• 沒有找到結果。

Decreased expression of mitochondrial genes in human unfertilized oocytes and arrested embryos.

N/A
N/A
Protected

Academic year: 2021

Share "Decreased expression of mitochondrial genes in human unfertilized oocytes and arrested embryos."

Copied!
7
0
0

加載中.... (立即查看全文)

全文

(1)

Decreased expression of mitochondrial

genes in human unfertilized oocytes and

arrested embryos

Rong-Hong Hsieh, Ph.D.,a,bHeng-Kien Au, M.D.,cTien-Shun Yeh, Ph.D.,d Shu-Ju Chang, M.S.,cYu-Fei Cheng, M.S.,cand Chii-Ruey Tzeng, M.D.a,c Taipei Medical University and Taipei Medical University Hospital, Taipei, Taiwan

Objective: To evaluate the relationship between mitochondrial gene expression of oocytes/embryos and their fertilizability in unfertilized oocytes, arrested embryos, and tripronucleate zygotes, because both nuclear and cytoplasmic factors contribute to oocyte activation, fertilization, and subsequent development.

Design: Prospective laboratory research.

Setting: In vitro fertilization (IVF) laboratory in a university hospital.

Patient(s): Seventy-five unfertilized oocytes, 45 arrested embryos, and 24 tripronucleate (3PN) embryos from 45 female patients undergoing IVF.

Intervention(s): Analysis of mitochondrial gene expression by semiquantitative reverse transcription poly-merase chain reaction (RT-PCR).

Main Outcome Measure(s): Comparison of the expression levels of mitochondrial genes including ND2, CO I, CO II, ATPase 6, CO III, ND3, ND6, and Cyt b in three groups.

Result(s): Significantly decreased transcription levels were expressed in unfertilized oocytes and arrested embryos. The average expression levels of the eight determined genes compared with the control (GAPDH) was 4.4 ⫾ 0.7, 6.4 ⫾ 1.1, and 13.2 ⫾ 1.1 in unfertilized oocytes, arrested embryos, and 3PN embryos, respectively. Significantly decreased expressions of the ATPase 6, CO III, and ND3 genes were detected from samples with 4977-bp common deletion in the mitochondrial DNA (mtDNA) compared with the non-deletion group.

Conclusion(s): The present study is the first report to present globally decreased mitochondrial gene expression levels in human compromised oocytes and embryos. These data support the notion that the down-regulation of mitochondrial RNA by defective oxidative phosphorylation genes possibly affects oocyte quality including fertilization and further embryo development. (Fertil Steril威 2004;81(Suppl 1):912–18. © 2004 by American Society for Reproductive Medicine.)

Key Words: Embryo, mitochondrion, oocyte, RT-PCR

In eukaryotic cells, mitochondria are special organelles that are responsible for the synthesis of adenosine triphosphate (ATP). Two distinct ge-nomes exist in all eukaryotic cells. One is located in the nucleus and is transmitted in the mendelian fashion, and the other is located within the mito-chondria and is transmitted through maternal lin-eage. The respiratory chain comprises five

en-zyme complexes located on the inner

mitochondrial membrane. Complex I is the larg-est of these proteins with at least 26 polypeptides. The NAD-linked substrates feed reducing equiv-alents into the chain via complex I, which passes electrons down the chain to ubiquinone.

Complex II accepts reducing equivalents from succinate and subsequently passes

trons to ubiquinone. From ubiquinone, elec-trons pass to complex III, to cytochrome c, and then via cytochrome oxidase to oxygen. The electrochemical proton gradient that supplies the energy for complex V to generate ATP is produced by complexes I, III, and IV (1–3). Present in one or more copies in every mito-chondrion, mtDNA comprises a circular, his-tone-free molecule composed of 16.6 kb of DNA.

There are 13 protein subunits: NADH:u-biquinone oxidoreductase subunit 1 (ND1), ND2, ND3, ND4, ND4L, ND5, and ND6 of complex I; cytochrome b of complex III; cyto-chrome c oxidase subunit 1 (CO I), CO II, and CO III of complex IV; and subunits 6 and 8 of

Received July 28, 2003; revised and accepted November 18, 2003. Supported by research grants from the National Science Council of the R.O.C. (NSC 91-2320-B-038-026) and Taipei Medical University (TMU 90-Y05-A105 and TMU 91-Y05-A115). Presented at the 57th Annual Meeting of the American Society for Reproductive Medicine, Orlando, Florida, October 20 –25, 2001 (Program: O21).

Reprint requests: Chii-Ruey Tzeng, M.D., Department of Obstetrics and Gynecology, Taipei Medical University Hospital, 250 Wu-Hsing Street, Taipei, Taiwan 110, Republic of China (FAX: 886-2-28753877; E-mail: tzengcr@ tmu.edu.tw).

aCenter for Reproductive

Medicine and Sciences, Taipei Medical University.

bDepartment of Nutrition

and Health Sciences, Taipei Medical University.

cDepartment of Obstetrics

and Gynecology, Taipei Medical University Hospital.

dGraduate Institute of Cell

and Molecular Biology; Taipei Medical University.

FERTILITY AND STERILITY

VOL. 81, SUPPL. 1, MARCH 2004 Copyright ©2004 American Society for Reproductive Medicine Published by Elsevier Inc. Printed on acid-free paper in U.S.A.

0015-0282/04/$30.00 doi:10.1016/j.fertnstert.2003. 11.013

(2)

ATPase of complex V. They are required for oxidative phosphorylation of a total of about 83 subunits, with the remainder of 70 subunits being encoded by nuclear genes and imported into the mitochondrion. Also, mtDNA contains two ribosome subunits and 22 transfer RNAs. The oxidative phosphorylation capacity of mitochondria is determined by the interplay between nuclear and mitochondrial genes; mtDNA encodes 13 proteins that are all components of the respiratory chain, whereas nuclear DNA encodes the major-ity of the respiratory chain proteins, all proteins that regulate replication and transcription of mtDNA, as well as proteins necessary for the biogenesis of mitochondria(2).

The mitochondria in an oocyte must have produced and stored all the energy required for the resumption of meiosis II, fertilization, and development of the embryo (4 – 6). De-ficiencies in mitochondrial ATP production may be associ-ated with impairment of oocyte fertilization or retarded em-bryonic development at later stages(7, 8). When the mutant mtDNA accumulates to a significant level, a reduction in oxidative phosphorylation efficiency may occur (9, 10). In humans, germ-line cells are derived from primordial germ cells, which are conspicuous in the developing zygote by the third week after conception. Quiescent primordial follicles might not enter meiotic division for a period of up to 40 years, and therefore they are expected to accumulate abun-dant mutant mtDNA in oocytes which may be unable to produce enough energy because of a dysfunction in the oxidative phosphorylation system. Recent studies have shown that the accumulation of mtDNA deletions may con-tribute to mitochondrial dysfunction and the failure of em-bryonic development (8, 11, 12).

Furthermore, mitochondrial replication for maintenance of a proper amount of functional mitochondria, transcription for synthesis of mtRNA, and translation for mitochondrial biogenesis during oogenesis is crucial for successful fertili-zation and embryo development. We examined the expres-sion levels of eight mitochondrial genes, the ND2, CO I, CO II, ATPase 6, CO III, ND3, ND6, and Cyt b genes, in human unfertilized oocytes and abnormal embryos to determine whether decreased expression of mitochondrial genes possi-bly interferes with developmental capacity.

MATERIALS AND METHODS

Preparation of Oocytes

The Institutional Review Board of Taipei Medical Uni-versity Hospital approved the study we performed on oo-cytes and embryos discarded during an in vitro fertilization (IVF) program. Oocytes were obtained from patients who were recruited into an IVF-ET (embryo transfer) program. Ovarian stimulation was performed by desensitization by using a gonadotropin-releasing hormone agonist (GnRH-a) followed by treatment with gonadotropins (FSH and hMG). Ovulation was induced using hCG. Oocytes were then

re-trieved by transvaginal ultrasonography-guided aspiration 34 to 36 hours after hCG administration. Oocytes were insem-inated in vitro with spermatozoa for 16 to 18 hours and subsequently cultured in human tubal fluid (HTF; Irvine, Santa Ana, CA) supplemented with 10% human plasmanate

(8). Twenty hours after insemination, cumulus cells were mechanically removed, and oocytes were examined for the presence of pronuclei.

Unfertilized oocytes collected 48 hours after retrieval were prepared for evaluation of mitochondrial gene expres-sion. Abnormal embryos were harvested when embryos were arrested or severely fragmented at two to four blastomeres from unknown causative factors. Tripronucleate embryos obtained 18 to 24 hours after IVF were cultured until they were four to eight blastomeres and then were prepared for analysis. From 48 patients enrolled in the IVF procedures, 75 unfertilized oocytes were donated to our research. In addi-tion, 45 embryos that were abnormally arrested and 24 three-pronuclei (3PN) zygotes unsuitable for embryonic re-placement or cryopreservation were also donated and used for the following experiments.

Semiquantitative RT-PCR

Total RNA extracted from oocytes and embryos was used as templates and cDNA was prepared using the RNA ex-traction and reverse transcription polymerase chain reaction (RT-PCR) kit from Ambion (Austin, TX). The RT-PCR amplifications were performed with 3␮L of cDNA in a total volume of 50␮L of amplification buffer, 40 pmol of specific primers, and 2.5 units of Taq DNA polymerase (Life Tech-nologies, Grand Island, NY). The sequences of the oligonu-cleotide primers used in this study are listed as follows: ND2 (Forward, np5101-5120, TAACTACTACCGCATTCCTA; Reverse, np5400-5381, CGTTGTTAGATATGGGGAGT),

CO I (Forward, np7041-7060,

GTCCTATCAATAG-GAGCTGT; Reverse, np7340-7321, CTTCGAAGCG

AAGGCTTCTC), CO II (Forward, np7845-7864, CAGAC-GAGGTCAACGATCCC; Reverse, np8130-8111, GTTTG-GTTTAGACGTCCGGG), ATPase 6 (Forward, np8781-8800, CGGACTCCTGCCTCACTCAT; Reverse, np9090-9071, AGAGGGAAGGTTAATGGTTG), CO III (Forward, np9611-9630, CGTATTACTCGCATCAGGAG; Reverse,

np9908-9889, GCCAAAGTGATGTTTGGATG), ND3

(Forward, np9981-10000, TGAGGGTCTTACTCTTTTAG;

Reverse, np10300-10281, GTTTGTAGGGCTCATGG

TAG), ND6 (Forward, np14291-14310,

TCATAAATTAT-TCAGCTTCC; Reverse, np14579-14560,

TGATTGT-TAGCGGTGTGGTC), Cyt b (Forward, np15506-15525,

GACAATTATACCCTAGCCAA; Reverse,

np15800-15781, GTCCAATGATGGTAAAAGGG), and GAPDH (Forward, CCTTCATTGACCTCAAC; Reverse, AGTTGT-CATGGATGACC).

For semiquantitative amplification, each cycle was car-ried out at 92°C for 30 seconds, 58°C for 30 seconds, and 72°C for 60 seconds. The reactions were analyzed after 15,

(3)

20, 25, 30, 35, and 40 cycles to optimize the linear range of amplification. The PCR reactions were optimized with re-spect to annealing temperature and numbers of PCR cycles. Each PCR product was run through a 2% agarose gel and was visualized with ethidium bromide staining. Cycle-de-pendent amplification of the housekeeping GAPDH mRNA was almost identical in oocytes, arrested embryos, and 3PN embryos, which allowed semiquantitative comparison of mtDNA PCR products obtained with each sample by densi-tometric analysis. The relative expression levels of the PCR products were determined using an imaging desitometer, and results were expressed as a ratio of above eight genes divided by GAPDH.

Determination of the 4977-bp Deleted mtDNA

Oocytes and embryos were stored in 20 ␮L of 1⫻ PCR

buffer containing 0.05 mg/mL of proteinase K, 20 mM DTT, and 1.7␮M SDS. After digestion for 1 hour at 56°C and 10 minutes of heat-inactivation of proteinase K at 95°C, this template was then used in the PCR assays. The sequences of the oligonucleotide primers used in this study are listed as follows: H1 (np 8285-8304 CTCTAGAGCCCACTGTA-AAG) and L1 (np 13650-13631 GGGGAAGCGAGGTT-GACCTG). The mtDNA was amplified in a 100-␮L reaction volume containing a final concentration of 1.5 mM MgCl2, 1

mM dNTPs, 20 pmol of each primer, and 1.5 IU Taq poly-merase (Life Technologies). Then the following amplifica-tion profile was used: 1 cycle of 95°C for 5 minutes; 35 cycles of 95°C for 40 seconds, 58°C for 40 seconds, 72°C for 6 minutes, and 1 cycle of 72°C for 7 minutes, then the mixture was kept at 4°C (8).

The PCR products were examined by agarose gel elec-trophoresis in which 8␮L of PCR products was separated on a 1.5% agarose gel and stained with ethidium bromide. The PCR products were cloned into a pGEM-T vector (Promega, Madison, WI). We performed DNA sequencing using the Dye Terminator cycle sequencing kit (Applied Biosystems, Foster, CA). Sequencing reactions were read on an ABI Prism Model 377 cycle sequencer (Applied Biosystems).

Statistical Analysis

All experiments were repeated at least three times. An ANOVA analysis was used to test statistically significant differences (P⬍.05) between experimental groups.

RESULTS

Transcript levels of the ND2, CO I, CO II, ATPase 6, CO III, ND3, ND6, and Cyt b genes in oocytes and embryos were determined. To measure the relative expression levels of oxidative phosphorylation genes in each oocyte or em-bryo, semiquantitative RT-PCR was performed on total RNA extracted from unfertilized oocytes, arrested embryos, and tripronucleate embryos. The PCR products of 15, 20, 25, 30, 35, and 40 cycles were analyzed to determine the optimal amplification conditions for RT-PCR reactions. Twenty cy-cles were necessary to visualize the ND2 PCR product of the expected size (300 bp). Performing additional cycles en-hanced DNA amplification without the appearance of any other band, arguing in favor of the specificity of the reaction (Fig. 1A). As expected, no PCR product was observed after 40 amplification cycles in the control reaction without cDNA by reverse transcription.

The expression levels of all eight examined mitochondrial genes and the GAPDH gene were determined by densito-metric analysis of RT-PCR products (seeFig. 1B). To obtain the relative expression levels of the eight genes, each of them was followed by normalization to the GAPDH gene. Sam-ples were collected into three groups according the develop-ment stage of oocytes and embryos. We collected 16, 9, and 6 cohorts of unfertilized oocytes, arrested embryos, and tripronucleate zygotes, respectively, with each cohort includ-ing three oocytes or embryos from the same donor. The normalized expression ratios of the eight different genes in each sample are presented inTable 1.

These eight gene transcription levels remained at similar levels in the same groups, with no statistically significant differences among analyzed genes in each cohort. However, there were statistically significant decreases in transcript levels expressed in unfertilized oocytes and arrested em-bryos compared with 3PN emem-bryos. The mean ratios of the T A B L E 1

Expression ratios of oxidative phosphorylation genes in mtDNA in unfertilized oocytes, arrested embryos, and 3PN embryos compared with GAPDH.

Group ND2 COI COII ATPase6 COIII ND3 ND6 Cyt b Average

Unfertilized 4.5⫾ 0.6a 4.6⫾ 0.7a 4.7⫾ 0.8a 4.0⫾ 1.0a 3.9⫾ 0.8a 3.8⫾ 0.7a 4.6⫾ 0.5a 4.8⫾ 0.7a 4.4⫾ 0.7 Arrested 6.9⫾ 1.2a 6.9⫾ 0.6a 6.3⫾ 1.1a 5.8⫾ 1.4a 5.5⫾ 1.7a 5.9⫾ 1.4a 7.1⫾ 1.4a 6.9⫾ 0.7a 6.4⫾ 1.1 3PN 13.1⫾ 1.1b 12.5⫾ 0.8b 13.1⫾ 0.9b 13.7⫾ 1.3b 13.1⫾ 1.1b 12.9⫾ 1.8b 13.7⫾ 0.6b 13.2⫾ 0.8b 13.2⫾ 1.1

Note: Data are presented as mean⫾ SEM.

a,bValues with different superscripts denotes statistically significant difference (P⬍.05; ANOVA).

(4)

expression of the eight different genes was 4.4⫾ 0.7, 6.4 ⫾ 1.1, and 13.2 ⫾ 1.1 in unfertilized, arrested, and 3PN em-bryos, respectively (seeTable 1).

In our previous study, the 4977-bp rearranged mtDNA was commonly observed to exist in oocytes and embryos, and resulted in compromised developmental capacity(8). To examine whether rearranged mtDNA in oocytes and

em-bryos affects expression levels of mtDNA genes, mitochon-drial RNA expression was also classified according to sam-ples with or without the 4977-bp deletion (Table 2). The frequencies of 4977-bp mtDNA were 62.7%, 31.1%, and 20.8% in unfertilized oocytes, arrested embryos, and 3PN embryos, respectively. In a comparison of cohorts with and these without the 4977-bp deletion, there were statistically F I G U R E 1

(A) Optimal amplification cycles of RT-PCR. After reverse transcription of total RNA from oocytes, the ND2 transcript was amplified with 15, 20, 25, 30, 35, and 40 cycles. (B) Semiquantitation of mitochondrial RNAs by RT-PCR. Lanes 1 to 9 represent the PCR products of the ND2, CO I, CO II, ATPase 6, CO III, ND3, ND6, Cyt b, and GAPDH genes.

Hsieh. mtRNA expression in human zygotes. Fertil Steril 2004.

T A B L E 2

Expression ratios of oxidative phosphorylation genes in mtDNA with or without 4977-bp deletion in unfertilized oocytes, arrested embryos, and 3PN embryos compared with GAPDH.

Group ND2 CO I CO II ATPase 6 CO III ND3 ND6 Cyt b

Unfertilized oocyte

With 4977 bp deleted mtDNA 4.5⫾ 0.7a 5.0⫾ 0.7a 4.6⫾ 1.0a 2.6⫾ 1.0c 2.6⫾ 0.9c 2.5⫾ 0.6c 4.7⫾ 0.4a 5.0⫾ 0.7a Without 4977 bp deleted mtDNA 4.4⫾ 0.6a 4.2⫾ 0.7a 4.8⫾ 0.5a 4.5⫾ 0.9a 4.3⫾ 0.7a 4.2⫾ 0.6a 4.5⫾ 0.6a 4.6⫾ 0.7a Arrested embryo

With 4977 bp deleted mtDNA 7.7⫾ 0.4a 6.9⫾ 0.7a 6.3⫾ 0.5a 4.1⫾ 0.6c 3.6⫾ 0.6c 4.4⫾ 0.6c 6.4⫾ 0.3a 7.1⫾ 1.1a Without 4977 bp deleted mtDNA 6.5⫾ 1.3a 6.9⫾ 0.5a 6.3⫾ 1.4a 6.6⫾ 0.6a 6.5⫾ 1.1a 6.7⫾ 0.9a 7.4⫾ 1.6a 6.8⫾ 0.6a Tripronucleate embryo

With 4977 bp deleted mtDNA 13.9⫾ 0.9b 13.4⫾ 0.1b 13.0⫾ 1.8b 14.8⫾ 0.6b 13.5⫾ 2.3b 14.3⫾ 0.6b 13.9⫾ 0.9b 12.9⫾ 0.4b Without 4977 bp deleted mtDNA 12.7⫾ 1.0b 12.0⫾ 0.6b 13.1⫾ 0.5b 13.1⫾ 1.3b 13.0⫾ 0.5b 12.2⫾ 1.8b 13.6⫾ 0.6b 13.4⫾ 1.0b

Note: Data are presented as mean⫾ SEM.

a,b,cValues with different superscripts denotes statistically significant difference (P⬍ .05; ANOVA).

(5)

significant decreases in RNA expressions of the ATPase 6, CO III, and ND 3 genes in unfertilized oocytes and arrested embryos harboring the 4977-bp deletion. However, there were no differences in 3PN embryos with or without the 4977-bp deletion (Fig. 2).

DISCUSSION

Unknown factors causing oocytes to remain unfertilized and abnormal embryo development may be related to cyto-plasmic defects of the oocytes. In particular, the organization and continued metabolic activity of mitochondria are neces-sity for cytoplasmic maturation and resumption of meiosis

(7, 13). Accumulation of mtDNA mutation, decreased mtDNA copy number, and decreased mtRNA expression reflecting mitochondrial defects may compromise the matu-ration of oocytes. The 4977-bp deletion, the most common mtDNA deletion associated with human aging processes, is found in oocytes and embryos (8, 14, 15). In this study, the frequencies of 4977-bp mtDNA were 62.7%, 31.1%, and 20.8% in unfertilized oocytes, arrested embryos, and 3PN embryos, respectively. The results similar with our previous report, the frequencies of 66.1% in unfertilized oocytes, 34.8% in arrested embryos, and 21.1% in tripronucleate (3PN) embryos (8).

There was a statistically significant increase in the pro-portion of deleted mtDNA in unfertilized oocytes. Accumu-lation of mtDNA deletions may contribute to mitochondrial dysfunction and impaired ATP production, and may also interfere with fertilization of human oocytes and subsequent

embryonic development(8, 11). Frequencies of the 4977-bp deleted mtDNA in oocytes have also been determined and reported by other studies(11, 16, 17). The 4977-bp deletion causes the removal of major structural genes containing ATPase 6 and 8, cytochrome oxidase III, and NADH-CoQ oxidoreductase (ND3, ND4, ND4L, and ND5) (seeFig. 2). The deleted genes in this rearranged mtDNA may result in impaired gene expression by decreasing the expression of corresponding genes in H strand of circular mtDNA.

This deletion also creates a chimeric gene, which fuses the 5⬘-portion of ATPase 8 and the 3⬘-portion of ND5 genes of mtDNA. Therefore, the deleted or truncated genes in this rearranged mtDNA may result in decreasing the expression of the deleted genes by producing tran-scripts of fused genes. In this study we demonstrated that lower expression levels of ATPase6, CO III, and ND3 genes in unfertilized oocytes and arrested embryos with the 4977-bp deleted mtDNA were significant than other genes outside of the deleted region. The decreased tran-scription reflected rearranged mtDNA in unfertilized oo-cytes and arrested embryos. However, compensatory tran-scription may take place in 3PN zygotes with rearranged mtDNA. There was not statistically significant decrease in expression levels in 3PN zygotes with or without the 4977-bp deletion in mtDNA, indicating the sperm factor plays an important role in 3PN formation.

Piko and Taylor (4) reported that mouse mitochondrial DNA does not replicate during preimplantation development but is transcribed actively from the two-cell stage. There is about a 30-fold rise during cleavage through the blastocyst F I G U R E 2

The relationship between defective mtDNA gene expression in oocytes and embryos with common 4977-bp deletion.

(6)

stage (18). To date, there is no experimental data to show mitochondrial expression levels in different stages of human embryos. Increased expression of mtDNA will accompany with embryo development, and lower transcription ability may interfere with oocyte fertilization or embryo devel-opment. Because amounts of RNA in single oocytes or embryos were too low to determine the expression level of specific genes by Northern blotting, in this study cohorts of every three oocytes or embryos were lysed to harvest total RNA and determine the semiquantitative expression level of RNA by RT-PCR. To rule out limitations of RT-PCR, various replication cycles were decided to iden-tify the optimal cycles with RT-PCR products in a linear range. The average expression proportions (mean⫾ SEM) of the eight studied genes compared with the control was 4.4 ⫾ 0.7, 6.4 ⫾ 1.1, and 13.2 ⫾ 1.1 in unfertilized oocytes, arrested embryos, and 3PN embryos, respec-tively.

The ND2, CO I, CO II, ATPase 6, CO III, ND3, ND6, and Cyt b gene transcription levels remained at similar levels in the same groups. The mtDNA transcripts are polycistronic

(19, 20), which means that each gene is separated following precise endonucleolytic excision of the tRNAs from the nascent transcripts. Although different mtDNA transcripts encode different protein assemblies to one of five mitochon-drial complexes, in our study the expression levels of the eight genes were similar in unfertilized oocytes, arrested embryos, and tripronucleate zygotes. The polycistronic mtDNA transcripts are consistent, with different mtRNA expression levels showing the same pattern in the same oocyte. The lower expression level representing the overall defective transcription was observed in unfertilized oocytes. There was a higher expression level in 3PN embryos com-pared with unfertilized oocytes and arrested embryos. In this study, arrested or severely fragmented embryos were col-lected at the two-cell to four-cell stage, and 3PN zygotes were collected at the four-cell to eight-cell stage with normal growth rates.

In normal embryonic development, the stage with two to four blastomeres may have more than twice the expression level of mtRNA compared with unfertilized oocytes. In fact, mitochondrial transcription appeared to be hampered from unfertilized oocytes to the four-cell stage of the examined arrested embryos, and hence there was no statistically sig-nificant difference in expression levels between unfertilized oocytes and arrested embryos in this study. Oocytes with intact mtDNA resumed with transcription may correlate with sufficient production of ATP. Differences in the amount of ATP generated by mature human oocytes may be related to the fertilization potential and developmental competence of an embryo(7).

There was almost a threefold higher expression level of the oxidative phosphorylation subunits in 3PN zygotes com-pared with unfertilized oocytes. Mitochondrial RNA

expres-sion did not seem to be modified in embryos developed with abnormal 3PN. The existence of 3PN would be normal fertilization by a single injected spermatozoon along with the nonextrusion of a second polar body or merely a polyspermy

(21, 22). In addition, injection with the cytoplasm of 3PN zygotes may enhance the clinical pregnancy rate in patients with repeated implantation failure (23). This implies that 3PN zygotes may have sufficient amounts of mtDNA con-tent and mtDNA transcripts for embryo development. Our report does not contradict the contention that decreased expression levels of the ATPase 6 gene in unfertilized oo-cytes compared with early cleavage-stage 3PN embryos

(24).

In conclusion, the current study is the first report to present globally decreased mitochondrial gene expression levels in human compromised oocytes and embryos. These data support the notion that the down-regulation of mito-chondrial RNA possibly affects oocyte fertilization and em-bryo development.

References

1. Wei YH. Mitochondrial DNA alterations as ageing-associated molec-ular events. Mutat Res 1992;275:145–55.

2. Taanman JW. The mitochondrial genome: structure, transcription, translation and replication. Biochim Biophys Acta 1999;1410:103–23. 3. Garesse R, Vallejo CG. Animal mitochondrial biogenesis and function: a regulatory cross-talk between two genomes. Gene 2001;263:1–16. 4. Piko L, Taylor KD. Amounts of mitochondrial DNA and abundance of

some mitochondrial gene transcripts in early mouse embryos. Dev Biol 1987;123:364 –74.

5. Ebert KM, Liem H, Hecht NB. Mitochondrial DNA in the mouse preimplantation embryo. J Reprod Fertil 1988;82:145–9.

6. Meirelles FV, Smith LC. Mitochondrial genotype segregation during preimplantation development in mouse heteroplasmic embryos. Genet-ics 1998;148:877–83.

7. Van Blerkom J, Davis PW, Lee J. ATP content of human oocytes and developmental potential and outcome after in-vitro fertilization and embryo transfer. Hum Reprod 1995;10:415–24.

8. Hsieh RH, Tsai NM, Au HK, Chang SJ, Wei YH, Tzeng CR. Multiple rearrangements of mitochondrial DNA in unfertilized human oocytes. Fertil Steril 2002;77:1012–7.

9. Richter C, Park J, Ames BN. Normal oxidative damage to mitochon-drial and nuclear DNA is extensive. Proc Natl Acad Sci USA 1988;85: 6465–7.

10. Hattori K, Tanaka M, Sugiyama S, Obayashi T, Ito T, Satake T, et al. Age-dependent increase in deleted mitochondrial DNA in the human heart: possible contributory factor to presbycardia. Am Heart J 1991; 121:1735–42.

11. Brenner CA, Wolny YM, Barritt JA, Matt DW, Munne S, Cohen J. Mitochondrial DNA deletion in human oocytes and embryos. Mol Hum Reprod 1998;4:887–92.

12. Perez GI, Trbovich AM, Gosden RG, Tilly JL. Mitochondria and the death of oocytes. Nature 2000;403:500 –1.

13. Cummins J. Mitochondrial DNA in mammalian reproduction. Rev Reprod 1998;3:172–82.

14. Hsieh RH, Hou JH, Hsu HS, Wei YH. Age-dependent respiratory function decline and DNA deletions in human muscle mitochondria. Biochem Mol Biol Int 1994;32:1009 –22.

15. Fahn HJ, Wang LS, Hsieh RH, Chang SC, Kao SH, Huang MH, et al. Age-related 4,977 bp deletion in human lung mitochondrial DNA. Am J Respir Crit Care Med 1996;154:1141–5.

16. Chen X, Prosser R, Simonetti S, Sadlock J, Jagiello G, Schon EA. Rearranged mitochondrial genomes are present in human oocytes. Am J Hum Genet 1995;57:239 –47.

17. Keefe DL, Niven-Fairchild T, Powell S, Buradagunta S. Mitochondrial deoxyribonucleic acid deletions in oocytes and reproductive aging in women. Fertil Steril 1995;64:577–83.

18. Taylor KD, Piko L. Mitochondrial biogenesis in early mouse embryos: expression of the mRNAs for subunits IV, Vb, and VIIc of cytochrome c oxidase and subunit 9 (P1) of H(⫹)-ATP synthase. Mol Reprod Dev 1995;40:29 –35.

(7)

19. Montoya J, Christianson T, Levens D, Rabinowitz M, Attardi G. Identification of initiation sites for heavy-strand and light-strand tran-scription in human mitochondrial DNA. Proc Natl Acad Sci USA 1982;79:7195–9.

20. Montoya J, Gaines GL, Attardi G. The pattern of transcription of the human mitochondrial rRNA genes reveals two overlapping transcrip-tion units. Cell 1983;34:151–9.

21. Van Steirteghem AC, Nagy Z, Joris H, Liu J, Staessen C, Smitz J, et al. High fertilization and implantation rates after intracytoplasmic sperm injection. Hum Reprod 1993;8:1061–6.

22. Grossmann M, Calafell JM, Brandy N, Vanrell JA, Rubio C, Pellicer A, et al. Origin of tripronucleate zygotes after intracytoplasmic sperm injection. Hum Reprod 1997;12:2762–5.

23. Huang CC, Cheng TC, Chang HH, Chang CC, Chen CI, Liu J, et al. Birth after the injection of sperm and the cytoplasm of tripronucleate zygotes into metaphase II oocytes in patients with repeated implantation failure after assisted fertilization procedures. Fertil Steril 1999;72:702–6. 24. Lee SH, Han JH, Cho SW, Cha KE, Park SE, Cha KY. Mitochondrial ATPase 6 gene expression in unfertilized oocytes and cleavage-stage embryos. Fertil Steril 2000;73:1001–5.

參考文獻

相關文件

The results of the present study revealed that ten cases out of thirteen of RCs (76.9%) showed immunopositive expression of laminin-1 at the basement membrane zone of the

The present proteomic technologies for the comprehensive identification of the proteins and peptides in human whole saliva and the progress being made in identifying potential

Human papillomavirus- related squamous cell carcinoma of the oropharynx: a comparative study in whites and African Americans. Prevalence of human papillomavirus type 16 DNA in

Central granular cell odontogenic tumour, report of the first malignant case and review of the literature. Human leucocyte antigen typing in

Background: The purpose of this study was to evaluate the immunohistochemical expression of NF-κB and IL-6 in oral premalignant and malignant lesions and to

When case 2 in the present report is compared with those cases, the common findings are symptoms in relation to the condyle, absence of suppuration in relation to the

In the present case, serum levels of phosphate and calcitriol as well as the tubular phosphate reabsorption become normal in 1 week after surgical removal of the tumor.. However,

In conclusion, data from the present study demonstrat- ed that signs of carotid calcifications in panoramic radio- graphs are associated with future events of stroke and/or