Gallic acid inhibits migration and invasion in human osteosarcoma U-2 OS cells through suppressing the matrix metalloproteinase-2/-9, protein kinase B (PKB) and PKC signaling pathways

(1)

Gallic acid inhibits migration and invasion in human osteosarcoma U-2 OS

cells through suppressing the matrix metalloproteinase-2/-9, protein

kinase B (PKB) and PKC signaling pathways

Ching-Lung Liao

a

, Kuang-Chi Lai

b,c

, An-Cheng Huang

d

, Jai-Sing Yang

e

, Jen-Jyh Lin

a,f

,

Shin-Hwar Wu

g

, W. Gibson Wood

h

, Jaung-Geng Lin

a,

⇑

,1

, Jing-Gung Chung

i,j,

⇑

,1 a_{Graduate Institute of Chinese Medicine, China Medical University, Taichung 404, Taiwan, ROC}

b

School of Medicine, China Medical University, Taichung 404, Taiwan, ROC c

Department of Surgery, China Medical University Beigang Hospital, Yunlin 651, Taiwan, ROC d

Department of Nursing, St. Mary’s Medicine Nursing and Management College, Yilan 266, Taiwan, ROC e

Department of Pharmacology, China Medical University, Taichung 404, Taiwan, ROC f

Division of Cardiology, China Medical University Hospital, Taichung 404, Taiwan, ROC

g_{Division of Critical Care Medicine, Department of Internal Medicine, Changhua Christian Hospital, Changhua 500, Taiwan, ROC}

h_{Department of Pharmacology, University of Minnesota, School of Medicine, Geriatric Research, Education and Clinical Center, VA Medical Center, Minneapolis, MN 55455, USA} i

Department of Biological Science and Technology, China Medical University, Taichung 404, Taiwan, ROC j

Department of Biotechnology, Asia University, Taichung 413, Taiwan, ROC

a r t i c l e

i n f o

Article history: Received 7 July 2011 Accepted 15 February 2012 Available online 25 February 2012

Keywords: Gallic acid

Migration and invasion

Human osteosarcoma U-2 OS cells MMP-2/-9

AKT/PKB PKC

a b s t r a c t

Advanced cancer is a multifactorial disease which complicates treatment if the cancer cells have metas-tasized calling for the targeting of multiple cellular pathways. Gallic acid (GA) is known to possess multi-ple pharmacological activity including antitumor effects. This study investigated the mechanisms for the anticancer properties of GA on migration and invasion of human osteosarcoma U-2 OS cells. The migra-tion and invasion in U-2 OS cells were determined by a Boyden chamber transwell assay. The expression levels and activities of MMP-2 and MMP-9 were measured by Western blotting, real-time PCR and gelatin zymography assays. All examined proteins levels from Western blotting indicated that GA decreased the protein levels of GRB2, PI3K, AKT/PKB, PKC, p38, ERK1/2, JNK, NF-

j

B p65 in U-2 OS cells. GA also inhibited the activities of AKT, IKK and PKC by in vitro kinase assay. GA suppressed the migration and invasive abil-ity of U-2 OS cells, and it decreased MMP-2 and MMP-9 protein and mRNA levels and secreted enzyme activities in vitro. These results suggest that potential signaling pathways of GA-inhibited migration and invasion in U-2 OS cells may be due to down-regulation of PKC, inhibition of mitogen-activated protein kinase (MAPK) and PI3K/AKT, resulting in inhibition of MMP-2 and MMP-9 expressions.

1. Introduction

Bone cancer morbidity and mortality is a signiﬁcant problem

worldwide (

Wermers et al., 2008

). Osteosarcoma, a highly

malig-nant bone tumor, characterized by formation of neoplastic bone

tissue, is the most frequent malignant bone tumor in children

and adolescents (

Arndt and Crist, 1999; Thompson et al., 2002

).

Currently, treatment of bone cancer includes surgery, radiation,

chemotherapy, or a combination of radiotherapy and

chemother-apy, but such treatments are not overly successful. Numerous

evi-dence has shown that natural products can be used to inhibit the

development of cancer in multiple animal models (

Hong and

Sporn, 1997

). These compounds can be used as antioxidants and

cancer preventative agents or even as cancer therapy drugs

Abbreviations: AKT/PKB, RAC-alpha serine/threonine-protein kinase; ERK1/2, extracellular signal-regulated kinase 1/2; GRB2, growth factor receptor-bound protein 2; GA, gallic acid; JNK, c-Jun N-terminal kinase; IKK, I

j

B kinase; MAPK, mitogen-activated protein kinase; MMPs, matrix metalloproteinases; PI3K, phosphoinositide 3-kinase; PKC, protein kinase C.

⇑

Corresponding authors. Addresses: Department of Biological Science and Technology, China Medical University, No. 91, Hsueh-Shih Road, Taichung 40402, Taiwan, ROC. Tel.: +886 4 2205 3366x2500; fax: +886 4 2205 3764 (J.G. Chung); Graduate Institute of Chinese Medicine, China Medical University, No. 91, Hsueh-Shih Road, Taichung 40402, Taiwan, ROC. Tel.: +886 4 2205 3366x3311; fax: +886 4 2203 5192 (J.G. Lin).

E-mail addresses:[email protected](J.-G. Lin),[email protected](J.-G. Chung). 1 _{Both authors contributed equally to study.}

Contents lists available at

SciVerse ScienceDirect

Food and Chemical Toxicology

(2)

(

AbouEl Hassan et al., 2006

). One of the major characteristics of

cancer cell metastasis is altered adhesion ability between cells

and the extracellular matrix (ECM) which is associated with

inva-sion and migration of tumor cells. In the metastasis of tumor cells,

matrix metalloproteinases (MMPs) and urokinase plasminogen

activator (u-PA) are overexpressed (

Farris et al., 2011

), and MMPs

have been shown to be involved in the invasion and metastasis of

various tumor cells (

Gullu et al., 2000; Mizutani et al., 2000

). The

inhibition of MMP expression or enzyme activity can be used as

early targets for preventing cancer metastasis (

Guruvayoorappan

and Kuttan, 2008; Waas et al., 2003

).

Gallic acid (3,4,5-trihydroxybenzoic acid; GA), a

polyhydroxy-phenolic compound, is abundant in natural plants such as gallnut,

grapes, sumach, oak bark, green tea apple peels, grapes,

strawber-ries, pineapples, bananas, lemons, and in red and white wine

(

Atkinson et al., 2004; Chakraborty et al., 2009; Kim et al., 2006;

Ng et al., 2004; Shahrzad et al., 2001

). GA has biological activities

such as anti-bacterial (

Kang et al., 2008

), anti-viral (

Kaur et al.,

2009

), anti-inﬂammatory (

Kim et al., 2006

), antioxidant (

Inoue

et al., 1994; Isuzugawa et al., 2001

) and antitumor effects (

Agarwal

et al., 2006; Faried et al., 2007; Ji et al., 2009; Kawada et al., 2001;

Veluri et al., 2006

). Other beneﬁcial actions of GA are anti-diabetic

and anti-angiogenic effects nuclear factor

kappa-light-chain-en-hancer of activated B cells (NF-

j

B) activity through modulating

the levels of MMP-2/9 and cytoskeletal reorganization signal

path-way in gastric cancer cells (

Ho et al., 2010

). Although GA was found

to inhibit the migration and invasion of osteosarcoma cells, the

possible molecular mechanisms are unclear and not well

investi-gated. Thus, the purpose of this study was to determine the

anti-metastatic effects and signaling pathways of GA in the

osteo-sarcoma cell line (U-2 OS) in vitro.

2. Materials and methods

2.1. Chemicals and reagents

Gallic acid (GA), dimethyl sulfoxide (DMSO), propidium iodide (PI) and trypan blue were purchased from Sigma–Aldrich Corp. (St. Louis, MO, USA). McCoy’s 5A medium,L-glutamine, fetal bovine serum (FBS), penicillin–streptomycin, and tryp-sin–EDTA were obtained from Invitrogen Life Technologies (Carlsbad, CA, USA). Pri-mary antibodies used for Western blotting analysis were obtained as follows: antibodies for growth factor receptor-bound protein 2 (GRB2), phosphoinositide ki-nase-3 (PI3K), AKT, PKC, p38, extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun N-terminal kinase (JNK), NF-

j

B p65, MMP-2, MMP-9, p-p38, p-ERK1/2, p-JNK and

a

-tubulin, and second antibodies were purchased from Santa Cruz Biotechnol-ogy Inc. (Santa Cruz, CA, USA).

2.2. Cell culture

The human osteosarcoma U-2 OS cell line was obtained from the Food Industry Research and Development Institute (Hsinchu, Taiwan). U-2 OS cells were plated onto 75 cm2

tissue culture ﬂasks with 90% McCoy’s 5A medium. All cell media were supplemented with 2 mM L-glutamine, 10% FBS, 100 Units/ml penicillin and 100

l

g/ml streptomycin and grown at 37 °C under a humidiﬁed 5% CO2atmosphere (Chen et al., 2011b; Huang et al., 2010).

2.3. Determination of cell viability and

Approximately 2 105_{cells/well of U-2 OS cells were grown in 12-well plates} and then were incubated with 5, 10, 20 and 40

l

M GA or 0.5% DMSO (as a vehicle control) for 24 and 48 h. Cells were harvested by centrifugation. For viability deter-mination, cells were stained with PI (5

l

g/ml) and then analyzed using a PI exclu-sion method by ﬂow cytometry (BD Biosciences, FACSCalibur, San Jose, CA, USA) as previously described (Chen et al., 2010; Lu et al., 2010).

2.4. Detection of cell number

Cells at a density of 2.5 105

were seeded in 12-well plates and then exposed to 5, 10, 20 and 40

l

M GA or 0.5% DMSO (as a vehicle control) for 24 and 48 h. Cells were harvested and determined cell number using trypan blue stain by Countess Automated Cell Counter (Invitrogen/Life Technologist) (Chen et al., 2011a; Duan et al., 2011).

2.5. In vitro migration and invasion assays

The determinations of migration or invasion in U-2 OS cells was performed through 24-well Transwell inserts (8

l

m pore ﬁlters; Millipore, Billerica, MA, USA) coated with 30

l

g type I collagen (Millipore) (migration assay) or Matrigel (BD Biosciences, Bedford, MA, USA) (invasion assay), respectively (Chen et al., 2010; Liu et al., 2011). Initially, U-2 OS cells were cultured for 24 h in serum-free-McCoy’s 5A medium and then cells were placed in the upper chamber of the trans-well insert (2 104

cells/0.4 ml medium) and treated with 0.5% DMSO (as a control) or GA (20 or 40

l

M) for 24 or 48 h. The medium containing 10% FBS was then placed in the lower chamber. A cotton swab was used to remove the non-migrated and in-vaded cells maintained in the upper chamber and the invasive cells were fixed with 4% formaldehyde and stained with 2% crystal violet. Finally, the cells in the lower surface of the filter which penetrated were counted and photographed under a phase-contrast microscope at 200 magnification. Each sample was analyzed duplicates of each treatment including the control and treated conditions were in-cluded and three independent experiments were performed as described elsewhere (Chen et al., 2010; Liu et al., 2011).

2.6. Gelatin zymography assay

Determination of the enzyme activities of MMP-2 and -9 in U-2 OS cells were measured after exposure to GA. U-2 OS cells (1 106

cells/well) were plated in 12-well tissue culture plates and then were incubated in serum-free McCoy’s 5A medium in the presence of 0, 10, 20, 30 and 40

l

M GA for 24 and 48 h. The condi-tioned medium was then collected and was separated by electrophoresis on 10% SDS–PAGE containing 0.2% gelatin (Sigma–Aldrich Corp.). At the end of electropho-resis, the gels were soaked in 2.5% Triton X-100 in dH2O twice for a total of 60 min at 25 °C, then were incubated in substrate buffer (50 mM Tris HCl, 5 mM CaCl2, 0.02% NaN3and 1% triton X-100, pH 8.0) at 37 °C for 18 h. Bands corresponding to activity of MMP-2 and -9 were visualized by negative staining using 0.2% Coo-massie blue in 50% methanol and 10% acetic acid as described elsewhere (Lai et al., 2010; Liu et al., 2011). The NIH ImageJ software was applied to quantify these bands as previously described (Chiang et al., 2011; Wen et al., 2010).

2.7. Western blotting analysis

U-2 OS cells (1 106

cells/well) were placed in 6-well plates and incubated with GA (20 or 40

l

M) for 24 h. Total protein amount was determined using a Bio-Rad protein assay kit (Bio-Rad Laboratories, Hercules, CA, USA) before being ex-tracted with the PRO-PREP™ protein extraction solution (iNtRON Biotechnology, Seongnam, Gyeonggi-Do, Korea) according to the manufacturer’s protocol. Protein

Time of incubation (h) 24 48 0 50 100 150 200

*

A

B

0 μM 5 μM 10 μM 20 μM 40 μM 0.0 2.0 4.0 6.0 8.0 10.0 12.0 0 24 48 Time of incubation (h) 5 0 mM 5 mM 10 mM 20 mM 40 mM 0 μM 5 μM 10 μM 20 μM 40 μM

Fig. 1. GA affected on percentage of viable cells and cell number in U-2 OS cells in vitro. Cells were placed in 90% McCoy’s 5A medium +10% FBS with 5, 10, 20 and 40

l

M of GA for 24 and 48 h for percentages of viable cells. (A) The cells were collected and were analyzed for viability by a PI exclusion method and ﬂow cytometry as described in Materials and Methods. (B) For cell number determina-tion, cells were stained with trypan blue and determined Countess Automated Cell Counter (Invitrogen). Each point is mean ± S.D. in triplicate of at least two independent experiments.⁄

p < 0.05 was considered as statistically signiﬁcant when compared with the untreated control.

(3)

abundance of GRB2, PI3K, AKT, PKC, p38, NF-

j

B p65, p38, ERK1/2, JNK, MMP-2, MMP-9, p-p38, p-ERK1/2 and p-JNK (Santa Cruz Biotechnology Inc.) were deter-mined by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and Western blotting as previously described (Lu et al., 2004; Yang et al., 2009). The relative abundance of each band was quantiﬁed using the NIH ImageJ (Chiang et al., 2011; Wen et al., 2010).

2.8. Real-time PCR of MMP-2 and -9 mRNA expressions

U-2 OS cells (1 106_{cells/well) were placed in 6-well plates and incubated with} GA (20 or 40

l

M) for 24 h. Cells were collected and total RNA was extracted from each treatment as previously described (Chiang et al., 2011). RNA samples were re-verse-transcribed at 42 °C with High Capacity cDNA Reverse Transcription Kit for 30 min according to the protocol of the supplier (Applied Biosystems, Foster City, CA, USA). The primers set as MMP-2F: CCCCAGACAGGTGATCTTGAC; MMP-2R: GCTTGCGAGGGAAGAAGTTG; 7F: GGATGGTAGCAGTCTAGGGATTAACT; MMP-7R: AGGTTGGATACATCACTGCATTAGG; MMP-9F: CGCTGGGCTTAGATCATTCC; MMP-9R: AGGTTGGATACATCACTGCATTAGG; GAPDH-F: ACACCCACTCCTCCACCTTT; GAPDH-R: TAGCCAAATTCGTTGTCATACC. Applied Biosystems 7300 Real-Time PCR system was used for each assay in triplicate and expression fold-changes were derived using the comparative CT(threshold cycle) method (Chen et al., 2010; Lin et al., 2009).

2.9. AKT, I

j

B kinase (IKK) and PKC using in vitro kinase assay

The peptide substrates, including KGSGS GRPRTSSFAEG for AKT1 and KKKKERLLDDRHDSGLDSMKDEE for IKKa/CHUK as well as the substrate Histone H1 and lipid activator for PKC

a

in base reaction buffer (20 mM HEPES, pH 7.5, 10 mM MgCl2, 1 mM EGTA, 0.02% Brij35, 0.02 mg/ml BSA, 0.1 mM Na3VO4, 2 mM DTT and 1% DMSO) were prepared according procedures provided by the manufac-turer (Reaction Biology Corp., Malvern, PA, USA). Any required cofactors (1.5 mM CaCl2, 16

l

g/ml Calmodulin, and 2 mM MnCl2) were then delivered into the sub-strate solution above and gently mixed with indicated kinase and subsub-strate

solu-tion. Various concentrations of GA (5, 10, 20, 40 and 80

l

M in DMSO) were added and mixed into the kinase reaction mixture. The initiate the reaction was car-ried out after33

P-ATP (speciﬁc activity 0.01

l

Ci/

l

l) into the reaction mixture and thereafter they were incubated for 120 min at room temperature. Reactions are spotted onto P81 ion exchange paper (Whatman #3698–915, Maidstone, England, United Kingdom) and ﬁlters were washed extensively in 0.1% phosphoric acid and counted as previously described (Coffer and Woodgett, 1991; Enomoto et al., 2005; Jones et al., 1991; Ma et al., 2011).

2.10. Statistical analysis

Statistical differences were determined using one-way analysis of variance (AN-OVA) followed by Dunnett’s post-test and considered signiﬁcant at the p < 0.05 be-tween experimental and control samples. All data are presented as means ± standard deviation (S.D.) in duplicate of at least three independent experiments.

3. Results

3.1. Effects of GA on percentage of viable and cell number U-2 OS cells

in vitro

U-2 OS cells were treated with various concentrations (5, 10, 20

and 40

l

M) of GA for 24 and 48 h. Cells were collected and

deter-mined viability by a PI exclusion and ﬂow cytometry assays. For

cell number determination, cells were stained with trypan blue

and then measured using Countess Automated Cell Counter

(Invit-rogen).

Fig. 1

A shows that 40

l

M GA treatment had a slight effect

on reduction (p < 0.05) on viability (86% and 78% at 24 and 48-h

Ratio of migrated cells to

untreated cells (% of control)

0 20 40 60 80 100 120 140

*

24

48 40 μM

20 μM

Time of incubation (h)

0 μM

24

48 40 μM

20 μM

Time of incubation (h)

0 μM

Ratio of invaded cells to

untreated cells (% of control)

0 20 40 60 80 100 120 140

*

Gallic acid (μM) 0 24 h 20 40 0 48 h 20 40 Gallic acid (μM) 0 24 h 20 40 0 48 h 20 40

A

C

D

B

Fig. 2. GA suppressed cell migration and invasion of U-2 OS cells. Cells were treated with 0, 20 and 40

l

M of GA for 24 and 48 h. (A) Cell migration was examined in a Boyden chamber and Matrigel-coated transwell with polycarbonate ﬁlters (pore size, 8

l

m); (C) cell invasion was examined in a Boyden chamber (polycarbonate ﬁlters; pore size, 8

l

m) were precoated with Matrigel. Migration (B) and invasion (D) abilities of U-2 OS cells were quantiﬁed by counting the number of cells that invaded the underside of the porous polycarbonate membrane under microscopy and represented the average of three independent experiments with duplicate samples.⁄

p < 0.05 was compared with the untreated control.

(4)

incubation, respectively) when compared with the control group.

GA at 40

l

M treatment showed a decrease of cell number

(p < 0.05) when compared with the 0-h treated group (

Fig. 2

B).

3.2. Effects of GA on migration and invasion of U-2 OS cells

We investigated the effects of GA on migration and invasion of

U-2 OS cells and results are shown in

Fig. 2

A–D. The migration

as-say showed that GA had a signiﬁcant inhibitory effect on cell

migration at concentrations between 20 and 40

l

M (

Fig. 2

A). Data

in

Fig. 2

B indicated that the inhibition rate was at 40–84% and 60–

92% when cells were incubated with GA for 24 and 48-h treatment,

respectively. The invasion assay showed that U-2 OS cells moved

from the upper chamber to the lower chamber in the absence of

GA (control group) (

Fig. 2

C). However, the penetration of the

Matrigel-coated ﬁlter by U-2 OS cells was inhibited in the presence

of GA. Percent inhibition at 20–40

l

M was at 60–90% and 66–94%

(

Fig. 2

D) when cells were exposed to GA for 24 and 48 h exposure,

respectively.

3.3. Effects of GA on the enzyme activity of MMP-2 and -9 in U-2 OS

cells

The previous study has shown that MMP-2 and -9 play vital

roles in tumor cell invasion (

Zhang et al., 2004

). We determined

if GA could inhibit the secretion of MMP-2 and -9 in U-2 OS cells.

Gelatin zymography was used to analyze the effects of 0, 10, 20,

30 and 40

l

M GA-treated U-2 OS cells on MMP-2 and -9 activities

for 24 and 48 h-incubations, respectively. Data in

Fig. 3

indicated

that GA at 20–40

l

M dramatically reduced activity of both

MMP-2 and -9 levels in U-MMP-2 OS cells.

3.4. Effects of GA on levels of proteins and genes associated with

migration and invasion in U-2 OS cells

We further determined the effects of GA on the levels of

proteins associated with migration and invasion in U-2 OS cells.

Results showed in

Fig. 4

A and B and indicated that GA decreased

24 h

48 h

0

10

20

30

40 (μM)

MMP-2 MMP-9 MMP-2 MMP-9 1.00 0.95 0.90 0.81 0.69 1.00 0.79 0.50 0.37 0.11 1.00 0.92 0.85 0.82 0.81 1.00 0.97 0.95 0.88 0.68

Fig. 3. GA decreased the MMP-2 and MMP-9 enzyme activities in U-2 OS cells. Cells (1 106

cells/well) were plated in 12-well were incubated with 0, 10, 20, 30 and 40

l

M of GA for 24 and 48 h. The supernatant was harvested from examined cells and it was separated by gelatin zymography as described in Section 2. The images of MMP-2 and MMP-9 activities were quantitated by the NIH ImageJ software. Data are performed with representative at least three independent experiments with similar results. MMP-2 MMP-7 MMP-9 Relative quantification 0.00 0.25 0.50 0.75 1.00 1.25 1.50

*

* *

α-tubulin

NF-κB p65

Gallic acid

0 20 40 (μM)

AKT

PKC

PI3K

GRB2

1.00 0.85 0.79 1.00 1.05 0.85 1.00 0.76 0.62 1.00 0.74 0.27 1.00 0.37 0.52

α-tubulin

ERK1/2

MMP-2

p38

JNK

1.00 0.34 0.49 1.00 0.93 0.95 1.00 0.29 0.32 1.00 0.87 0.39

MMP-9

1.00 1.09 0.57

Gallic acid

0 20 40 (μM)

A

C

0 μM 20 μM 40 μM

Gallic acid

0 20 40 (μM)

p-p38

p-ERK1/2

p-JNK

α-tubulin

1.00 0.45 0.27 1.00 0.97 0.51 1.00 0.42 0.15

D

1.00 0.59 0.66 1.00 0.74 0.33

B

Fig. 4. GA altered the proteins and gene levels of associated with migration and invasion in U-2 OS cells. Cells were treated with 0, 20 and 40

l

M of GA for 24 h. The total proteins were collected and the proteins levels were measured using Western blotting analysis. The levels of (A) GRB2, PI3K, AKT, PKC, NF-

j

B p65, (B) p38, ERK1/2, JNK, MMP-2, MMP-9, (C) p-p38, p-ERK1/2 and p-JNK were examined by SDS–PAGE and Western blotting. Results were shown with similar results of at least three independent experiments. (D) The total RNA was extracted from GA-treated U-2 OS cells, and then RNA samples were reverse-transcribed to cDNA for real-time PCR as described in Section 2. The ratios between MMP-2, -7, -9 and GAPDH mRNA are used and data represents mean ± S.D. in duplicate of at least three independent experiments.⁄

p < 0.05 was considered signiﬁcantly.

(5)

protein levels of GRB2, PI3K, AKT, PKC, NF-

j

B p65 (

Fig. 4

A), p38,

ERK1/2, JNK, MMP-2, MMP-9 (

Fig. 4

B), p38, ERK1/2 and

p-JNK (

Fig. 4

C) in U-2 OS cells. The ERK signaling has been reported

to up-regulate the expression of MMPs (

Coffer and Woodgett,

1991; Enomoto et al., 2005; Jones et al., 1991

). Results indicated

that GA could inhibit the levels of ERK1/2 (

Fig. 4

B), p-ERK1/2

(

Fig. 4

C) and AKT/PKB (

Fig. 4

A), suggesting that GA may inhibit

the ERK and PI3K/AKT signaling pathways in U-2 OS cells in vitro.

It was reported that signaling pathways by p38, JNK, ERK1/2 and

PI3K/AKT involve protein phosphorylation (

Dalby et al., 1998;

Myl-onis et al., 2006

). Our data indicated that GA suppressed the levels

of p-p38, p-ERK1/2 and p-JNK in U-2 OS cells as shown in

Fig. 4

C. GA treatment in a dose-dependent manner for 24 h also reduced

mRNA expression levels of MMP-2 and MMP-9 as seen in

Fig. 4

D. This is also conﬁrmed by gelatin zymographic and Western

blotting analyses in Figs.

3 and

4 B, respectively, and the results

indicated that GA inhibited the levels of protein and mRNA of

MMP-2 and MMP-9 in U-2 OS cells.

3.5. Effects of GA on AKT/PKB, IKK and PKC activities by in vitro kinase

assay

Data in

Fig. 5

A–C indicated that GA at 10, 20, 40 and 80

l

M

inhibited AKT/PKB activity (

Fig. 5

A). IKK activity was inhibited by

GA at 20, 40 and 80

l

M (

Fig. 5

B), and PKC activity was inhibited

at 5, 10, 20, 40 and 80

l

M (

Fig. 5

C).

4. Discussion

Tumor metastasis occurs through a series of steps including

vessel formation, cell attachment, invasion, migration and cell

pro-liferation, whose regulation is complex (

Fidler, 2002

). Numerous

efforts have been taken to develop drugs that can inhibit

metasta-sis, but the anti-metastatic agents have had mixed results (

Fidler,

2002

). In normal bone, matrix is constantly degraded and replaced

by new matrixa a process involving a coordinated balance between

bone degradation and synthesis (

Chakraborti et al., 2003

) and the

proteolytic enzymes such as matrix metalloproteinases (MMPs)

are required in this process (

Duffy et al., 2008

). Krupitza et al.

dem-onstrated that GA was ineffective in lymphendothelial cells (LECs)

gap formation and there was no inﬂuence on cell migration (

Madl-ener et al., 2010

). In our study, we investigated the anti-metastatic

mechanisms of GA on the invasion and migration of human

osteo-genic sarcoma U-2 OS cells using a Boyden chamber assay to

quan-tify the migratory potential of U-2 OS cells. We found that GA

inhibited in vitro migration and invasion ability of U-2 OS cells

(

Fig. 2

). Our results strengthen the potential use of GA as a new

strategy for anticancer therapy against migration and invasion of

U-2 OS cells.

MMPs play important roles in tumor angiogenesis, metastasis

and stimulation of growth factor release from the ECM (

Everts

et al., 1992; Ortega et al., 2003

). It is well-established that

inhibi-tions of MMP gene expression or enzyme activity are early targets

for preventing cancer metastasis (

Zhang et al., 2004

). It was

re-ported that MMP-2 (72-kDa gelatinase A) and MMP-9 (92-kDa

A

B

C

Fig. 5. GA reduced AKT/PKB, IKK and JNK activities in vitro. Different concentrations of GA (0, 5, 10, 20, 40 and 80

l

M) were measured and the activities of AKT/PKB (A), IKK (B) and PKC (C) were done as described in Materials and Methods. Data represents mean ± S.D. of at least three independent experiments in duplicate. ⁄

p < 0.05 was considered signiﬁcantly.

Fig. 6. The proposed a schematic presentation of the mechanisms of GA-inhibited migration and invasion of human osteosarcoma U-2 OS cells.

(6)

gelatinase B) are involved with the invasive metastatic potential of

tumor cells. Recently, it was reported that MMP-2 and MMP-9

were present in human osteosarcoma cells (

Guruvayoorappan

and Kuttan, 2008; Waas et al., 2003

). Herein, we clearly showed

that GA inhibited the migration and invasion of U-2 OS cells

in vitro and proposed that GA may account for its inhibitory effect

on cancer metastasis. Firstly, GA could inhibit the protein activity

of MMP-2 and MMP-9 (

Fig 3

) in U-2 OS cells, which are involved

in degradation of extracellular matrix and play vital roles in cancer

cell migration and invasion (

Zhang et al., 2004

). Secondly, GA

inhibited the mRNA levels of MMP-2 and -9 (

Fig. 4

D). Thirdly, GA

could inhibit the protein levels of MMP-2 and MMP-9 directly

(

Fig. 4

B). Finally, GA inhibited levels of ERK1/2 which are key

mol-ecules of the ERK signaling pathway that have been shown to

pro-mote tumor invasion and metastasis. In the present study, GA also

decreased the protein levels of AKT and JNK (

Figs. 4

A and B). It was

reported that most integrins activate MAPK and PI3K, leading to

activation of AKT/PKB (

Bjornland et al., 2005; Chakraborti et al.,

2003; Zhang et al., 2004

). The JNK inhibitor (SP600125) was used

to pre-treat the U-2 OS cells which then were exposed to GA,

resulting in decrease the MMP-2 and MMP-9 protein levels (data

not shown). We also found that GA inhibited the levels of AKT/

PKB, IKK and PKC (

Fig. 5

) in vitro which was associated with

inhi-bition of MMP-2 and MMP-9 mRNA levels (

Fig. 4

C) and protein

lev-els (

Fig. 4

B). Such effects are consistent a decrease in migration of

GA-treated U-2 OS cells.

To further explore the exact expression of GA-induced

inhibi-tion of invasion and migrainhibi-tion, we performed a gelatin

zymogra-phy assay to detect the activities of MMP-2 and MMP-9 in U-2

OS cells. The results showed that GA notably down-regulated

activ-ities of MMP-2 and MMP-9 in a dose-dependent manner. These

re-sults demonstrated that anti-metastatic effect of GA was

associated with the inhibition of enzymatically degradative

pro-cesses of metastasis in U-2 OS cells (

Fig. 3

). The present results

sug-gest that GA might have efﬁcacy if delivered to the bone site at

concentrations between 20 and 40

l

M, and thus preventing

metas-tasis of bone cancer cells.

In the present study, results showed that GA reduced protein

levels of PI3K, AKT/PKB, NF-

j

B, MMP-2 and MMP-9. PI3K

activa-tion stimulated the downstream target AKT/PKB which plays

vari-ous and important roles including cell invasion (

Duffy, 2004

). GA

also inhibited AKT/PKB activity (

Fig. 5

A) and it decreased the levels

of PKC, p38 and JNK in U-2 OS cells (

Fig. 4

A and B). Several reports

indicate that activation of PKC can cause translocation of the

pro-tein to membranes affecting the expression of MMP-9 via

modula-tion of transcripmodula-tion factors such as NF-

j

B or Sp-1 through MAPK

and PI3K signaling pathways (

Eccles, 2004; Hollborn et al., 2007

).

GA inhibited the PKC activity (

Fig. 5

C). Therefore, the regulation

of NF-

j

B, downstream of the PI3K/AKT and MAPK (ERK1/2, p38

and JNK) pathways, may be involved in GA-suppressed MMP-2

and -9 expression and invasion of U-2 OS cells. It was reported that

PI3K activation stimulated the downstream target AKT/PKB, which

plays various and important roles including cell invasion (

Chung

et al., 2004; Zhang et al., 2006

). Other reports have shown that

the activation of ERK and AKT/PKB is involved in the development

of endometrial cancer (

Hollborn et al., 2007

). These ﬁndings

sug-gest that GA has multiple anti-metastatic activities and it exhibits

a potent cytotoxic effect that could be potentially utilized as an

anti-metastatic agent for bone cancer in the future.

In conclusion, the present study determined the efﬁcacy of GA

on counteracting migration and invasion and identiﬁed molecular

mechanisms of GA inhibition in human osteosarcoma U-2 OS cells.

GA inhibited the activities of AKT/PKB, IKK and PKC in a

dose-dependent manner. Potential signaling pathways depicted in

Fig. 6

for GA-inhibited migration and invasion in U-2 OS cells

which may be mediated through down-regulation of PKC, blocking

MAPK, PI3K/AKT and NF-

j

B pathways, resulting in the inhibition of

MMP-2 and MMP-9.

Conﬂict of Interest

The authors declare that there was no conﬂicts of interest.

Acknowledgements

This work was supported by the research grant CMU100-S-18

from China Medical University, Taichung, Taiwan.

References

AbouEl Hassan, M.A., Braam, S.R., Kruyt, F.A., 2006. Paclitaxel and vincristine potentiate adenoviral oncolysis that is associated with cell cycle and apoptosis modulation, whereas they differentially affect the viral life cycle in non-small-cell lung cancer non-small-cells. Cancer Gene Ther. 13, 1105–1114.

Agarwal, C., Tyagi, A., Agarwal, R., 2006. Gallic acid causes inactivating phosphorylation of cdc25A/cdc25C-cdc2 via ATM-Chk2 activation, leading to cell cycle arrest, and induces apoptosis in human prostate carcinoma DU145 cells. Mol. Cancer Ther. 5, 3294–3302.

Arndt, C.A., Crist, W.M., 1999. Common musculoskeletal tumors of childhood and adolescence. N. Engl. J. Med. 341, 342–352.

Atkinson, B.L., Blackman, A.J., Faber, H., 2004. The degradation of the natural pyrethrins in crop storage. J. Agric. Food Chem. 52, 280–287.

Bjornland, K., Flatmark, K., Pettersen, S., Aaasen, A.O., Fodstad, O., Maelandsmo, G.M., 2005. Matrix metalloproteinases participate in osteosarcoma invasion. J. Surg. Res. 127, 151–156.

Chakraborti, S., Mandal, M., Das, S., Mandal, A., Chakraborti, T., 2003. Regulation of matrix metalloproteinases: an overview. Mol. Cell Biochem. 253, 269–285. Chakraborty, A., Ferk, F., Simic, T., Brantner, A., Dusinska, M., Kundi, M., Hoelzl, C.,

Nersesyan, A., Knasmuller, S., 2009. DNA-protective effects of sumach (Rhus coriaria L.), a common spice. Results of human and animal studies. Mutat. Res. 661, 10–17.

Chen, H.M., Chang, F.R., Hsieh, Y.C., Cheng, Y.J., Hsieh, K.C., Tsai, L.M., Lin, A.S., Wu, Y.C., Yuan, S.S., 2011a. A novel synthetic protoapigenone analogue, WYC02-9, induces DNA damage and apoptosis in DU145 prostate cancer cells through generation of reactive oxygen species. Free Radic. Biol. Med. 50, 1151–1162. Chen, K.T., Hour, M.J., Tsai, S.C., Chung, J.G., Kuo, S.C., Lu, C.C., Chiu, Y.J., Chuang, Y.H.,

Yang, J.S., 2011b. The novel synthesized 6-ﬂuoro-(3-ﬂuorophenyl)-4-(3-methoxyanilino)quinazoline (LJJ-10) compound exhibits anti-metastatic effects in human osteosarcoma U-2 OS cells through targeting insulin-like growth factor-I receptor. Int. J. Oncol. 39, 611–619.

Chen, Y.Y., Chiang, S.Y., Lin, J.G., Ma, Y.S., Liao, C.L., Weng, S.W., Lai, T.Y., Chung, J.G., 2010. Emodin, aloe-emodin and rhein inhibit migration and invasion in human tongue cancer SCC-4 cells through the inhibition of gene expression of matrix metalloproteinase-9. Int. J. Oncol. 36, 1113–1120.

Chiang, J.H., Yang, J.S., Ma, C.Y., Yang, M.D., Huang, H.Y., Hsia, T.C., Kuo, H.M., Wu, P.P., Lee, T.H., Chung, J.G., 2011. Danthron, an anthraquinone derivative, induces DNA damage and caspase cascades-mediated apoptosis in SNU-1 human gastric cancer cells through mitochondrial permeability transition pores and Bax-triggered pathways. Chem. Res. Toxicol. 24, 20–29.

Chung, T.W., Lee, Y.C., Kim, C.H., 2004. Hepatitis B viral HBx induces matrix metalloproteinase-9 gene expression through activation of ERK and PI-3K/AKT pathways: involvement of invasive potential. FASEB J. 18, 1123–1125. Coffer, P.J., Woodgett, J.R., 1991. Molecular cloning and characterisation of a novel

putative protein-serine kinase related to the cAMP-dependent and protein kinase C families. Eur. J. Biochem. 201, 475–481.

Dalby, K.N., Morrice, N., Caudwell, F.B., Avruch, J., Cohen, P., 1998. Identiﬁcation of regulatory phosphorylation sites in mitogen-activated protein kinase (MAPK)-activated protein kinase-1a/p90rsk that are inducible by MAPK. J. Biol. Chem. 273, 1496–1505.

Duan, X., Ponomareva, L., Veeranki, S., Choubey, D., 2011. IFI16 induction by glucose restriction in human ﬁbroblasts contributes to autophagy through activation of the ATM/AMPK/p53 pathway. PLoS One 6, e19532.

Duffy, M.J., 2004. The urokinase plasminogen activator system: role in malignancy. Curr. Pharm. Des. 10, 39–49.

Duffy, M.J., McGowan, P.M., Gallagher, W.M., 2008. Cancer invasion and metastasis: changing views. J. Pathol. 214, 283–293.

Eccles, S.A., 2004. Parallels in invasion and angiogenesis provide pivotal points for therapeutic intervention. Int. J. Dev. Biol. 48, 583–598.

Enomoto, A., Murakami, H., Asai, N., Morone, N., Watanabe, T., Kawai, K., Murakumo, Y., Usukura, J., Kaibuchi, K., Takahashi, M., 2005. Akt/PKB regulates actin organization and cell motility via Girdin/APE. Dev. Cell 9, 389–402.

Everts, V., Delaisse, J.M., Korper, W., Niehof, A., Vaes, G., Beertsen, W., 1992. Degradation of collagen in the bone-resorbing compartment underlying the osteoclast involves both cysteine-proteinases and matrix metalloproteinases. J. Cell Physiol. 150, 221–231.

Faried, A., Kurnia, D., Faried, L.S., Usman, N., Miyazaki, T., Kato, H., Kuwano, H., 2007. Anticancer effects of gallic acid isolated from Indonesian herbal medicine,

(7)

Phaleria macrocarpa (Scheff.) Boerl, on human cancer cell lines. Int. J. Oncol. 30, 605–613.

Farris, S.D., Hu, J.H., Krishnan, R., Emery, I., Chu, T., Du, L., Kremen, M., Dichek, H.L., Gold, E., Ramsey, S.A., Dichek, D.A., 2011. Mechanisms of urokinase plasminogen activator (uPA)-mediated atherosclerosis: role of the uPA receptor and S100A8/A9 proteins. J. Biol. Chem. 286, 22665–22677.

Fidler, I.J., 2002. The organ microenvironment and cancer metastasis. Differentiation 70, 498–505.

Gullu, I.H., Kurdoglu, M., Akalin, I., 2000. The relation of gelatinase (MMP-2 and -9) expression with distant site metastasis and tumour aggressiveness in colorectal cancer. Br. J. Cancer 82, 249.

Guruvayoorappan, C., Kuttan, G., 2008. Amentoﬂavone inhibits experimental tumor metastasis through a regulatory mechanism involving MMP-2, MMP-9, prolyl hydroxylase, lysyl oxidase, VEGF, ERK-1, ERK-2, STAT-1, NM23 and cytokines in lung tissues of C57BL/6 mice. Immunopharmacol. Immunotoxicol. 30, 711–727. Ho, H.H., Chang, C.S., Ho, W.C., Liao, S.Y., Wu, C.H., Wang, C.J., 2010. Anti-metastasis effects of gallic acid on gastric cancer cells involves inhibition of NF-kappaB activity and downregulation of PI3K/AKT/small GTPase signals. Food Chem. Toxicol. 48, 2508–2516.

Hollborn, M., Stathopoulos, C., Steffen, A., Wiedemann, P., Kohen, L., Bringmann, A., 2007. Positive feedback regulation between MMP-9 and VEGF in human RPE cells. Invest. Ophthalmol. Vis. Sci. 48, 4360–4367.

Hong, W.K., Sporn, M.B., 1997. Recent advances in chemoprevention of cancer. Science 278, 1073–1077.

Huang, W.W., Chiu, Y.J., Fan, M.J., Lu, H.F., Yeh, H.F., Li, K.H., Chen, P.Y., Chung, J.G., Yang, J.S., 2010. Kaempferol induced apoptosis via endoplasmic reticulum stress and mitochondria-dependent pathway in human osteosarcoma U-2 OS cells. Mol. Nutr. Food Res. 54, 1585–1595.

Inoue, M., Suzuki, R., Koide, T., Sakaguchi, N., Ogihara, Y., Yabu, Y., 1994. Antioxidant, gallic acid, induces apoptosis in HL-60RG cells. Biochem. Biophys. Res. Commun. 204, 898–904.

Isuzugawa, K., Inoue, M., Ogihara, Y., 2001. Catalase contents in cells determine sensitivity to the apoptosis inducer gallic acid. Biol. Pharm. Bull 24, 1022–1026. Ji, B.C., Hsu, W.H., Yang, J.S., Hsia, T.C., Lu, C.C., Chiang, J.H., Yang, J.L., Lin, C.H., Lin, J.J., Suen, L.J., Gibson Wood, W., Chung, J.G., 2009. Gallic acid induces apoptosis via caspase-3 and mitochondrion-dependent pathways in vitro and suppresses lung xenograft tumor growth in vivo. J. Agric. Food Chem. 57, 7596-7604. Jones, P.F., Jakubowicz, T., Pitossi, F.J., Maurer, F., Hemmings, B.A., 1991. Molecular

cloning and identiﬁcation of a serine/threonine protein kinase of the second-messenger subfamily. Proc. Natl. Acad. Sci. USA 88, 4171–4175.

Kang, M.S., Oh, J.S., Kang, I.C., Hong, S.J., Choi, C.H., 2008. Inhibitory effect of methyl gallate and gallic acid on oral bacteria. J. Microbiol. 46, 744–750.

Kaur, M., Velmurugan, B., Rajamanickam, S., Agarwal, R., Agarwal, C., 2009. Gallic acid, an active constituent of grape seed extract, exhibits anti-proliferative, pro-apoptotic and anti-tumorigenic effects against prostate carcinoma xenograft growth in nude mice. Pharm. Res. 26, 2133–2140.

Kawada, M., Ohno, Y., Ri, Y., Ikoma, T., Yuugetu, H., Asai, T., Watanabe, M., Yasuda, N., Akao, S., Takemura, G., Minatoguchi, S., Gotoh, K., Fujiwara, H., Fukuda, K., 2001. Anti-tumor effect of gallic acid on LL-2 lung cancer cells transplanted in mice. Anticancer Drugs 12, 847–852.

Kim, S.H., Jun, C.D., Suk, K., Choi, B.J., Lim, H., Park, S., Lee, S.H., Shin, H.Y., Kim, D.K., Shin, T.Y., 2006. Gallic acid inhibits histamine release and pro-inﬂammatory cytokine production in mast cells. Toxicol. Sci. 91, 123–131.

Lai, K.C., Huang, A.C., Hsu, S.C., Kuo, C.L., Yang, J.S., Wu, S.H., Chung, J.G., 2010. Benzyl isothiocyanate (BITC) inhibits migration and invasion of human colon cancer HT29 cells by inhibiting matrix metalloproteinase-2/-9 and urokinase plasminogen (uPA) through PKC and MAPK signaling pathway. J. Agric. Food Chem. 58, 2935–2942.

Lin, C.C., Chen, J.T., Yang, J.S., Lu, H.F., Hsu, S.C., Tan, T.W., Lin, Y.T., Ma, Y.S., Ip, S.W., Wu, J.J., Li, Y.C., Chung, J.G., 2009. Danthron inhibits the migration and invasion of human brain glioblastoma multiforme cells through the inhibition of mRNA expression of focal adhesion kinase, Rho kinases-1 and metalloproteinase-9. Oncol. Rep. 22, 1033–1037.

Liu, K.C., Huang, A.C., Wu, P.P., Lin, H.Y., Chueh, F.S., Yang, J.S., Lu, C.C., Chiang, J.H., Meng, M., Chung, J.G., 2011. Gallic acid suppresses the migration and invasion of PC-3 human prostate cancer cells via inhibition of matrix metalloproteinase-2 and -9 signaling pathways. Oncol. Rep. 26, 177–184.

Lu, C.C., Yang, J.S., Huang, A.C., Hsia, T.C., Chou, S.T., Kuo, C.L., Lu, H.F., Lee, T.H., Wood, W.G., Chung, J.G., 2010. Chrysophanol induces necrosis through the production of ROS and alteration of ATP levels in J5 human liver cancer cells. Mol. Nutr. Food Res. 54, 967–976.

Lu, H.F., Sue, C.C., Yu, C.S., Chen, S.C., Chen, G.W., Chung, J.G., 2004. Diallyl disulﬁde (DADS) induced apoptosis undergo caspase-3 activity in human bladder cancer T24 cells. Food Chem. Toxicol. 42, 1543–1552.

Ma, C.Y., Ji, W.T., Chueh, F.S., Yang, J.S., Chen, P.Y., Yu, C.C., Chung, J.G., 2011. Butein inhibits the migration and invasion of SK-HEP-1 human hepatocarcinoma cells through suppressing the ERK, JNK, p38, and uPA signaling multiple pathways. J. Agric. Food Chem. 59, 9032–9038.

Madlener, S., Saiko, P., Vonach, C., Viola, K., Huttary, N., Stark, N., Popescu, R., Gridling, M., Vo, N.T., Herbacek, I., Davidovits, A., Giessrigl, B., Venkateswarlu, S., Geleff, S., Jager, W., Grusch, M., Kerjaschki, D., Mikulits, W., Golakoti, T., Fritzer-Szekeres, M., Fritzer-Szekeres, T., Krupitza, G., 2010. Multifactorial anticancer effects of digalloyl-resveratrol encompass apoptosis, cell-cycle arrest, and inhibition of lymphendothelial gap formation in vitro. Br. J. Cancer 102, 1361–1370. Mizutani, K., Kofuji, K., Shirouzu, K., 2000. The signiﬁcance of MMP-1 and MMP-2 in

peritoneal disseminated metastasis of gastric cancer. Surg. Today 30, 614–621. Mylonis, I., Chachami, G., Samiotaki, M., Panayotou, G., Paraskeva, E., Kalousi, A., Georgatsou, E., Bonanou, S., Simos, G., 2006. Identiﬁcation of MAPK phosphorylation sites and their role in the localization and activity of hypoxia-inducible factor-1alpha. J. Biol. Chem. 281, 33095–33106.

Ng, T.B., He, J.S., Niu, S.M., Zhao, L., Pi, Z.F., Shao, W., Liu, F., 2004. A gallic acid derivative and polysaccharides with antioxidative activity from rose (Rosa rugosa) ﬂowers. J. Pharm. Pharmacol. 56, 537–545.

Ortega, N., Behonick, D., Stickens, D., Werb, Z., 2003. How proteases regulate bone morphogenesis. Ann. N. Y. Acad. Sci. 995, 109–116.

Shahrzad, S., Aoyagi, K., Winter, A., Koyama, A., Bitsch, I., 2001. Pharmacokinetics of gallic acid and its relative bioavailability from tea in healthy humans. J. Nutr. 131, 1207–1210.

Thompson, R.C., Jr., Cheng, E.Y., Clohisy, D.R., Perentesis, J., Manivel, C., Le, C.T., 2002. Results of treatment for metastatic osteosarcoma with neoadjuvant chemotherapy and surgery. Clin. Orthop. Relat. Res, 240–247.

Veluri, R., Singh, R.P., Liu, Z., Thompson, J.A., Agarwal, R., Agarwal, C., 2006. Fractionation of grape seed extract and identiﬁcation of gallic acid as one of the major active constituents causing growth inhibition and apoptotic death of DU145 human prostate carcinoma cells. Carcinogenesis 27, 1445–1453. Waas, E.T., Wobbes, T., Lomme, R.M., DeGroot, J., Ruers, T., Hendriks, T., 2003. Matrix

metalloproteinase 2 and 9 activity in patients with colorectal cancer liver metastasis. Br. J. Surg. 90, 1556–1564.

Wen, Y.F., Yang, J.S., Kuo, S.C., Hwang, C.S., Chung, J.G., Wu, H.C., Huang, W.W., Jhan, J.H., Lin, C.M., Chen, H.J., 2010. Investigation of anti-leukemia molecular mechanism of ITR-284, a carboxamide analog, in leukemia cells and its effects in WEHI-3 leukemia mice. Biochem. Pharmacol. 79, 389–398.

Wermers, R.A., Tiegs, R.D., Atkinson, E.J., Achenbach, S.J., Melton 3rd, L.J., 2008. Morbidity and mortality associated with Paget’s disease of bone: a population-based study. J. Bone Miner Res. 23, 819–825.

Yang, J.S., Chen, G.W., Hsia, T.C., Ho, H.C., Ho, C.C., Lin, M.W., Lin, S.S., Yeh, R.D., Ip, S.W., Lu, H.F., Chung, J.G., 2009. Diallyl disulﬁde induces apoptosis in human colon cancer cell line (COLO 205) through the induction of reactive oxygen species, endoplasmic reticulum stress, caspases casade and mitochondrial-dependent pathways. Food Chem. Toxicol. 47, 171–179.

Zhang, L., Shi, J., Feng, J., Klocker, H., Lee, C., Zhang, J., 2004. Type IV collagenase (matrix metalloproteinase-2 and -9) in prostate cancer. Prostate Cancer Prostatic. Dis. 7, 327–332.

Zhang, S., Li, Z., Wu, X., Huang, Q., Shen, H.M., Ong, C.N., 2006. Methyl-3-indolylacetate inhibits cancer cell invasion by targeting the MEK1/2-ERK1/2 signaling pathway. Mol. Cancer Ther. 5, 3285–3293.