose (G2); N-acetylchitotriose (G3); N-acetylchitotetraose (G4); N-acetylchitopentaose (G5); and N-acetylchitohexaose (G6). Lanes G1–G6, N-acetylchitooligosaccharides from monomer to hexamer hydrolyzed with ChiCH or ChiCW individually.

Fig. 7. Affinity electrophoresis of chitinases in the presence (+) and absence (
) of glycol chitin (A), CM-cellulose (B), and laminarin (C). Substrates (0.1% wt/vol) were added in 8% native polyacrylamide gels and BSA (lane 1), ChiCW (lane 2), and ChiCH (lane 3) were subjected to native PAGE at 4C. Proteins were visualized by Coomassie blue G-250 staining after electrophoresis.

purified by GST fusion protein technology

[30]

, the

expression vector, pGEX-6P-1, with N-terminal GST

tag was selected to construct recombinant expression

vectors. Fortunately, we had achieved high-level

expres-sion of recombinant chitinases in E. coli as GST-fuexpres-sion

proteins.

In the study of Kim et al.

[31]

, a lysozyme from

bac-teriophage /Ea1h was not successfully overexpressed in

E. coli using pQE30 expression vector, E. coli host cell

growth was abolished, and the bacteria were lysed after

induction of lysozyme expression. They indicated that

lysozyme seems to be toxic to E. coli host cells because

lysozyme has muramidase activity to hydrolyze

b-1,4-linkage of N-acetylglucosamine and N-acetylmuramic

acid in the peptidoglycan layer of bacterial cell walls

[32]

. On the other hand, some chitinases display a more

or less lysozyme activity to degrade bacterial cell walls

[1]

. Therefore, two chitinases in our study seemed

to be toxic to E. coli host cell when those recombinant

enzymes were directly expressed in E. coli without any

protein fused in those N-termini.

In addition, the result of kinetics of native and

GST-fused chitinases possibly reveals the same information

and explanation of our successful overexpression of

chitinases. The K

values of ChiCH and

GST-ChiCW were larger than those of ChiCH (7-fold) and

ChiCW (3-fold). That indicated addition of GST in

the N-terminus of each chitinase decreased

substrate-binding affinity. According to the result of kinetics, we

proposed that overexpression of GST-chitinase fusion

protein was successful because addition of GST in the

N-terminus interfered and decreased enzyme activity

and toxicity to E. coli.

As presented in

Fig. 5

, ChiCH and ChiCW have

dif-ferent domain structures and the peptide sequences of

both catalytic domains share very low similarity (10%)

by sequence comparison although both enzymes belong

to family-18 chitinases. Thus, we investigated kinetics of

ChiCH and ChiCW toward three kinds of substrates

and determined K

, V

, k

, and k

/K

in this study.

K

of ChiCH toward three kinds of substrates was

low-er than those of ChiCW (

Table 3

). These data revealed

substrate-binding affinity of ChiCH was better than

ChiCW. However, ChiCW shows higher k

and k

/

K

than those of ChiCH and the data indicate that

ChiCW catalyzes hydrolysis of chitinous substrates,

especially on glycol chitin and colloidal chitin, more

effectively. Therefore, the different domain structures

and sequences of catalytic domains cause different

ki-netic properties of two enzymes.

Based on the result of TLC, chitooligosaccharides

with degree of polymerization (DP) values of 4–6, i.e.,

chitotetraose to chitohexaose, are good substrates of

both chitinases although ChiCW shows higher reaction

velocities with three substrates. However, chitotriose

was slowly hydrolyzed. When ChiCW hydrolyzed

chito-tetraose, formation of chitohexaose was detected and

the result indicates ChiCW has transglycosylation

activ-ity. In addition, no N-acetylglucosaminidase activity

was observed by TLC or detected by 4-MU-GlcNAc

substrate. Furthermore, chitobiose only produced by

ChiCW hydrolyzing colloidal chitin for 2 h could be

de-tected by TLC. This result corresponded to the data of

kinetics of two enzymes. ChiCW catalyzes hydrolysis

of colloidal chitin more effectively.

In our previous and this study, enzyme activities

of ChiCH and ChiCW were detected using substrates

4-MU-(GlcNAc)

and 4-MU-(GlcNAc)

, respectively,

due to ChiCH with 4-MU-(GlcNAc)

and ChiCW with

4-MU-(GlcNAc)

showing higher activities. According

to the study of Haran et al.

[33]

, 4-MU-(GlcNAc)

and 4-MU-(GlcNAc)

can be used to differentiate

exo-and endo-modes of catalytic mechanisms of chitinases.

Thus, it is suggested that ChiCH is an exochitinase.

Fur-thermore, ChiCH do not show N-acetylglucosaminidase

activity and produce chitobiose after hydrolysis of

chi-tooligosaccharides (DP 3–6). Therefore, we suggest

ChiCH as a chitobiosidase. On the other hand, ChiCW

shows higher activity with 4-MU-(GlcNAc)

and

effec-tively produces chitobiose from chitohexaose and

colloi-dal chitin. Therefore, we propose that ChiCW is an

endochitinase.

Based on the results of kinetic properties and

hydro-lysis products, we proposed the initial pathway of chitin

depolymerization of B. cereus 28-9. ChiCW effectively

catalyzed hydrolysis of chitin and low molecular mass

chito-multimers to chito-oligomers and end product

chi-tobiose. Then, chito-oligomers were hydrolyzed by

ChiCH to produce chitobiose.

ChiCW showed significant sequence homology with

ChiB of B. cereus CH in our previous study

[8]

.

Accord-ing to the study of Mabuchi and Araki

[12]

,

recombi-nant ChiB shows equal good binding activity onto

colloidal chitin and cellulose, and C-terminal domain

of ChiB was reported as cellulose-binding domain based

on the data of binding assay and sequence analysis. In

that study, purified recombinant ChiB was 64 kDa and

smaller than predicted molecular weight (70.6 kDa).

Thus, they thought that ChiB was cleaved its C-terminal

domain by proteolytic modification of E. coli. In this

study, full-length ChiCW of 71 kDa without proteolytic

modification was purified and showed better binding

activity onto colloidal chitin than cellulose. Therefore,

we thought that C-terminal domain of ChiCW belonged

to a chitin-binding domain although sequence analysis

revealed that as cellulose-binding domain.

In addition to successful overexpression of chitinases

in E. coli, the method of chitinolytic zymography assay

was modified to enhance the resolution of zymogram.

To detect chitinases, the methods for chitinolytic

zymo-gram analysis have been developed and widely used

chitinases in substrate-containing gels by activity

stain-ing after gel electrophoresis. All detection methods are

modified from the most widely used SDS–PAGE

proce-dure, Laemmli method, with modifications, and the

res-olution of zymogram is determined by the Laemmli

condition of electrophoresis

[29]

. However, the resolving

power of the traditional Laemmli gel is unsatisfactory.

The deviations of chitinolytic zymography-estimated

molecular masses and calculated molecular masses of

chitinases were reported

[16,26]

. Therefore, we develop

a new method for chitinolytic zymography assay in this

study. Chitinolytic zymography assay performed in a

Tris–Tricine buffer system

[25]

can achieve high

resolu-tion, excellent linearity, and range of calibration to

determine molecular masses of chitinases. Furthermore,

molecular mass of chitinase estimated by our method is

more corresponding to calculated molecular mass

with-out casting gradient SDS–polyacrylamide gels. On the

other hand, chitinolytic zymography assay performed

in Tris–Tricine buffer system tolerates deviation in ionic

strength and pH of protein samples

[25]

. Therefore, we

recommend this method as an ideal and convenient

sys-tem for chitinolytic zymography assay and it could also

be applied in proteomic studies.

Acknowledgment

This study was financially supported by the National

Science Council, Taiwan, Republic of China.

References

[1] J. Flach, P.E. Pilet, P. Jolles, WhatÕs new in chitinase research?, Experientia 48 (1992) 701–716.

[2] J.H. Sietsma, J.G.H. Wessels, Evidence for covalent linkages between chitin and b-glucan in a fungal cell wall, J. Gen. Microbiol. 114 (1979) 99–108.

[3] R. Cohen-Kupiec, I. Chet, The molecular biology of chitin digestion, Curr. Opin. Biotechnol. 9 (1998) 270–277.

[4] P.A. Felse, T. Panda, Regulation and cloning of microbial chitinase genes, Appl. Microbiol. Biotechnol. 51 (1999) 141–151. [5] L.S. Graham, M.B. Sticklen, Plant chitinases, Can. J. Bot. 72

(1994) 1057–1083.

[6] N. Takaya, D. Yamazaki, H. Horiuchi, A. Ohta, M. Takagi, Intracellular chitinase gene from Rhizopus oligosporus: molecular cloning and characterization, Microbiology 144 (1998) 2647–2654. [7] C.J. Huang, C.Y. Chen, Gene cloning and biochemical charac-terization of chitinase CH from Bacillus cereus 28-9, Ann. Microbiol. 54 (2004) 289–297.

[8] C.J. Huang, T.K. Wang, S.C. Chung, C.Y. Chen, Identification of an antifungal chitinase from a potential biocontrol agent, Bacillus cereus 28-9, J. Biochem. Mol. Biol. (2004) (accepted).

[9] N. Arora, T. Ahmad, R. Rajagopal, R.K. Bhatnagar, A consti-tutively expressed 36 kDa exochitinase from Bacillus thuringiensis HD-1, Biochem. Biophys. Res. Commun. 307 (2003) 620–625. [10] J.E. Barboza-Corona, E. Nieto-Mazzocco, R.

Velazquez-Rob-ledo, R. Salcedo-Hernandez, M. Bautista, B. Jimenez, J.E. Ibarra, Cloning, sequencing, and expression of the chitinase gene chiA74

from Bacillus thuringiensis, Appl. Environ. Microbiol. 69 (2003) 1023–1029.

[11] Y. Lin, G. Xiong, Molecular cloning and sequence analysis of the chitinase gene from Bacillus thuringiensis serovar alesti, Biotech-nol. Lett. 26 (2004) 635–639.

[12] N. Mabuchi, Y. Araki, Cloning and sequencing of two genes encoding chitinases A and B from Bacillus cereus CH, Can. J. Microbiol. 47 (2001) 895–902.

[13] S. Thamthiankul, S. Suan-Ngay, S. Tantimavanich, W. Panbang-red, Chitinase from Bacillus thuringiensis subsp. pakistani, Appl. Microbiol. Biotechnol. 56 (2001) 395–401.

[14] S. Wang, S. Wu, G. Thottappilly, R.D. Locy, N.K. Singh, Molecular cloning and structural analysis of the gene encoding Bacillus cereus exochitinase Chi36, J. Biosci. Bioeng. 92 (2001) 59– 66.

[15] T. Watanabe, K. Kobori, K. Miyashita, T. Fujii, H. Sakai, M. Uchida, H. Tanaka, Identification of glutamic acid 204 and aspartic acid 200 in chitinase A1 from Bacillus circulans WL-12 as essential residues for chitinase activity, J. Biol. Chem. 268 (1993) 18567–18572.

[16] T. Watanabe, W. Oyanagi, K. Suzuki, H. Tanaka, Chitinase system of Bacillus circulans WL-12 and importance of chitinase A1 in chitin degradation, J. Bacteriol. 172 (1990) 4017–4022. [17] T. Watanabe, W. Oyanagi, K. Suzuki, K. Ohnishi, H. Tanaka,

Structure of the gene encoding chitinase D of Bacillus circulans WL-12 and possible homology of the enzyme to other prokaryotic chitinases and class III plant chitinases, J. Bacteriol. 174 (1992) 408–414.

[18] S. Chong, G.E. Montello, A. Zhang, E.J. Cantor, W. Liao, M. Xu, J. Benner, Utilizing the C-terminal cleavage activity of a protein splicing element to purify recombinant proteins in a single chromatographic step, Nucleic Acids Res. 26 (1998) 5109–5115. [19] S.C. Makrides, Stratagies for achieving high-level expression of

genes in Escherichia coli, Microbiol. Rev. 60 (1996) 512–538. [20] J. Nilsson, S. Stahl, J. Lundeberg, M. Uhlen, P. Nygren, Affinity

fusion strategies for detection, purification, and immobilization of recombinant proteins, Protein Exp. Purif. 11 (1997) 1–6. [21] H. Tsujibo, T. Okamoto, N. Hatano, L. Miyamoto, T. Watanabe,

M. Mitsutomi, Y. Inamori, Family 19 chitinases from Strepto-myces thermoviolaceus OPC-520: molecular cloning and charac-terization, Biosci. Biotechnol. Biochem. 64 (2000) 2445–2453. [22] M. Kaomek, K. Mizuno, T. Fujimura, P. Sriyotha, J.R.K.

Cairns, Cloning, expression, and characterization of an antifungal chitinase from Leucaena leucocephala de Wit, Biosci. Biotechnol. Biochem. 67 (2003) 667–676.

[23] K. Morimoto, S. Karita, T. Kimura, K. Sakka, K. Ohmiya, Cloning, sequencing, and expression of the gene encoding Clostridium paraputrificum chitinase ChiB and analysis of the functions of novel cadherin-like domains and a chitin-binding domain, J. Bacteriol. 179 (1997) 7306–7314.

[24] K. Okazaki, Y. Yamashita, M. Noda, N. Sueyoshi, I. Kameshita, S. Hayakawa, Molecular cloning and expression of the gene encoding family 19 chitinase from Streptomyces sp. J-13-3, Biosci. Biotechnol. Biochem. 68 (2004) 341–351.

[25] H. Schagger, G. von Jagow, Tricine–sodium dodecyl sulfate– polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa, Anal. Biochem. 166 (1987) 368– 379.

[26] J. Trudel, A. Asselin, Detection of chitinase activity after polyacrylamide gel electrophoresis, Anal. Biochem. 178 (1989) 326–366.

[27] M.M. Bradford, A rapid and sensitive method for the quantita-tion of microgram quantities of protein utilizing the principle of protein–dye binding, Anal. Biochem. 72 (1976) 248–254. [28] T. Tanaka, S. Fujiwara, S. Nishikori, T. Fukui, M. Takagi, T.

Imanaka, A unique chitinase with dual active sites and triple substrate binding sites from the hyperthermophilic archaeon

Pyrococcus kodakaraensis KOD1, Appl. Environ. Microbiol. 65 (1999) 5338–5344.

[29] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. [30] C. Dian, S. Eshaghi, T. Urbig, S. McSweeney, A. Heijbel, G.

Salbert, D. Birse, Strategies for the purification and on-column cleavage of glutathione-S-transferase fusion target proteins, J. Chromatogr. B. 769 (2002) 133–144.

[31] W.S. Kim, H. Salm, K. Geider, Expression of bacteriophage / Ea1h lysozyme in Escherichia coli and its activity in growth

inhibition of Erwinia amylovora, Microbiology 150 (2004) 2707– 2714.

[32] G.M. Cooper, The Cell, a Molecular Approach, American Society for Microbiology, Washington, DC, 1997.

[33] S. Haran, H. Schickler, A. Oppeheim, I. Chet, New components of the chitinolytic system of Trichoderma harzianum, Mycol. Res. 99 (1995) 441–446.

[34] A. Tronsmo, G.E. Harman, Detection and quantification of N-acetyl-b-DD-glucosaminidase, chitobiosidase, and endochitinase in solutions and on gels, Anal. Biochem. 208 (1993) 74–79.