The molecular structures and expression patterns of zebrafish troponin I genes

(1)

The molecular structures and expression patterns of zebraﬁsh troponin I genes

Chuan-Yang Fu, Hung-Chieh Lee, Huai-Jen Tsai

*

Institute of Molecular and Cellular Biology, National Taiwan University, Room 307, Fisheries Science Building, No. 1, Section 4, Roosevelt Road, Taipei 106, Taiwan

a r t i c l e

i n f o

Article history: Received 18 July 2008

Received in revised form 31 January 2009 Accepted 3 February 2009 Available online xxxx Keywords: Zebraﬁsh Troponin I Muscle Expression pattern Molecular structure

a b s t r a c t

Troponin I (TnnI), a constituent of the troponin complex located on the thin filament, provides a calcium-sensitive switch for striated muscle contraction. Cardiac TnnI is, therefore, a highly calcium-sensitive and specific marker of myocardial injury in acute coronary syndromes. The TnnI gene, which has been identified in birds and mammals, encodes the isoforms expressed in cardiac muscle, fast skeletal muscle and slow skeletal muscle. However, very little is known about the TnnI gene in lower vertebrates. Here, we cloned and characterized the molecular structures and expression patterns of three types of zebrafish tnni genes: tnni1, tnni2 and tnni-HC (heart and craniofacial). Based on the unrooted radial gene tree analysis of the TnnI gene among vertebrates, the zebrafish TnnI1 and TnnI2 we cloned were homologous of the slow muscle TnnI1 and fast muscle TnnI2 of other vertebrates, respectively. In addition, reverse transcrip-tion-polymerase chain reaction (RT-PCR) and whole-mount in situ hybridization demonstrated that zeb-rafish tnni1 and tnni2 transcripts were not detectable in the somites until 16 h post-fertilization (hpf), after which they were identified as slow- and fast-muscle-specific, respectively. Interestingly, tnni-HC, a novel tnni isoform of zebrafish was expressed exclusively in heart during early cardiogenesis at 16 hpf, but then extended its expression in craniofacial muscle after 48 hpf. Thus, using zebrafish as our system model, it is suggested that the results, as noted above, may provide more insight into the molecular structure and expression patterns of the lower vertebrate TnnI gene.

1. Results and discussion

The troponin (Tn) complex provides a calcium-sensitive molec-ular switch for the regulation of striated muscle contraction. It is composed of three subunits: troponin I (TnnI), troponin C (TnnC), and troponin T (TnnT). Each Tn is composed of multiple isoforms which are encoded by distinct genes and expressed in a tissue-spe-cific manner. These isoforms are also regulated at different devel-opmental stages. (Schiaffino et al., 1993; Parmacek and Leiden, 1991). Particularly, TnnI is a myofibrillar protein involved in the calcium regulation of contraction in cardiac and skeletal muscles (Wilkinson and Grand, 1978). It has multiple functional domains that are distinct and bind with high affinity to actin (Potter and Gergely, 1974) and TnnC (Head and Perry, 1974). The interactions of these domains are regulated by actomyosin ATPase activity in resting and contracting muscle (Wilkinson et al., 1972). TnnI also interacts functionally with other muscle proteins, including TnnT, and the specific domains that are involved in other interactions have been identified (Horwitz et al., 1979). In birds and mammals, there are three different muscle fiber-type specific isoforms: a slow-twitch type (TnnIs/TnnI1), a fast-twitch type (TnnIf/TnnI2) and a cardiac type (TnnIc/TnnI3) (Toyota and Shimada, 1981;

Wade et al., 1990). Each type is encoded by a single speciﬁc gene (Guenet et al., 1996).

TnnIs is transiently expressed in the developing heart of both birds and mammals (Hastings, 1996; Sabry and Dhoot, 1989; Sag-gin et al., 1989; Murphy et al., 1991; Gorza et al., 1993). In mam-mals, the transient expression of TnnIs in the heart is under the control of a developmentally regulated program of gene transcrip-tion (Huang et al., 2000). In contrast, although Xenopus TnnIs is ex-pressed in the somites and skeletal muscles, it is not exex-pressed in the developing heart (Warkman and Atkinson, 2002), indicating that the developmental expression pattern of the amphibian TnnIs gene is quite different from the mammalian and avian TnnIs homo-log. The lines of evidences reveal that the structure and function of TnnI gene among different species may exhibit a different and complicate manner. Therefore, the ﬁrst step, it is important to elu-cidate the molecular structure and expression pattern of the TnnI gene in the ﬁsh.

As a result of the ease of manipulating gene transfer, the trans-parency of embryos and feasibility of mutagenesis, the zebrafish (Danio rerio) is an excellent model for studying the developmental and fiber-specific regulation of muscle diversity (Grunwald and Ei-sen, 2002). Most importantly, the processes of cardiac and skeletal muscle commitment, differentiation, and maturation are observa-ble directly in vivo (Briggs, 2002). Secondly, the organization of slow-twitch and fast-twitch muscles in fish is more homogeneous than that of birds and mammals. In fish, slow- and fast-twitch

* Corresponding author. Tel.: +886 2 3366 2487; fax: +886 2 2363 8483. E-mail address:hjtsai@ntu.edu.tw(H.-J. Tsai).

Contents lists available atScienceDirect

Gene Expression Patterns

j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / g e p

(2)

muscles are spatially separated; slow muscle forms a superficial layer, whereas fast muscle forms a deep layer (Waterman, 1969; Koumans and Akster, 1995), which makes it easy to assay develop-mental regulation of muscle-fiber specificity.

Because it is still unknown about the molecular structures and expression patterns of zebrafish tnni gene during embryonic devel-opment, we initiated the present study. Here, we report the cloning of three distinct fiber-types of zebrafish tnni genes. tnni1 and tnni2 were characterized as slow- and fast-muscle-specific, respectively. In addition, a novel tnni gene isoform, tnni-HC, was found to be exclusively expressed in heart during early cardiogenesis at 16 hours of post-fertilization (hpf). Interestingly enough, we found that tnni-HC was also expressed in craniofacial muscles after 48 hpf.

1.1. Identiﬁcation and characterization of three types of zebraﬁsh tnni gene

To clone the full-length of zebrafish tnni cDNAs, we used two degenerated primers, tnni-DF and tnni-DR, and obtained three RT-PCR produces with the molecular masses of 180-, 189- and 184-bp. After we performed BLAST search, three zebrafish EST clones corresponding Accession no. EH612065, EE686691 and CV126661, were found from zebrafish EST clone database. On the basis of these EST sequences, we designed specific primers to am-plify the putative zebrafish tnni cDNAs by RACE. Consequently, three full-length cDNAs of zebrafish tnni were identified: tnni1 was 930-bp containing a 543-bp open reading frame, tnni2 was 755-bp containing a 531-bp open reading frame, and tnni-HC was 961-bp containing a 549-bp open reading frame.

The deduced amino acid sequence of three zebrafish TnnI were compared with other vertebrates, the data showed that the deduced amino acid sequence of zebrafish TnnI1 shared 59–62%, 48–53%, 55– 57% and 49–51% identities with vertebrates TnnIs (slow-twitch muscle fibers), TnnIf (fast-twitch muscle fibers), TnnIc (cardiac mus-cle) and Ciona TnnI (heart TnnI, and body well TnnI), respectively (Table 1). Meanwhile, the deduced amino acid sequence of zebrafish TnnI2 shared 55%, 59–69%, 53–57% and 53% identities with verte-brates TnnIs, TnnIf, TnnIc and inverteverte-brates TnnI, respectively (Table 1). These evidences indicate that zebrafish TnnI1 and TnnI2 was quite similar to TnnIs and TnnIf, respectively. However, the zebrafish TnnI-HC shared 63–81% identities with vertebrates TnnIs.

It has been reported that TnnI consists of 181–211 deduced amino acid residues and that the cardiac isoform TnnIc is the larg-est because it contains an extra 30-amino-acid at the N-terminus (Perry, 1999). When the deduced amino acid residues of the three types of zebrafish TnnI were aligned with the counterpart of other vertebrates and, we found that there are some highly conserved domains such as C-domain of TnnC binding site, TnnT-binding site, Actin/TnnC-tropomyosin binding site, N-domain of TnnC-binding site and Actin–tropomyosin binding site (Fig. 1). However, not one of the TnnI zebrafish genes contained a 30-amino-acid N-ter-minal amino acid extension domain, a phenomenon that otherwise distinguishes the typical TnnIc isoform from the other TnnI iso-forms of known species (Hastings et al., 1991). We compared the N-terminal amino acid sequences of zebrafish TnnI genes with those known TnnIc polypeptides of Ciona (AAL27686), Xenopus (AAA65727), chicken (NM_213570), mice (NM_009406) and hu-mans (NM_000363).We found that the N-terminal amino acid se-quence of zebrafish TnnI did not resemble the counterpart of vertebrate TnnIc such as (1) a Glu-rich domain located at the N-ter-minus, which was prominent in the TnnIc of Ciona and Xenopus, but neither in bird TnnIc nor mammal TnnIc; (2) a Pro-rich/hydro-phobic/basic motif, and (3) an AXEXH motif (MacLean et al., 1997) (Supplementary data). These evidences indicate that three types of zebrafish TnnI sequence lacked N-terminal sequence that was con-served among vertebrate TnnIc sequences.

According to ZFIN database, there were five tnni2 genes such as tnni2a.1 (NM_001007365), tnni2a.2 (NM_201093), tnni2a.3 (NM_ 205575), tnni2b.1 (NM_001017587) and tnni2b.2 (NM_ 001003423). When these five tnni2 genes were compared with three types of zebrafish tnni described in this study, results showed that these five tnni2 genes and zebrafish tnni2 gene are categorized as fast muscle fiber-type. The amino acid similarity between zebra-fish TnnI2 and other five TnnI2 ranged 64–81%.

1.2. Phylogenetic analysis of TnnI

To examine the evolutionary relationship between teleost and other species TnnI, we constructed a phylogenetic tree based on the deduced amino acid residues of the three types of zebraﬁsh TnnI (Fig. 2). Results showed that zebraﬁsh TnnI1 and TnnI2 were clustered with their tetrapod counterparts into two distinct

mono-Table 1

Identity of zebraﬁsh TnnI1, TnnI2, and TnnI-HC with other vertebrates and invertebrates. TnnI Species (GenBank No.) Zebraﬁsh TnnI1 (NM_001002101)

(Identity %)

Zebraﬁsh TnnI2 (NM_001009901) (Identity %)

Zebraﬁsh TnnI-HC (NM_001008613) (Identity %)

TnnIs Xenopus laevis (AAL86906) 62 55 63

Rattus norvegicus (NP_058880)

59 55 81

Mus musculus (NP_067442) 59 55 81

Homo sapiens (AAA61228) 59 55 79

TnnIf Xenopus laevis (AAL86905) 53 64 63

Rattus norvegicus (P27768) 48 60 58

Mus musculus (NP_033431) 49 60 59

Homo sapiens (AAH32148) 48 59 57

Salmo salar (NM_001123661)

49 69 54

Clupea harengus (U20112) 50 67 51

TnnIc Xenopus laevis (AAA65727) 56 57 64

Rattus norvegicus (NM_017144)

55 53 60

Mus musculus (NM_009406) 55 53 59

Homo sapiens (NM_000363) 57 55 62

TnnI-heart Ciona intestinalis (AAN87358) 50 53 57 TnnI-body well Ciona intestinalis (AAL27686) 51 53 57

2 C.-Y. Fu et al. / Gene Expression Patterns xxx (2009) xxx–xxx

ARTICLE IN PRESS

(3)

Fig. 1. The deduced amino acid sequences of three types of zebraﬁsh TnnI compared with other TnnI from vertebrates. The alignment of amino acid sequences of three types TnnI by CLUSTALW (1.83). The conserved regions are boxed with red, including (1) C-domain of TnnC binding site, (2) TnnT-binding site, (3) Actin/TnnC-tropomyosin binding site, (4) N-domain of TnnC-binding site, (5) Actin–tropomyosin binding site. Asterisks, two dots and one dot were indicated that amino acid residues were 100%, 75%, 50% conserved among all species, respectively.

(4)

phyletic groups. Interestingly, zebraﬁsh TnnI-HC was belonged to the tetrapod TnnIs monophyletic group. Further study of this unu-sual characteristic should provide additional insight into the molecular structure of TnnI genes.

1.3. Temporal expression of tnni in zebraﬁsh

We used specific primers to detect the temporal expressions of the three types of zebrafish tnni gene transcripts by RT-PCR. Total RNAs were extracted from zebrafish embryos at 10 stages, ranging from 1-, 4-, 8-, 10-, 12-, 14-, 15-, 16-, 24- and 48-hpf. As shown in

Fig. 3, we were able to detect all three types of zebraﬁsh tnni gene at 16 hpf through 48 hpf (Fig. 3), indicating that zebraﬁsh tnni gene transcripts are neither maternally expressed, nor a very early embryonic marker.

1.4. Spatial expression of tnni1 in zebraﬁsh embryos

The deduced amino acid sequence of zebrafish TnnI1 is quite similar to that of quail (Hastings, 1996), mice (Barton et al., 2000) and humans (Wade et al., 1990). In mammals and birds, TnnIs transcripts are transiently expressed in the developing heart during the early embryogenic stage. At later stages, TnnIs are ex-pressed exclusively in skeletal muscle (Trimmer et al., 1989). Un-like the TnnIs in mammals and birds, the amphibian TnnIs gene is expressed in the somites and skeletal muscles, but not expressed in the developing heart (Warkman and Atkinson, 2002). To exam-ine the spatial expression of zebrafish tnni1, whole-mount in situ hybridization (WISH) was performed on zebrafish embryos col-lected from 20 to 96 hpf. The data showed that zebrafish tnni1 transcripts were detected specifically in somites at 20 and 24 hpf

Fig. 2. An unrooted radial gene tree of TnnI among vertebrates. The gene tree was constructed with the neighbor-joining method (Pearson et al., 1999), using 1000 bootstrap values. The marker length of 0.1 corresponds to 10% sequence difference. The TnnIs, TnnIf, TnnIc clades, and Ciona were marked in red, blue, green, and brown, respectively. SeeSection 2for details on the sources of TnnI. This phylogenic tree indicates that Zebraﬁsh TnnI1 and TnnI2 clustered with their tetrapod counterparts into two distinct monophyletic groups. Especially, Zebraﬁsh TnnI-HC was belonged to the tetrapod TnnIs monophyletic group, and The Ciona TnnI was unique monophyletic groups.

Fig. 3. Using reverse transcriptase-polymerase chain reaction (RT-PCR) to detect the temporal expression patterns of zebrafish tnni genes during the early development. Total RNA was isolated from different developmental stages (hours of post-fertilization; hpf) as indicated. Specific primers were designed for detecting the existence of tnni1, tnni2, and tnni-HC transcripts. The expected molecular size of each DNA fragment after RT-PCR amplification was indicated on the right. Three types of tnni genes started to be transcribed in 16 hpf. The b-actin transcript was used as an internal control.

ARTICLE IN PRESS

(5)

(Fig. 4A and B) during early somitogenesis and were also detectable at 48 hpf (Fig. 4C and D). Histochemical section of trunk was also

performed to confirm the expression of zebrafish tnni1 at cell level. This analysis showed that zebrafish tnni1 is expressed in a

slow-Fig. 4. The expression pattern of tnni1 transcript during the development of zebraﬁsh embryos. Embryos at different stages as indicated were collected and hybridized with tnni1 using whole-mount in situ hybridization. Panels A, B, C, D, F and H were lateral views and anterior of embryo to the left; panel E and G were dorsal view and anterior of embryo to the top. tnni1 was expressed in the somite at 20–48 hpf, but it was expressed in craniofacial muscle and ﬁn at 72–96 hpf. Panel D and D0_{were whole-mount in situ}

hybridization and transverse section (red line) at 48 hpf Embryos. Panel D0_{was indicated that tnni1 gene was slow-muscle-speciﬁc. Panels I and J were hybridized with MyoD,}

speciﬁc marker for craniofacial muscles and truck muscle at 72 hpf Embryos. am, adductor mandibulae; lap, levator arcus palatini; ao, adductor operculi; ah, adductor hyoideus; ih, interhyoideus; hh, hyohyoideus; s, somite; f, ﬁn bud; tv 1–5, transversus ventralis 1–5.

(6)

twitch muscle-ﬁber-speciﬁc manner until 48 hpf (Fig. 4D0_).

Inter-estingly enough, similar to expression patterns of mammals and amphibian TnnI1 (Zhu et al., 1995; Warkman and Atkinson,

2002), zebrafish tnni1 was specifically and uniformly detected in truck somites from 20 to 96 hpf (Fig. 4F and H), In addition, tnni1 was up-regulated in fin buds and jaw and head muscles, such as

Table 2

The comparison of expression in the craniofacial muscle and other regions among the three zebraﬁsh tnni genes.

Zebrafish tnni1 Zebrafish tnni2 Zebrafish tnni-HC

16–48 hpf S S H

72 hpf S, f, lap, ah, ao, ih, hh, am S, f, am, sh, hm H, so, sr, io, ir, mr, lr, ih, hh, sh, hm, imp, ima 96 hpf S, f, lap, ah, ao, ih, hh, am S, f, am, sh, hm, lap, ao H, so, sr, io, ir, mr, lr, ih, hh, sh, hm, imp, ima ah, adductor hyoideus; am, adductor mandibulae; ao, adductor operculi; do, dilator operculi; hh, hyohyoideus; ih, interhyoideus; ima, intermandibularis anterior; imp, intermandibularis posterior; io, inferior oblique; ir, inferior rectus; lap, levator arcus palatini; mr, medial rectus; sh, sternohyoideus; so, superior oblique; sr, superior rectus; S, somite; H, heart; f, ﬁn bud.

Fig. 5. The expression pattern of tnni2 transcript during the development of zebraﬁsh embryos. Embryos at different stages as indicated were collected and hybridized with tnni2 using whole-mount in situ hybridization. Panels A, B, C, D, F and H were lateral views and anterior of embryo to the left; and panel E and G were dorsal view and anterior of embryo to the top. tnni2 was expressed in the somite at 20–48 hpf, then it was expressed in craniofacial muscle and ﬁn at 72–96 hpf. Panel D and D0_{were whole-mount}

in situ hybridization and transverse section (red line) at 48 hpf Embryos. Panel D0_{was indicated that tnni2 gene was fast-muscle-speciﬁc. am, adductor mandibulae; lap,}

levator arcus palatini; ao, adductor operculi; hm, hapaxial muscles; sh, sternohyoideus; s, somite; f, ﬁn bud. 6 C.-Y. Fu et al. / Gene Expression Patterns xxx (2009) xxx–xxx

(7)

adductor mandibulae (am), levator arcus palatine (lap) adductor operculi (ao), adductor hyoideus (ah), interhyoideus (ih), hyohyoi-deus (hh) after 48 hpf (Fig. 4F and H andTable 2). This evidence indicates that the expression of zebraﬁsh tnni1 was different from that of mammals and birds, but similar to amphibian counterparts.

1.5. Spatial expression of tnni2 in zebraﬁsh embryos

The amino acid sequence of zebrafish TnnI2 exhibited a high de-gree of identity to that of quail (Baldwin et al., 1985), mice (Koppe et al., 1989), humans (Zhu et al., 1994), amphibian (Warkman and Atkinson, 2002) and fish (Hodgson et al., 1996andJackman et al., 1998). In mammals, the expression of TnnI2 is in skeletal muscle (Trimmer et al., 1989), but it is not expressed in heart. In order to study the spatial expression pattern of zebrafish tnni2, we per-formed WISH for zebrafish embryos collected from 20 to 96 hpf. Results showed that the zebrafish tnni2 transcript was specifically detected in somites at 20 hpf (Fig. 5A and B), and it was expressed continuously up to 48 hpf (Fig. 5C and D). Histochemical examina-tion revealed that zebrafish tnni2 transcript displayed clearly in fast-twitch muscle fibers (Fig. 5D0_{). Similar to the expression}

pat-terns of zebrafish tnni1 during early embryogenesis, zebrafish tnni2 not only was specifically and uniformly detected in truck somites from 20 to 96 hpf (Fig. 5F and H), However, unlike tnni1 expression in craniofacial muscle, tnni2 was expressed in sternohyoideus (sh), but tnni2 was absent in ih, hh, and ah (Fig. 5E and G andTable 2). These data suggest that the spatial expression of zebrafish tnni2 was similar to that of mammals and other vertebrates.

1.6. Spatial expression of tnni-HC in zebraﬁsh embryos

In heart development, the slow-twitch muscle fiber isoform of vertebrates, TnnIs, is predominantly expressed in hearts during embryogenesis. However, TnnIs is completely replaced by TnnIc, which is a cardiac-specific isoform (Huang et al., 2000). To examine the spatial expression pattern of the zebrafish tnni-HC isoform we found in this study, we carried out WISH for zebrafish embryos

from 16 to 96 hpf. Results showed that the tnni-HC transcript was first detected in the lateral plated mesoderm (Fig. 6A) at 16 hpf, and then it was expressed in a single heart cone at 18 hpf (Fig. 6B). From 24 hpf onward, the tnni-HC transcript was ex-pressed in the heart tube (Fig. 6C). It was specifically and uniformly detected in both atrium and ventricle from 48 to 96 hpf (Fig. 6D– G). We also noticed that tnni-HC was detected in craniofacial mus-cles, such as, lap, ah, ih, hh, sh, hm, medial rectus (mr), lateral rec-tus (lr), superior oblique (so), inferior oblique (io), superior recrec-tus (sr), inferior rectus (ir) intermandibularis posterior (imp), inter-mandibularis anterior (ima) after 48 hpf (Fig. 6E,F and G andTable 2). These data indicates that tnni-HC was expressed in early heart development stage and craniofacial muscles development stage. To further examine how tnni-HC was expressed in the zebrafish adult heart, we performed ISH on the histological section of zebra-fish adult heart using tnni-HC RNA as a probe. Results showed that the tnni-HC transcript was detected in the ventricle trabeculae of adult heart (Fig. 7C). These data indicated that tnni-HC was present in early heart development and continues its expression until adulthood. Thus, it appears that the heart of zebrafish does not un-dergo the developmental switch from TnnIs to TnnIc that is charac-teristic of the higher vertebrates. Instead, zebrafish express only tnni-HC, which is a unique isoform that is totally different from what is known in mammals, amphibians or avian homologues. Moreover, phylogenetic analysis also reveals that TnnI-HC was not belonged to the tetrapod TnnIc monophyletic group. This find-ing gives further evidence that zebrafish may not have a cardiac-specific isoform, but replace by a slow muscle isoform, tnni-HC. These hypotheses merit further investigation.

1.7. Conclusion

In this study, we cloned and characterized the molecular struc-tures and expression patterns of three types of zebraﬁsh tnni genes: tnni1, tnni2 and tnni-HC. In comparing our zebraﬁsh system model to higher vertebrates, we found that the molecular struc-tures and expression patterns of TnnI orthologous genes among

Fig. 6. The expression pattern of tnni-HC transcript during the development of zebraﬁsh embryos. Embryos at different stages as indicated were collected and hybridized with tnni-HC using whole-mount in situ hybridization. Panels A, B, C, D and F were dorsal view, anterior of embryo to the top; and panels E and G were lateral views, anterior of embryo to the left. tnni-HC was expressed in the heart exclusively during early cardiogenesis at 16–48 hpf, but it was not only in the craniofacial muscle but also in the heart after 48 hpf. so, superior oblique; io, inferior oblique; sr, superior rectus; ir, inferior rectus; lr, lateral rectus; mr, medial rectus; sh, sternohyoideus; lap, levator arcus palatini; ao, adductor hyoideus; imp, intermandibularis posterior; ima, intermandibularis anterior; ih, interhyoideus; hh, hyohyoideus; hm, hapaxial muscles; V, ventricle; A, atrium.

(8)

zebrafish and vertebrates are partially conserved. Thus, for exam-ple, when we compared the molecular structures and expression patterns of tnni1 and tnni2 genes in truck and craniofacial muscles of zebrafish with those of TnnIs and TnnIf, respectively, of other vertebrates, we found that they were highly conserved. However, there were a highly difference between vertebrate TnnIc and zebra-fish tnni-HC, which was a unique isoform that has not been re-ported in mammals, amphibians, or avian homologues. This finding is particularly important in terms of cardiac development during embryogenesis because cardiac TnnI is commonly served as a specific marker of myocardial injury in acute coronary syn-dromes. Therefore, the present study lays the empirical ground-work for further study required to understand the biological function and the regulatory mechanism that explains TnnI muscle fiber diversification in lower vertebrates, in general, and how the tnni-HC gene switches its expression from heart to craniofacial muscles, in specific. From a larger perspective, such understanding will provide more insight into the evolutionary implications of TnnI genes in both lower and higher vertebrates.

2. Experimental procedures

2.1. Nucleic acids extraction and cDNA library synthesis

To obtain total RNA, zebraﬁsh embryos aged 48–72 hpf were collected and immediately stored in liquid nitrogen. The frozen embryos were homogenized with TRIzol reagent (Bio-Rad) and their total RNAs were extracted according to the manufacturer’s instructions. First strand cDNA was synthesized from 3 ng of total RNA using a SuperScript II (Invitrogen).

2.2. Molecular cloning of tnni cDNAs

To clone cDNA of zebraﬁsh tnni, degenerated primers were de-signed on the basis of the conserved polynucleotide sequences of

known EST clones or cDNA of tnni, such as the forward primer tnni-DF, G(T/G/C)(A/C/G)T(A/C/G)TC(G/T/A)GC(A/C/T)GA (T/C)GC (C/T) ATG, and a reverse primer tnni-DR, TTCTT(C/G/T)C(G/T) GCC(T/C) TCCAT(A/T/G)CC. Thirty-ﬁve cycles of PCR ampliﬁcation were performed by EXTaq DNA polymerase (Takara). Each cycle con-sisted of denaturation for 40 s at 94 °C, 1 min of annealing at 57 °C, and 30 s of extension at 72 °C. The last extension step was extended for 10 min at 72 °C. All PCR fragments were ligated with pGEM T-Easy vector (Promega) and transformed into Escherichia coli DH5

a

and sequenced.

2.3. Rapid amplifcation of cDNA ends (RACE)

To get the full-length cDNA, RACE was used by following the procedures described byChen et al. (2001). The 50_{- and 3}0_-RACE

were performed with zebraﬁsh-EST-speciﬁc primers. For 30_-RACE,

tnni1-F (ATGTCTGAGTCCCAGAGACC), tnni2-F (ATGTCAGAAAAAAA GAGGAC), tnni-HC-F (ATGCCCGAGCAAGAGAAAAA) were used; whereas, for 50_{-RACE, tnni1-R (TTATTGTCCAGCATCAAACA),}

tnni2-R (TTAAGCCTCGGACTCAAACA), tnni-HC-tnni2-R (TTATTGTGCT-GCATCAA ACA) were used. After ampliﬁcation, the PCR produces were sub-cloned and sequenced as described above.

2.4. Bioinformatics analysis of TnnI sequences

The EST database from NCBI (http://www.ncbi.nlm.nih.gov/) was used to search for sequence annotations indicative of possible homology to zebraﬁsh tnni. Nucleotide sequences were translated by using the sequence available through the BCM Search Launcher interface (http://searchlauncher.bcm.tmc.edu). Multiple sequence alignment of the deduced amino acid sequences of TnnI was per-formed using ClustalW (Thompson et al., 1994), and phylogenetic trees were constructed by using the neighbor-joining method ( Pear-son et al., 1999) through the EMBL–EBI interface ( http://www.ebi.a-c.uk/Tools/clustalw/). The accession numbers of sequences used in

Fig. 2andTable 1are GenBank Human-TnnIs: AAA61228, Rat-TnnIs: NP_058880, Mus-TnnIs: NP_067442, Xenopus-TnnIs: AAL86906, Human-TnnIf: AAH32148, Rat-TnnIf: P27768, Mus-TnnIf: NP_033431, Xenopus-TnnIf: AAL86905, Human-TnnIc: NM_ 000363, Rat-TnnIc: NM_017144, Mus-TnnIc: NM_009406, Xeno-pus-TnnIc: AAA65727, Ciona-(Heart): AAN87358, Ciona-(Body well): AAL27686, Salmo-TnnIf: NM_001123661, Herring-TnnIf: U20112.

2.5. RT-PCR analysis

To detect the spatial and temporal expressions of zebrafish tnni isoforms, RT-PCR was performed by using the different specific primers as described inSection 2.2above. The total RNAs were ex-tracted from embryos at 1, 4, 8, 10, 12, 14, 15, 16, 24 and 48 hpf. The primer pairs of tnni1-F and tnni1-R, tnni2-F and tnni2-R, and tnni-HC-F and tnni-HC-R were used to amplify cDNA fragments of 543, 540, and 530, respectively. In order to avoid the contamination from genomic DNA, we used RNase-free DNase I to digest the total extracted RNAs before RT-PCR was performed. Additionally, we de-signed primers, which are corresponding to the flanking intron 1, to serve as controls to amplify the contaminated genomic DNA such as tnni1-intron 1-F (GGAGAAACAGGTATGAACTATTGT-ACTATT) and tnni1-intron 1-R (TAGTCAAAATCTGAAATATAAAGA-TTGGTG); tnni2-intron 1-F (AGATGTCAGAGTAAGTATTCAGATGT-TTTG) and tnni2-intron 1-R (CATCTTTTTTCTGTTCATGAACATGA-GTTC); and tnni-HC-intron 1-F (AGCACTACAAGGTAAGTTC-ATTCTGTTTGC) and tnni-HC-intron 1-R (TGCTTCAACCTAAGGG-ATAAAAATA AAAGT). We used the amplification of zebrafish b-actin (Kelly and Reversade, 1997) to serve as an RNA quality control in each tissue sample.

Fig. 7. The tnni-HC transcript was expressed in the adult heart of zebraﬁsh. Embryos at 48 hpf were collected and hybridized with either antisense tnni-HC probe or sense tnni-HC probe using whole-mount in situ hybridization. Strong signal was observed in the heart of 48-hpf embryos when antisense probe was used (A), but no signal was observed for using sense probe (B). Adult heart was sectioned and also hybridized with either antisense probe or sense probe of tnni-HC. Like tnni-HC expression in embryos, positive signal was observed in the adult heart when antisense probe was used (C), but no signal was observed for using sense probe (D).

ARTICLE IN PRESS

(9)

2.6. WISH

WISH of whole embryos was performed by using digoxigenin (DIG)-labeled riboprobes of tnni1, tnni2 and tnni-HC. We followed the procedures as described byThisse and Thisse (2008). Stained embryos were placed in 100% glycerol and evaluated with a differ-ential interference contrast microscope (DMR, Leica) with a color digital camera (COOLPIX 996, Nikon) attached. For histological examination, some stained embryos were embedded in optimum cutting temperature compound and sectioned at 10-nm intervals.

Acknowledgement

This work was supported by the National Science Council, Republic of China, under Grant 96-2628-B-002-027-MY2.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, in the online version, atdoi:10.1016/j.gep.2009.02.001.

References

Baldwin Jr., A.S., Kittler, E.L., Emerson Jr., C.P., 1985. Structure, evolution, and regulation of a fast skeletal muscle troponin I gene. Proc. Natl. Acad. Sci. USA 82, 8080–8084.

Barton, P.J., Mullen, A.J., Cullen, M.E., Dhoot, G.K., Simon-Chazottes, D., Guenet, J.L., 2000. Genes encoding troponin I and troponin T are organized as three paralogous pairs in the mouse genome. Mamm. Genome 11, 926–929. Briggs, J.P., 2002. The zebraﬁsh: a new model organism for integrative physiology.

Am. J. Physiol. Regul. Integr. Comp. Physiol. 282, R3–9.

Chen, Y.H., Lee, W.C., Liu, C.F., Tsai, H.J., 2001. Molecular structure, dynamic expression, and promoter analysis of zebraﬁsh (Danio rerio) myf-5 gene. Genesis 29, 22–35.

Gorza, L., Ausoni, S., Merciai, N., Hastings, K.E., Schiafﬁno, S., 1993. Regional differences in troponin I isoform switching during rat heart development. Dev. Biol. 156, 253–264.

Grunwald, D.J., Eisen, J.S., 2002. Headwaters of the zebraﬁsh – emergence of a new model vertebrate. Nat. Rev. Genet. 3, 717–724.

Guenet, J.L., Simon-Chazottes, D., Gravel, M., Hastings, K.E., Schiafﬁno, S., 1996. Cardiac and skeletal muscle troponin I isoforms are encoded by a dispersed gene family on mouse chromosomes 1 and 7. Mamm. Genome 7, 13–15. Hastings, K.E., 1996. Strong evolutionary conservation of broadly expressed protein

isoforms in the troponin I gene family and other vertebrate gene families. J. Mol. Evol. 42, 631–640.

Hastings, K.E., Koppe, R.I., Marmor, E., Bader, D., Shimada, Y., Toyota, N., 1991. Structure and developmental expression of troponin I isoforms. cDNA clone analysis of avian cardiac troponin I mRNA. J. Biol. Chem. 266, 19659–19665. Head, J.F., Perry, S.V., 1974. The interaction of the calcium-binding protein (troponin

C) with bivalent cations and the inhibitory protein (troponin I). Biochem. J. 137, 145–154.

Hodgson, P.A., Leaver, M.J., George, S.G., MacLean, D.W., Hastings, K.E., 1996. Molecular cloning of troponin I expressed in fast white muscle of a teleost ﬁsh, the Atlantic herring (Clupea harengus L.). Biochim. Biophys. Acta 1306, 142–146. Horwitz, J., Bullard, B., Mercola, D., 1979. Interaction of troponin subunits. The interaction between the inhibitory and tropomyosin-binding subunits. J. Biol. Chem. 254, 350–355.

Huang, X., Lee, K.J., Riedel, B., Zhang, C., Lemanski, L.F., Walker, J.W., 2000. Thyroid hormone regulates slow skeletal troponin I gene inactivation in cardiac troponin I null mouse hearts. J. Mol. Cell Cardiol. 32, 2221–2228.

Jackman, D.M., Pham, T., Noel, J.J., Waddleton, D.M., Dhoot, G.K., Heeley, D.H., 1998. Heterogeneity of Atlantic salmon troponin-I. Biochim. Biophys. Acta 1387, 478– 484.

Kelly, G.M., Reversade, B., 1997. Characterization of a cDNA encoding a novel band 4.1-like protein in zebraﬁsh. Biochem. Cell Biol. 75, 623–632.

Koppe, R.I., Hallauer, P.L., Karpati, G., Hastings, K.E., 1989. cDNA clone and expression analysis of rodent fast and slow skeletal muscle troponin I mRNAs. J. Biol. Chem. 264, 14327–14333.

Koumans, J.T.M., Akster, H.A., 1995. Myogenic cells in development and growth of ﬁsh. Comp. Biochem. Physiol. 110A, 3–20.

MacLean, D.W., Meedel, T.H., Hastings, K.E., 1997. Tissue-speciﬁc alternative splicing of ascidian troponin I isoforms. Redesign of a protein isoform-generating mechanism during chordate evolution. J. Biol. Chem. 272, 32115– 32120.

Murphy, A.M., Jones 2nd, L., Sims, H.F., Strauss, A.W., 1991. Molecular cloning of rat cardiac troponin I and analysis of troponin I isoform expression in developing rat heart. Biochemistry 30, 707–712.

Parmacek, M.S., Leiden, J.M., 1991. Structure, function, and regulation of troponin C. Circulation 84, 991–1003.

Pearson, W.R., Robins, G., Zhang, T., 1999. Generalized neighbor-joining: more reliable phylogenetic tree reconstruction. Mol. Biol. Evol. 16, 806–816.

Perry, S.V., 1999. Troponin I: inhibitor or facilitator. Mol. Cell Biochem. 190, 9–32. Potter, J.D., Gergely, J., 1974. Troponin, tropomyosin, and actin interactions in the Ca2+ _regulation _of _muscle _contraction. _Biochemistry _13,

2697–2703.

Sabry, M.A., Dhoot, G.K., 1989. Identiﬁcation and pattern of expression of a developmental isoform of troponin I in chicken and rat cardiac muscle. J. Muscle. Res. Cell Motil. 10, 85–91.

Saggin, L., Gorza, L., Ausoni, S., Schiafﬁno, S., 1989. Troponin I switching in the developing heart. J. Biol. Chem. 264, 16299–16302.

Schiafﬁno, S., Gorza, L., Ausoni, S., 1993. Troponin isoform switching in the developing heart and its functional consequences. Trends Cardiovasc. Med. 3, 12–17.

Thisse, C., Thisse, B., 2008. High-resolution in situ hybridization to whole-mount zebraﬁsh embryos. Nat. Protoc. 3, 59–69.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-speciﬁc gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.

Toyota, N., Shimada, Y., 1981. Differentiation of troponin in cardiac and skeletal muscles in chicken embryos as studied by immunoﬂuorescence microscopy. J. Cell Biol. 91, 497–504.

Trimmer, J.S., Cooperman, S.S., Tomiko, S.A., Zhou, J.Y., Crean, S.M., Boyle, M.B., Kallen, R.G., Sheng, Z.H., Barchi, R.L., Sigworth, F.J., 1989. Primary structure and functional expression of a mammalian skeletal muscle sodium channel. Neuron 3, 33–49.

Wade, R., Eddy, R., Shows, T.B., Kedes, L., 1990. cDNA sequence, tissue-speciﬁc expression, and chromosomal mapping of the human slow-twitch skeletal muscle isoform of troponin I. Genomics 7, 346–357.

Warkman, A.S., Atkinson, B.G., 2002. The slow isoform of Xenopus troponin I is expressed in developing skeletal muscle but not in the heart. Mech. Dev. 115, 143–146.

Waterman, R.E., 1969. Development of the lateral musculature in the teleost, Brachydanio rerio: a ﬁne structural study. Am. J. Anat. 125, 457–493. Wilkinson, J.M., Grand, R.J., 1978. Comparison of amino acid sequence of troponin I

from different striated muscles. Nature 271, 31–35.

Wilkinson, J.M., Perry, S.V., Cole, H.A., Trayer, I.P., 1972. The regulatory proteins of the myoﬁbril. Separation and biological activity of the components of inhibitory-factor preparations. Biochem. J. 127, 215–228.

Zhu, L., Lyons, G.E., Juhasz, O., Joya, J.E., Hardeman, E.C., Wade, R., 1995. Developmental regulation of troponin I isoform genes in striated muscles of transgenic mice. Dev. Biol. 169, 487–503.

Zhu, L., Perez-Alvarado, G., Wade, R., 1994. Sequencing of a cDNA encoding the human fast-twitch skeletal muscle isoform of troponin I. Biochim. Biophys. Acta 1217, 338–340.