Cloning and characterization of a cDNA encoding the cytosolic copper/zinc-superoxide dismutase from sweet potato tuberous

Download (0)

全文

(1)

Plant Molecular Biology 23:911-913, 1993.

© 1993 Kluwer Academic Publishers. Printed in Belgium. 911

Short communication

Cloning and characterization of a cDNA encoding the cytosolic

copper/zinc-superoxide dismutase from sweet potato tuberous root

Chi-Tsai Lin 1, Kai-Wun Yeh 2, Ming-Ching Kao 3 and Jei-Fu Shaw 4

~ Department of Bioengineering, Tatung Institute of Technology, 40 Chungshan North Road, 3rd sec. Taipei, Taiwan," 2 Department of Botany, National Taiwan University, Taipei, Taiwan; 3 Department of Biochemistry, National Defense Medical Center, Taipei, Taiwan; 4Institute of Botany, Academia Sinica, Nankang, Taipei, Taiwan

Received 1 July 1993; accepted in revised form 6 September 1993

Key words: cDNA, cytosolic Cu/Zn-SOD, superoxide dismutase, sweet potato, Iopomoea batatas (L.)

Abstract

A full-length c D N A clone encoding a putative copper/zinc-superoxide dismutase (SOD) of sweet potato,

Ipomoea batatas (L.) Lam. cv Tainong 57, was isolated from a c D N A library constructed in )~gtl0 from tuber root mRNA. Nucleotide sequence analysis of this c D N A clone revealed that it comprises a complete open reading frame coding for 152 amino acid residues. The deduced amino acid sequence showed higher homology (78-86 ~o) with the sequence of the cytosolic SOD than that of the chloroplast SOD from other plant species. The residues required for coordinating copper and zinc are conserved as they are among all reported Cu/Zn-SOD sequences. In addition, it lacks recognizable plastic or mitochondrial targeting sequences. These data suggest that the isolated sweet potato clone encodes a cytosolic Cu/Zn-SOD.

One of the natural antioxidant enzymes, super- oxide dismutase (SOD; superoxide:superoxide oxidoreductase, EC 1.15.1.1), scavenges O2-, and thus prevents the lethal effects of O2-. SODs are metalloproteins and are classified into three types (Mn-, Fe- and Cu/Zn-SOD), depending on the metal found in the active site. In higher plants, the most prominent SODs are Cu/Zn isozymes found in the cytosol and plastids [8]. It has been ob- served that the activity of plant SOD increases in response to a variety of environmental and

chemical stimuli [3, 7]. Many plant SOD c D N A s from leaf or seedling have been sequenced and compared, but no reports on SOD c D N A from root tissue. We report in this paper the c D N A sequence and deduced amino acid sequence from a cytosolic Cu/Zn-SOD c D N A clone.

Young growing roots of sweet potato, Ipomoea batatas (L.) Lam. cv. Tainong 57, were harvested immediately before use. Skinned and diced roots were frozen in liquid nigrogen and ground to pow- der in a ceramic mortar. Total R N A were pre-

The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number X73139.

(2)

912

27 ATG GTG AAG GCT GTC GCA GTT CTT AGC AGT AGT GAA

1 M V K A V A V L $ S $ E

87 AGC CAA GAA GGA GAT GGT CCA ACC ACA GTC ACT GGA

21 $ O E G D G P T T V T G

147 CTT CAT GGC TTC CAT GTC CAT GCC CTA GGT GAC ACA

41 L H G F H V H A L G D T

207 CCA CAT l - r c AAT CCT GCT GGA bAG GAG CAT GGA (aCT

61 P H F N P A G K E H G A

267 GGT GAT C1-F GGA AAC ATC ACG GTT GGA GAA GAT GGT

81 G D L G N I T V G E D G

327 AAG CAG ArT COG CTT ACT GGA C-/2A AAT TCT GTT ATT

101 K Q I P L T G A N S V I

387 GAT CCC GAT GAT CTT GGT AAA GGT GGC CAT GAG CTC

121 D P D D L G K G G H E L

447 GGG AGG GTT GCC TGC GGT ATC ArT GGC CTG CAG GGT

141 G R V A C G I I G L Q G

GGGGTGCTCTGAGATCACAAACAAAA GGT GTC AGC GGC ACC ATT TTC TIC

G V S G T I F F

AAC G1-F TCG GGC CTC AAA CCT GGT N V S G L K P G

ACA AAT GGA TGC ATG TCT ACT GGA

T N G C M S T G

CCT GGA GAC GAT AAC CGC CAT GCC

P G D D N R H A

ACT GCT TCA TTC ACC ATC ACT GAC

T A S F T I T D

GGA AGA GCT GET GET Gl-r CAT GGT

G R A V V V H G

AGC AAA AGO ACT GGA AAT GCT GGC

S K S T G N A G

TAAGGTGTGATTTGCTTATGAAGTCACCCAT

514 GGCAGAGAG~GCTTGAATAAAGGAATCATTTTGTGCAGTGC I i i I I CTGTG I I I I 1GAACTTCATGCCTTGACC 593 AACTCTTATGGGGGATAGAAACTTTGATATGTATTCACTGTTTATCGTA•TTCAT•TTGCCTAAl-FACTATCTGAATAA 672 TAAGITGG1-FTGTGA~+A.A A.a.~AAAAAAAAAA

Fig. I. Nucleotide sequence of sweet potato SOD (SW-SOD) c D N A and the deduced amino acid sequence. Numbers to the left

refer to nucleotide and amino acid residuces. Consensus sequences of the translation start site and polyadenylation signal are underlined. The asterisk denotes the stop signal.

SW-SOD TSOD MSOD-4 MSOD-2 RSODA SW-SOD TSOD MSOD-4 MSOD-2 RSODA SW-SOD TSOD MSOD-4 MSOD-2 RSODA

MVKAVAVLSS SEGVSGTIFF SQEGDGPTTV TGNVSGLKPG LHGFHVHALG 50 . . . N . . . Y L . T . V , V A . . . . N , , I . . .

. . . G . . . K . . . T . . . S . . . . . . AG T D - . K . . . S I . . . . . . V . , G . . . I . K . . . H . V . . . S . . . I . . . . DTTNG~dSTG PHFNPAGKEH GAPGDDNRHA GDLGNITVGE D G T A S F T I T D 100 . . . ' - J Y . . . E , E V . . . . . . Y , . , S . . . E . E . . . V . A . A . . V , N I N V . , . . . V . L . . . EFED . . . V . A . . . . V V N V N , , , . . . Y . . . E . E T . . . V , A . . . . V . N I H V V . DPDDLGKGGH ELSKSTGNAG G R V A ~ I I G L 150 KQIPLTGANS VIGRAVVVHG . . . PQ, I . . . A . . . I ~ . . . S . . . P . . I . . . A . . . S . . . . A , P H . I . . . A . . . S . . . P . . I . . . A . . . T . . . SW-SOD QG 1 52 TSOD , , MSOD-4 . , MSOD-2 . , RSODA . ,

Fig. 2. Comparison of amino acid sequences of SODs: SW-SOD, sweet potato SOD (this study); TSOD, tomato SOD [6];

MSOD-4, maize SOD-4 [2]; MSOD-2, maize SOD-2 [ 1]; RSODA, rice SODA [8]. Numbers refer to SW-SOD. Three sequences are shown only where they differ from SW-SOD. A dot refers to identities with SW-SOD. A dash denotes deletion. Residues coordinating copper and zinc are indicated with asterisks. The two cysteines that form a disulfide bridge are boxed.

(3)

pared by the guanidium HC1 procedure [4]. The poly(A) + RNAs were isolated according to the oligo-(dT) affinity method [4] and then ligated with 2gtl0. The recombinant cDNAs were pack- aged with Stratagene's Gigapack and then a cDNA library was constructed by using C600hlf as the host. Putative positive clones were selected by plaque hybridization with 32p-labelled DNA fragment of Aspergillus japonicus SOD (unpub- lished data) which was amplified by PCR using two primers ( 5 ' - T C C A T G G G T T C C A T G T G C - 3 ', 5' -GTTTCCGGTGCTCTTGCT-3 ' ) accord- ing to the sequence of maize SOD-4 [2]. A cDNA fragment from purified positive plaques was sub- cloned into p G E M - 7 z f ( + ) (Promega) named

SW-SOD-15 using Escherichia coli JM109 as

host. Nucleotide sequence was determined in both directions by the automated fluorescent sequenc- ing of DNA with dye primers using the Applied Biosystems Model 373A DNA sequencing sys- tem (Applied Biosystems).

Figure 1 shows the nucleotide and deduced amino acid sequences of one cDNA clone. Se- quencing analysis found that the cDNA was full- length, comprising a complete open reading frame coding for 152 amino acid residues and a poly- adenylated residuce on 3' end. There is no transit peptide as reported in chloroplast or mitochon- dria enzymes. The DNA sequence translation start site (AAAAATGG) matches the consensus sequence (AACAATGG) reported for this region in plants [5].

The deduced sequence of 152 amino acids showed higher homology with the sequences of the cytosolic SOD from several other plant spe- cies (maize SOD-2, 78.3~o [1]; maize SOD-4, 83.6~o [2]; rice RSODA, 79.0~o [8], rice RSODB, 83~o [8]; tomato TSOD, 85.5~o [6]) than the sequence of chloroplastic counterpart (pea SOD, 60.5~o [10]; petunia SOD, 62.5~o [11]; tomato SOD, 63.2~o [6]). This suggests that the sweet potato SOD is of a cytosolic type. Figure 2 shows that seven residues coordinating copper (histidine 45, 47, 62 and 119) and zinc (histidine 62, 70, 79 and aspartate 82), as well as

913 the two cysteines (56 and 145) that form a single disulfide bridge, are conserved as they are among all reported Cu/Zn-SOD sequences [3].

Acknowledgements

This work was supported by the National Science Council of the Republic of China. We thank Mr. Ming-Tse Lin for his excellent technical assistance.

References

1. Cannon RE, White JA, Scandalios JG: Cloning o f c D N A for maize superoxide dismutase 2 (SOD-2). Proc Natl Acad Sci U S A 84:179-183 (1987).

2. Cannon RE, Scandalios JG: Two cDNAs encode two nearly identical Cu/Zn-superoxide dismutase proteins in maize. Mol Gen Genet 2 1 9 : 1 - 8 (1989).

3. Fridovich I: Superoxide dismutases. Adv Enzymol 58: 61-97 (1986).

4. Lin CT, Yeh KW, Lee PD, Su JC: Primary structure of sweet potato starch phosphorylase deduced from its c D N A sequence. Plant Physiol 95:1250-1253 (1991). 5. L~itcke HA, Chow KC, Mickel FS, Moss KA, Kern HF,

Scheele GA: Selection of A U G initiation codons differs in plants and animals. EMBO J 6:43-48 (1987). 6. Perl-Treves R, Nacmias B, Aviv D, Zeelon EP, Galun E:

Isolation of two c D N A clones from tomato containing two different superoxide dismutase sequences. Plant Mol Biol 11:609-623 (1988).

7. Perl-Treves R, Galun E: The tomato Cu/Zn superoxide dismutase genes are developmentally regulated and re- spond to light and stress. Plant Mol Biol 17:745-760 (1991).

8. SakamotoA, OhsugaH, Tanaka K: Nucleotide se- quences of two c D N A clones encoding different Cu/Zn- superoxide dismutases expressed in developing rice seed. Plant Mol Biol 19:323-327 (1992).

9. Sakamoto A, OkumuraT, OhsugaH, Tanaka K: Ge- nomic structure of the gene for Copper/Zinc-superoxide dismutase in rice. FEBS Lett 301:185-189 (1992). 10. Scioli JR, Zilinskas BA: Cloning and characterization of

a c D N A encoding the chloroplastic Copper/Zinc-super- oxide dismutase from pea. Proc Natl Acad Sci USA 85: 7661-7665 (1988).

11. Tepperman J, Katayama C, Dunsmuir P: Cloning and nucleotide sequence of a petunia gene encoding a chlo- roplast localized superoxide dismutase. Plant Mol Biol

數據

Fig. 2.  Comparison  of  amino  acid  sequences  of  SODs:  SW-SOD,  sweet  potato  SOD  (this  study);  TSOD,  tomato  SOD  [6];
Fig. 2. Comparison of amino acid sequences of SODs: SW-SOD, sweet potato SOD (this study); TSOD, tomato SOD [6]; p.2
Fig.  I.  Nucleotide  sequence  of sweet  potato  SOD  (SW-SOD)  c D N A   and  the deduced  amino  acid  sequence
Fig. I. Nucleotide sequence of sweet potato SOD (SW-SOD) c D N A and the deduced amino acid sequence p.2

參考文獻

相關主題 :