CTGF increases drug resistance to paclitaxel by upregulating
survivin expression in human osteosarcoma cells
Hsiao-Chi Tsai1, Chun-Yin Huang2,3 , Hong-Lin Su1* and Chih-Hsin Tang4,5,6*
1Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan 2Department of Orthopaedic Surgery, China Medical University Beigang Hospital,
Yun-Lin County, Taiwan
3Graduate Institute of Clinical Medical Science, China Medical University, Taichung, Taiwan
4Graduate Institute of Basic Medical Science, China Medical University, Taichung, Taiwan
5Department of Pharmacology, School of Medicine, China Medical University, Taichung, Taiwan
6Department of Biotechnology, College of Health Science, Asia University, Taichung, Taiwan
*: Corresponding author.
Chih-Hsin, Tang PhD
Graduate Institute of Basic Medical Science, China Medical University No. 91, Hsueh-Shih Road, Taichung, Taiwan
Tel: 886-4-22052121-7726 Fax: 886-4-22333641
E-mail: [email protected]
Or
Hong-Lin, Su PhD
Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan No. 250 Kuo Kuang Rd., Taichung, Taiwan
Tel: 886- 4-22840416-417 Fax: 886-4-22854391
E-mail: suhonglin @ gmail.com 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33
Abstract
Osteosarcoma is the most common primary malignant tumor, and its treatments require more effective therapeutic approaches. Paclitaxel has a broad range of antitumor activities, including apoptosis-inducing effects. However, the majority of tumors in patients with advanced cancer eventually develop chemoresistance. Connective tissue growth factor (CTGF) is a secreted protein that modulates the invasiveness of certain human cancer cells by binding to integrins. However, the effect of CTGF in paclitaxel-mediated chemotherapy is unknown. Here, we report that the expression of CTGF in osteosarcoma patients was significantly higher than CTGF expression in normal bone tissues. Overexpression of CTGF increased the resistance to paclitaxel-mediated cell apoptosis. In contrast, knockdown of CTGF expression by CTGF shRNA increased the chemotherapeutic effect of paclitaxel. In addition, CTGF increased resistance to paclitaxel-induced apoptosis through upregulation of survivin expression. Moreover, the AMP-activated protein kinase (AMPK)-dependent nuclear factor kappa B (NF-B) pathway mediated paclitaxel-increased chemoresistance and survivin expression. In a mouse xenograft model, overexpression of CTGF promoted resistance to paclitaxel. In contrast, knockdown of CTGF expression increased the therapeutic effect of paclitaxel in this model. In conclusion, our data indicate that CTGF might be a critical oncogene of human osteosarcoma involved in resistance to paclitaxel treatment.
Running title: CTGF raises paclitaxel-resistance in osteosarcoma Key Words: Osteosarcoma; Survivin; CTGF; Chemotherapy; Paclitaxel
34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56
Introduction
Osteosarcoma is the most common histological form of primary bone cancer and the eighth most common form of childhood cancer. It is arises from the malignant transformation of mesenchymal cells, often occurring during cell differentiation in the formation of osteoid and immature bone . Before and after surgical resection of osteosarcoma tumors, patients usually undergo an aggressive chemotherapy regimen. Improvements in chemotherapeutic regimens and surgical techniques have resulted in a 5-year overall survival rate of 52–62% . Paclitaxel (Taxol) was reported to have cytotoxic activity against many forms of leukemia and solid tumors, including chemotherapy-resistant epithelial ovarian cancer, advanced breast cancer, small cell and non-small cell lung cancer, head and neck cancer, and osteosarcoma . However, tumors in most of the patients with late-stage cancer often develop resistance to paclitaxel . Recent trials have shown that the overall survival rate of patients with osteosarcoma has reached its peak with little or no improvement for conventional treatment modalities because of the development of osteosarcomas with chemotherapeutic resistance . Therefore, it is important to understand the molecular mechanisms that contribute to drug resistance of tumors, and to identify novel therapeutic targets in human osteosarcoma.
Connective tissue growth factor (CTGF) is the second member of the CCN family, also known as CCN2, and has important roles in many biological processes; CTGF is also thought to be involved in tumor cell proliferation, migration, angiogenesis, and metastasis . The role of CTGF in normal tissue fibrosis has been well studied . On the other hand, CTGF has also been identified as an oncogene in a variety of cancers, including melanoma, chondrosarcoma, acute lymphoblastic leukemia, and pancreatic cancer . Clinically, CTGF expression correlates with 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81
melanoma progression and metastasis. Inhibition of CTGF, either genetically or with a specific anti-CTGF monoclonal antibody, significantly inhibits the ability of human melanoma cells to grow in the skin . Furthermore, the role of CTGF in the development of resistance to paclitaxel treatment has been demonstrated in breast cancer and ovarian cancer . These observations suggest that CTGF expression may be involved in the progression and chemoresistance of human cancers.
A previous study has shown that paclitaxel interacts with microtubules and induces apoptosis in various tumor cells . Acquired resistance to paclitaxel may be mediated by a number of proposed mechanisms, including overexpression of P-glycoprotein, alterations in tubulin, and aberrant signal transduction pathways inhibiting apoptosis . Survivin has been characterized as a member of the inhibitor of apoptosis (IAP) protein family and has been shown to be involved in early events in the development of resistance following paclitaxel exposure . High levels of expression of survivin in ovarian cancer patients were significantly associated with clinical resistance to a paclitaxel/platinum-based treatment programs, and stable transfection with survivin cDNA in ovarian cancer cells caused a 4- to 6-fold increase in cellular resistance to paclitaxel . On the other hand, survivin has been reported to be a useful target for assessing tumor prognosis and the degree of malignancy in human osteosarcoma . Therefore, survivin plays an important role in tumor prognosis and in modulating paclitaxel-induced apoptosis in human cancers.
Although the role of CTGF in chemoresistance has been implicated in some types of cancer cells, the effect of CTGF on paclitaxel-induced cell apoptosis in human osteosarcoma has not been extensively studied. The objective of this study was to determine the in vitro and in vivo efficacy of CTGF in the paclitaxel-induced chemoresistance in human osteosarcoma cells. Our results suggest that CTGF 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106
increases the protein expression of survivin, which promotes cell viability and resistance to paclitaxel-mediated cell death in human osteosarcoma cells.
Materials and Methods Materials
Anti-rabbit and anti-mouse IgG-conjugated horseradish peroxidase, rabbit polyclonal antibodies (specific for p65, IB), and mouse monoclonal antibodies (specific for CTGF, survivin, poly[ADP-ribose] polymerase [PARP], phosphorylated IB and-tubulin) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Small interfering RNAs (siRNAs) against survivin, AMPK1, and AMPK2 were from the same supplier; an siRNA control in experiments using targeted siRNA transfection consisted of a scrambled sequence that will not lead to the specific degradation of any known cellular mRNA. Rabbit polyclonal antibodies specific for AMPKα phosphorylated at Thr172, p65 phosphorylated at Ser536, and AMPKα were purchased from Cell Signaling and Neuroscience (Danvers, MA). Ara-A, compound C, TPCK, and PDTC were purchased from Calbiochem (San Diego, CA, USA). Lipofectamine 2000 was purchased from Invitrogen (Carlsbad, CA, USA). Reporter lysis buffer was purchased from Promega (Madison, WI, USA).
Human osteosarcoma tissue arrays were purchased from Biomax (Rockville, MD, USA). All other chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA).
Cell culture
The human osteosarcoma cell lines (MG-63, U-2 OS, and HOS) were purchased from the American Type Cell Culture Collection (Manassas, VA, USA). MG-63 and 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
HOS cells were maintained in Dulbecco`s Modified Eagle Medium (DMEM) supplemented with 20 mM HEPES and 10% heat-inactivated FCS, 2 mM glutamine, penicillin (100 U/ml), and streptomycin (100 μg/ml) at 37 °C with 5% CO2. U-2 OS cells were maintained in McCoy’s 5A medium, which was supplemented with 10% FBS, penicillin (100 U/ml), and streptomycin (100 μg/ml) at 37 °C with 5% CO2.
Overexpression of CTGF with the pcDNA3.1-CTGF expression vector
The complete CTGF open reading frame was amplified by reverse transcription (RT)-PCR. Subsequent PCR amplification from RT reaction products was performed in 0.2 mM dNTPs, 1.5 mM MgCl2, 40 U/ml of Platinum® Pfx DNA Polymerase (Invitrogen, Groningen, The Netherlands), and 1 nmol of each PCR primer, designed to amplify the full-length CTGF DNA (sense: CCAACCATGACCGCCGCCAG, and antisense: TCATGCCATGTCTCCGTACATCTTCCTG). PCR products were purified from agarose gels using the Viogene Gel/PCR DNA Isolation System (Viogene, CA, USA). The complete CTGF was cloned into the topoisomerase-activated pcDNA3.1-TOPO vector (Invitrogen Carlsbad, CA).
Immunohistochemical staining
Human osteosarcoma tissue arrays were deparaffinized with xylene and rehydrated through addition of ethanol. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide in methanol for 10 min. Heat-induced antigen retrieval was carried out for all sections in 0.01 M sodium citrate buffer, pH 6 at 95°C for 25 min. Human CTGF antibody was applied at a dilution of 1:200 and incubated at 4°C overnight. The antibody-binding signal was detected using the NovoLink Polymer Detection System (Leica Microsystems) and visualized with the diaminobenzidine reaction. The sections were counterstained with hematoxylin. The 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158
immunohistochemistry results were scored by taking into account the percentage of positive detection and intensity of the staining. The intensity score was given as follows: 0, no staining; 1, weakly positive; 2, moderately positive; 3 and 4, strongly positive.
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay
Cell viability was determined by the MTT assay. Cells were plated in 96-well plates at a concentration of 2,000 cells per well. After treatment with paclitaxel, cultures were washed with PBS. Next, 0.5 mg/ml of MTT solution was added to each well and incubated at 37 °C for 30 min. To dissolve formazan crystals, culture medium was replaced with an equal volume of DMSO. After the mixture was shaken at room temperature for 10 min, absorbance of each well was determined at 550 nm using a microplate reader (Bio-Tek, Winooski, VT, USA).
Colony formation assay
Cells were plated in 12-well plates at a concentration of 1 × 104 cells per well. After treatment with paclitaxel for 48 h, cells were washed with PBS and replaced with fresh medium. Cells were allowed to form colonies for 14 days before being stained with crystal violet (0.4 g/l).
4′-6-diamidino-2-phenylindole (DAPI) staining
Apoptotic nuclei were detected using DAPI staining. Cells were plated in 6-well plates at a concentration of 1 × 106 cells per well. After being treated with paclitaxel at various concentrations for 48 h, cells were washed with PBS, fixed with 4% paraformaldehyde, and analyzed via fluorescence microscopy to assess chromatin condensation and segregation.
159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184
TUNEL assay
A terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end labeling (TUNEL) assay was also used to examine cell apoptosis using the BD ApoAlert™ DNA Fragmentation Assay Kit. Cells were incubated with paclitaxel for 24 h, trypsinized, fixed with 4% paraformaldehyde, and permeabilized with 0.1% Triton-X-100 in 0.1% sodium citrate. After being washed with PBS, the cells were incubated with the reaction mixture for 60 min at 37 °C. The stained cells were then analyzed with a flow cytometer.
Caspase-3 activity assay
Caspase-3 activity was measured by the direct assay of caspase-3 enzyme activity in cell lysates using synthetic chromogenic substrate (Ac-DEVD-pNA; substrate for caspase-3). Cell lysates were prepared and incubated with anti-caspase-3. Immunocomplexes were incubated with peptide substrate in assay buffer (100 mM NaCl, 50 mM 4-(2-hydroxyethyl)-1-piperazine-ethanesulphonic acid [HEPES], 10 mM dithiothreitol, 1 mM EDTA, 10% glycerol, and 0.1% 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate [CHAPS], pH 7.4) for 2 h at 37 °C. The release of p-nitroaniline was monitored at 405 nm. Results are the percent change in activity compared to an untreated control.
Western blot analysis
The cellular lysates were prepared as described previously . Protein concentration was determined using the Thermo Scientific Pierce BCA Protein Assay Kit (Thermo Fisher Scientific Inc., USA). Proteins were resolved on SDS-PAGE and transferred to immobilon polyvinyldifluoride (PVDF) membranes. The blots were 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210
blocked with 4% BSA for 1 h at room temperature and incubated with the primary antibodies for 1 h at room temperature. After 3 washes in tris-buffered saline with 0.05% Tween 20 (TBS-Tween), the blots were subsequently incubated with a donkey anti-rabbit or anti-mouse peroxidase-conjugated secondary antibody for 1 h at room temperature. The blots were visualized by enhanced chemiluminescence using Kodak X-OMAT LS film (Eastman Kodak, Rochester, NY). Quantitative data were obtained using a computing densitometer and ImageQuant software (Molecular Dynamics, Sunnyvale, CA).
Quantitative real-time PCR
Total RNA was extracted from osteosarcoma cells using a TRIzol kit (MDBio Inc., Taipei, Taiwan). The reverse transcription reaction was performed using 2 μg of total RNA that was reverse transcribed into cDNA using an oligo(dT) primer. A volume of 100 ng total cDNA was added per 25-µl reaction, along with sequence-specific primers and Taqman® probes. Sequences for all target gene primers and probes were purchased commercially (β-actin was used as the internal control) (Applied Biosystems). qPCR assays were carried out in triplicate using a StepOnePlus sequence detection system. The cycling conditions were 10 min of polymerase activation at 95 °C, followed by 40 cycles at 95 °C for 15 s and 60 °C for 60 s. The threshold was set above the non-template control background and within the linear phase of target gene amplification to calculate the cycle number at which the transcript was detected (denoted as CT).
Transfection and reporter gene assay
Human osteosarcoma cells were co-transfected with 0.8 mg B-luciferase plasmid, 0.4 mg -galactosidase expression vector. Cells were grown to 80%
211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236
confluence in 12 well plates and were transfected on the following day with Lipofectamine 2000 (LF2000). DNA and LF2000 were premixed for 20 min and then applied to cells. After 24 h transfection, the cells were then incubated with the indicated agents. After 24 h incubation, the media were removed, and cells were washed once with cold PBS. To prepare lysates, 100 ml reporter lysis buffer was added to each well, and cells were scraped from dishes. The supernatant was collected after centrifugation at 13,000 rpm for 2 min. Aliquots of cell lysates (20 ml) containing equal amounts of protein (20–30 mg) were placed into wells of an opaque black 96-well microplate. An equal volume of luciferase substrate was added to all samples, and luminescence was measured in a microplate luminometer. The value of luciferase activity was normalized to transfection efficiency monitored by the co-transfected -galactosidase expression vector.
Murine xenograft experiments
To generate murine subcutaneous tumors, 1 × 106 osteosarcoma cells were injected subcutaneously into the right flanks of nude mice (purchased from the National Science Council Animal Center, Taipei, Taiwan). Four weeks after injection, the subcutaneous tumor size had reached a diameter of approximately 1000 mm3, and the mice received intraperitoneal (i.p.) injections of paclitaxel (20 mg/kg) twice a week thereafter. Tumor volumes were calculated by the following formula: length × width2 × /6. All mice were manipulated in accordance with the Animal Care and Use Guidelines of the China Medical University (Taichung, Taiwan), under a protocol approved by the Institutional Animal Care and Use Committee.
Statistics
The values given are mean ± SEM. The significance of difference between the 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262
experimental groups and controls was assessed by Student’s t test. The difference was considered significant if the p value was less than 0.05.
Results
Overexpression CTGF cells increases chemotherapy resistance to paclitaxel in
human osteosarcoma
Previous studies have demonstrated that CTGF expression confers resistance to chemotherapeutic agents in ovarian and breast cancer . We hypothesized that CTGF may also be involved in chemotherapy resistance in osteosarcoma. First, we used immunohistochemical staining to detect CTGF expression in osteosarcoma patients. We found that the expression of CTGF in osteosarcoma patients was significantly higher than the CTGF expression in normal bone tissues (Figs. 1A and 1B). Next, we examined the relationship between CTGF expression and chemotherapy effects on human osteosarcoma. To this end, the CTGF-overexpression cell lines MG-63/CTGF, HOS/CTGF, and U-2 OS/CTGF cells were established. Using the MTT assay, we observed that overexpression of CTGF protected the cells from paclitaxel-induced growth inhibition (Figs. 1C-E). These results indicated that CTGF conferred resistance to paclitaxel in human osteosarcoma cells. We next compared chemoresistance after paclitaxel stimulation among 3 osteosarcoma cell lines. We found that the U-2 OS cells were more resistant to paclitaxel than the MG-63 and HOS cells were (Supplementary Figure S1). In addition, western blotting showed that expression of CTGF was higher in the U-2 OS cells than in the MG-63 cells (Supplementary figure S2). To confirm that CTGF conferred resistance to paclitaxel treatment, we created stable U-2 OS cell lines expressing CTGF short hairpin RNA (U-2 OS/CTGF shRNA) and control short hairpin RNA (U-2 OS/Control shRNA). 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288
Using a colony-formation assay, we found that knockdown of CTGF expression via CTGF shRNA in U-2 OS cells drastically decreased colony-forming ability of the cells upon exposure to paclitaxel (Figs. 1F and 1G). These data indicated that CTGF plays an important role in increasing the resistance of osteosarcoma cells to paclitaxel.
CTGF promotes cell survival by inhibiting paclitaxel-induced apoptosis
Paclitaxel interacts with microtubules and induces apoptosis in various tumor cells . Exposing osteosarcoma cells to paclitaxel has been shown to increase apoptosis in these cells . Because cleavage of the PARP protein can serve as a marker for cells undergoing apoptosis , we used PARP expression, detected by western blotting, to determine whether CTGF-induced cell survival is mediated through inhibition of apoptosis. As shown in Figure 2A, paclitaxel treatment resulted in higher PARP cleavage in MG-63/vector, HOS/vector, and U-2 OS/vector cells than in cells overexpressing CTGF. To further confirm that CTGF-induced resistance is mediated through inhibition of apoptosis, TUNEL staining, DAPI staining, and caspase-3 activity assays were also used to detect cell apoptosis in osteosarcoma cells. We again found that overexpression of CTGF significantly decreased paclitaxel-mediated cell apoptosis (Figs. 2B, 2D, and 2F). In contrast, decreased CTGF expression promoted paclitaxel-induced apoptosis (Figs. 2C, 2E, and 2G). These data confirmed that CTGF-induced resistance to paclitaxel is mediated through inhibition of apoptosis.
Survivin is involved in CTGF-mediated chemoresistance
Survivin has been demonstrated to play a role in inhibiting both caspase-dependent and incaspase-dependent apoptosis . In glioblastoma multiforme, high levels of CTGF mRNA are directly correlated with advanced tumor stage because CTGF can induce the expression of survivin . We found that the protein and mRNA expression 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314
of survivin increased in CTGF-overexpressing cells (Figs. 3A and 3B). To determine whether survivin is involved in the CTGF-mediated chemoresistance, we pretreated cells with control or survivin siRNA for 48 h before paclitaxel treatment. As shown in Figures 3C and 3D, CTGF-mediated resistance to paclitaxel-induced cell death was significantly inhibited in the survivin siRNA-transfected cells, but not in the control siRNA-transfected cells. This result was confirmed by observation in the TUNEL assay indicating increased DNA fragmentation in the survivin siRNA-transfected cells (Fig. 3D). These results indicated that survivin plays an important role in CTGF-induced paclitaxel resistance in human osteosarcoma cells.
AMPK and NF-B signaling pathways are involved in CTGF-mediated survivin
expression and chemoresistance
AMP-activated protein kinase (AMPK)-dependent nuclear factor kappa B (NF-B) activation has been reported to mediate survivin expression and cell death . We therefore examined whether AMPK and NF-B pathways are involved in CTGF-mediated survivin expression and chemoresistance. Stimulation of MG-63/CTGF cells with paclitaxel increased AMPK and p65 phosphorylation (Fig. 4A). The activity of NF-B is primarily regulated by interaction with inhibitory IB proteins, and IB is the best-studied member of the IB family of proteins and displays all defining characteristics of an NF-B inhibitor . We also found that paclitaxel increased IBphosphorylation (Fig. 4A). In addition, the NF-B-luciferase activity was also increased after treatment with paclitaxel time-dependently (Fig. 4B). Furthermore, pretreatment of cells with AMPK inhibitors (Ara A or compound C),
NF-B inhibitor (PDTC), IκB protease inhibitor (TPCK) or NEMO-binding domain peptide (NBD peptide, NF-B selective inhibitor peptide) decreased the CTGF-315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339
mediated chemoresistance (Fig. 4C-F), suggesting that the AMPK and NF-B signaling pathways mediated CTGF-increased resistance to paclitaxel. There are 2-subunits (1 and 2) of AMPK that contain different catalytic sites . To determine which AMPK catalytic subunit is involved in CTGF-mediated chemoresistance, siRNA against AMPK1 and AMPK2 was used. As shown in Figures 4C and 4D, whereas transfection of cells with AMPK1 markedly reduced the CTGF-mediated chemoresistance, no such effect was observed after transfecting cells with AMPKsiRNA. Therefore, AMPK1 but not AMPKis involved in CTGF-promoted chemoresistance to paclitaxel in human osteosarcoma. To further confirm the AMPK-dependent NF-B signaling pathways are involved in CTGF-mediated survivin protein expression, we pretreated MG-63/CTGF cells with Ara A, compound C, PDTC, or TPCK abolished paclitaxel-increased p65 phosphorylation and survivin expression (Fig. 4G). Therefore, AMPK-dependent NF-B activation is involved in CTGF-mediated survivin expression and chemoresistance to paclitaxel in human osteosarcoma cells.
CTGF confers drug resistance to paclitaxel in a mouse xenograft model
To determine whether CTGF is also involved in paclitaxel-increased resistance in vivo, the nude mice xenograft model was used. The MG-63/vector, MG-63/CTGF, U-2 OS/Control shRNA, or U-2 OS/CTGF shRNA cells were injected into the flanks of nude mice. After 45 days, the mice were sacrificed, and tumor volume and weight were measured. Remarkably, CTGF overexpression in osteosarcoma cells induced a 2.6-fold higher tumor volume and 2-fold higher tumor weight than the control cells (Fig. 5A, C, and D). Knockdown of CTGF expression in U-2 OS cells increased the cytotoxic effect of paclitaxel and decreased the tumor weight (Figs. 5B, C, and D). 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364
The protein levels of survivin in tumor tissues of these four groups were also measured. Western blotting showed that the protein levels of CTGF and survivin were significantly higher in the CTGF-overexpressing group than those in the control group. However, knockdown of CTGF expression had contrasting results (Fig. 5E). These data provide in vivo evidence supporting the hypothesis that CTGF is a potential oncogene that contributes to anti-chemotherapeutic effects in human osteosarcoma.
Discussion and conclusions
Today, most patients with osteosarcoma are treated with conventional treatment strategies. However, approximately 30% of these patients relapse, and only a few do not die . This is because tumor cells in osteosarcoma patients can develop resistance to chemotherapy drugs. Therefore, it is important to identify potential targets for preventing the development of osteosarcoma tumor resistance to chemotherapy drugs. Here, we have shown that overexpressing CTGF in human osteosarcoma cells promotes the cells’ survival through inhibiting paclitaxel-induced apoptosis in vitro and in vivo. We also found that upregulated expression of survivin-mediated through AMPK-dependent NF-B signaling pathways-plays a role in the CTGF-promoted resistance to paclitaxel. Overall, our results suggest that CTGF plays an important role in osteosarcoma progression by increasing the resistance of cancer cells to paclitaxel-based chemotherapy.
CTGF is a multifunctional signaling protein involved in a wide variety of biological and pathologic processes . The role of CTGF in cancer remains controversial, however. In some studies, CTGF has been shown to be a factor in improved survival in patients . For example, in colorectal cancer, patients showed better overall survival when their tumors displayed higher CTGF expression. In 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391
chondrosarcoma patients, the expression of CTGF also correlates with survival rates in patients . Moreover, in human lung adenocarcinoma, CTGF inhibits metastasis and invasion . However, in human rhabdomyosarcoma, disrupting CTGF expression by using CTGF-neutralizing antibodies increases apoptosis and inhibits angiogenesis . CTGF also inhibits cell growth in squamous cell carcinoma . Thus, the relationship between CTGF proteins and cancer progression cannot be generalized across different types of cancers. Our data have shown that the expression of CTGF protein was significantly higher in human osteosarcoma than in normal tissues, suggesting that CTGF plays an important role in tumor progression. Previous studies have showed that CTGF expression confers resistance to chemotherapeutic agents in breast cancer and ovarian cancer . These observations are consistent with our results indicating that overexpressing CTGF in MG-63 cells (which normally have low CTGF, expression and are paclitaxel sensitive) directly increases the resistance to paclitaxel-induced cell death. On the other hand, knockdown of endogenous CTGF expression in U-2 OS cells (which normally have high CTGF, drug- expression and are paclitaxel resistant) sensitized cells to paclitaxel treatment. In this study, overexpression of CTGF has only significantly reduced the effects of paclitaxel, but not completely mitigated the effects. That means there are other mechanisms also operating for the action of paclitaxel, which are CTGF-independent. Previous study showed that the growth arrest and DNA damage-inducible 45 alpha protein (GADD45α), a stress signal response gene involved in regulation of DNA repair and apoptosis, was significantly induced in osteosarcoma cells after exposure to paclitaxel . RAIDD (RIP associated ICH-1/CED-3-homologous protein with a death domain) is an apoptosis associate gene, was also found lower expressed in osteosarcoma multidrug resistant cell line. Transfection of osteosarcoma multidrug resistant cell line with RAIDD reversed the paclitaxel-mediated resistance . Autophagy is one of another mechanism that observed during paclitaxel-induced apoptosis in Saos-2 osteosarcoma cells . Therefore, GADD45α, RAIDD and autophagy may play a role in CTGF-independent mechanism after paclitaxel treatment. However, this hypothesis is needs further examination. In our mouse xenografts experiments, we observed that CTGF expression protects osteosarcoma cells from paclitaxel treatment, and eliminating CTGF expression in cancer cells significantly increases the therapeutic effect of paclitaxel. These data indicate that CTGF plays an important role in increasing the resistance of osteosarcoma cells to paclitaxel.
It has been indicated that failure to activate the intrinsic apoptotic program is one of a recognized mechanism of drug resistance . Increasing evidence suggests that survivin increases telomerase activity during the development of chemotherapy 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428
resistance and that survivin plays a role in cancer metastasis . Here, we found that overexpressing CTGF increased the expression of survivin. In addition, knockdown of survivin expression significantly reduced CTGF-mediated chemoresistance to paclitaxel. Previous studies have reported similar results indicating that direct or indirect inhibition of survivin decreases the proliferation and cell viability of osteosarcoma cells . In addition, inhibiting survivin in HeLa cells promoted caspase-dependent cell death . Furthermore, shRNA-mediated inhibition of survivin expression in human SAOS2 osteosarcoma cells enhanced sensitivity of these cells to cisplatin and doxorubicin . According to these results, survivin is an important downstream effector of increased resistance against chemotherapy-induced cell apoptosis in osteosarcoma cells, and CTGF might confer paclitaxel resistance in osteosarcoma cells by increasing survivin expression.
It has been reported that AMPK-dependent NF-B activation is involved in survivin expression and cell death . In the current study, we found that CTGF increased the expression of AMPK and p65 activation in osteosarcoma cells. Furthermore, inhibitors of AMPK and NF-B reversed the CTGF-mediated resistance to paclitaxel. AMPK contains two -subunits, which have different catalytic sites. Here we report that transfection of cells with AMPK1 but not with AMPK2 siRNA markedly blocked CTGF-induced chemoresistance. Therefore, AMPK1 appears to be more important than AMPK2 in the CTGF-mediated resistance to paclitaxel. Furthermore, we also showed that AMPK and NF-B inhibitors abolished CTGF-induced p65 phosphorylation and survivin expression. These results suggest that the AMPK-dependent NF-B signaling pathway is important for CTGF-induced survivin expression and chemoresistance to paclitaxel.
In conclusion, we have shown that overexpression of CTGF in osteosarcoma 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453
cells increased cell survival by inhibiting paclitaxel-induced apoptosis. Our in vitro results and in vivo xenograft studies showed that overexpression of CTGF significantly increased tumor cell survival, and that suppression of CTGF expression significantly increased the sensitivity of osteosarcoma cells to paclitaxel. Thus, we conclude that CTGF might be a critical oncogene, and we believe that these data support an investigation of CTGF as a strategic target in osteosarcoma therapy.
Acknowledgments
This study was supported by grant from the National Science Council of Taiwan (NSC99-2320-B-039-003-MY3; 100-2320-B-039-028-MY3).
Conflict of Interest Statement
The authors have no financial or personal relationships that could inappropriately influence this research.
References
[1] J. Gill, M.K. Ahluwalia, D. Geller, R. Gorlick, New targets and approaches in osteosarcoma, Pharmacol Ther, 137 (2013) 89-99.
[2] S.C.L. Hsu, J. H. Wen, S. W. Chueh, F. S., Crude extract of Rheum palmatum inhibits migration and invasion of U-2 OS human osteosarcoma cells by suppression of matrix metalloproteinase-2 and -9, BioMedicine, 3 (2013) 120-129.
[3] E. Desandes, Survival from adolescent cancer, Cancer Treat Rev, 33 (2007) 609-615.
[4] K.H. Lu, K.H. Lue, M.C. Chou, J.G. Chung, Paclitaxel induces apoptosis via caspase-3 activation in human osteogenic sarcoma cells (U-2 OS), J Orthop Res, 2caspase-3 (2005) 988-994.
[5] G.A. Orr, P. Verdier-Pinard, H. McDaid, S.B. Horwitz, Mechanisms of Taxol resistance related to microtubules, Oncogene, 22 (2003) 7280-7295.
454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483
[6] W.C.C. Huang, Y. J. Hung, M. C., Implication of nuclear EGFR in the development of resistance to anticancer therapies, BioMedicine, 1 (2011) 2-10.
[7] S.S. Bielack, B. Kempf-Bielack, G. Delling, G.U. Exner, S. Flege, K. Helmke, R. Kotz, M. Salzer-Kuntschik, M. Werner, W. Winkelmann, A. Zoubek, H. Jurgens, K. Winkler, Prognostic factors in high-grade osteosarcoma of the extremities or trunk: an analysis of 1,702 patients treated on neoadjuvant cooperative osteosarcoma study group protocols, J Clin Oncol, 20 (2002) 776-790.
[8] F. Lamoureux, P. Richard, Y. Wittrant, S. Battaglia, P. Pilet, V. Trichet, F. Blanchard, F. Gouin, B. Pitard, D. Heymann, F. Redini, Therapeutic relevance of osteoprotegerin gene therapy in osteosarcoma: blockade of the vicious cycle between tumor cell proliferation and bone resorption, Cancer Res, 67 (2007) 7308-7318.
[9] D.R. Brigstock, The connective tissue growth factor/cysteine-rich
61/nephroblastoma overexpressed (CCN) family, Endocr Rev, 20 (1999) 189-206. [10] A. Leask, D.J. Abraham, All in the CCN family: essential matricellular signaling modulators emerge from the bunker, J Cell Sci, 119 (2006) 4803-4810.
[11] A. Leask, C.P. Denton, D.J. Abraham, Insights into the molecular mechanism of chronic fibrosis: the role of connective tissue growth factor in scleroderma, J Invest Dermatol, 122 (2004) 1-6.
[12] C. Wenger, V. Ellenrieder, B. Alber, U. Lacher, A. Menke, H. Hameister, M. Wilda, T. Iwamura, H.G. Beger, G. Adler, T.M. Gress, Expression and differential regulation of connective tissue growth factor in pancreatic cancer cells, Oncogene, 18 (1999) 1073-1080.
[13] C.L. Steffen, D.K. Ball-Mirth, P.A. Harding, N. Bhattacharyya, S. Pillai, D.R. Brigstock, Characterization of cell-associated and soluble forms of connective tissue growth factor (CTGF) produced by fibroblast cells in vitro, Growth Factors, 15 (1998) 199-213.
[14] P. Vorwerk, H. Wex, B. Hohmann, Y. Oh, R.G. Rosenfeld, U. Mittler, CTGF (IGFBP-rP2) is specifically expressed in malignant lymphoblasts of patients with acute lymphoblastic leukaemia (ALL), Br J Cancer, 83 (2000) 756-760.
[15] E.C. Finger, C.F. Cheng, T.R. Williams, E.B. Rankin, B. Bedogni, L. Tachiki, S. Spong, A.J. Giaccia, M.B. Powell, CTGF is a therapeutic target for metastatic melanoma, Oncogene, (2013).
[16] A. Dhar, A. Ray, The CCN family proteins in carcinogenesis, Experimental oncology, 32 (2010) 2-9.
[17] D. Lai, K.C. Ho, Y. Hao, X. Yang, Taxol resistance in breast cancer cells is mediated by the hippo pathway component TAZ and its downstream transcriptional targets Cyr61 and CTGF, Cancer Res, 71 (2011) 2728-2738.
[18] K.L. Sodek, M.J. Ringuette, T.J. Brown, Compact spheroid formation by ovarian 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521
cancer cells is associated with contractile behavior and an invasive phenotype, Int J Cancer, 124 (2009) 2060-2070.
[19] S.B. Horwitz, Taxol (paclitaxel): mechanisms of action, Ann Oncol, 5 Suppl 6 (1994) S3-6.
[20] F. Li, Survivin study: what is the next wave?, J Cell Physiol, 197 (2003) 8-29. [21] X. Ling, R.J. Bernacki, M.G. Brattain, F. Li, Induction of survivin expression by taxol (paclitaxel) is an early event, which is independent of taxol-mediated G2/M arrest, J Biol Chem, 279 (2004) 15196-15203.
[22] N. Zaffaroni, M. Pennati, G. Colella, P. Perego, R. Supino, L. Gatti, S. Pilotti, F. Zunino, M.G. Daidone, Expression of the anti-apoptotic gene survivin correlates with taxol resistance in human ovarian cancer, Cell Mol Life Sci, 59 (2002) 1406-1412. [23] E. Osaka, T. Suzuki, S. Osaka, Y. Yoshida, H. Sugita, S. Asami, K. Tabata, A. Hemmi, M. Sugitani, N. Nemoto, J. Ryu, Survivin as a prognostic factor for osteosarcoma patients, Acta Histochem Cytochem, 39 (2006) 95-100.
[24] Y.C. Chiu, C.Y. Lin, C.P. Chen, K.C. Huang, K.M. Tong, C.Y. Tzeng, T.S. Lee, H.C. Hsu, C.H. Tang, Peptidoglycan enhances IL-6 production in human synovial fibroblasts via TLR2 receptor, focal adhesion kinase, Akt, and AP-1- dependent pathway, J Immunol, 183 (2009) 2785-2792.
[25] S.H. Kaufmann, S. Desnoyers, Y. Ottaviano, N.E. Davidson, G.G. Poirier, Specific proteolytic cleavage of poly(ADP-ribose) polymerase: an early marker of
chemotherapy-induced apoptosis, Cancer Res, 53 (1993) 3976-3985.
[26] T. Liu, B. Brouha, D. Grossman, Rapid induction of mitochondrial events and caspase-independent apoptosis in Survivin-targeted melanoma cells, Oncogene, 23 (2004) 39-48.
[27] D. Yin, W. Chen, J. O'Kelly, D. Lu, M. Ham, N.B. Doan, D. Xie, C. Wang, J. Vadgama, J.W. Said, K.L. Black, H.P. Koeffler, Connective tissue growth factor associated with oncogenic activities and drug resistance in glioblastoma multiforme, Int J Cancer, 127 (2010) 2257-2267.
[28] C. Liu, B. Liang, Q. Wang, J. Wu, M.H. Zou, Activation of AMP-activated protein kinase alpha1 alleviates endothelial cell apoptosis by increasing the expression of anti-apoptotic proteins Bcl-2 and survivin, J Biol Chem, 285 (2010) 15346-15355. [29] A. Oeckinghaus, S. Ghosh, The NF-kappaB family of transcription factors and its regulation, Cold Spring Harbor perspectives in biology, 1 (2009) a000034.
[30] G. Carvalho, C. Fabre, T. Braun, J. Grosjean, L. Ades, F. Agou, E. Tasdemir, S. Boehrer, A. Israel, M. Veron, P. Fenaux, G. Kroemer, Inhibition of NEMO, the
regulatory subunit of the IKK complex, induces apoptosis in high-risk myelodysplastic syndrome and acute myeloid leukemia, Oncogene, 26 (2007) 2299-2307.
[31] B.E. Kemp, D. Stapleton, D.J. Campbell, Z.P. Chen, S. Murthy, M. Walter, A. Gupta, 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559
J.J. Adams, F. Katsis, B. van Denderen, I.G. Jennings, T. Iseli, B.J. Michell, L.A. Witters, AMP-activated protein kinase, super metabolic regulator, Biochem Soc Trans, 31 (2003) 162-168.
[32] P. Bornstein, E.H. Sage, Matricellular proteins: extracellular modulators of cell function, Curr Opin Cell Biol, 14 (2002) 608-616.
[33] L.H. Pan, T. Beppu, A. Kurose, K. Yamauchi, A. Sugawara, M. Suzuki, A. Ogawa, T. Sawai, Neoplastic cells and proliferating endothelial cells express connective tissue growth factor (CTGF) in glioblastoma, Neurol Res, 24 (2002) 677-683.
[34] N. Schutze, U. Noth, J. Schneidereit, C. Hendrich, F. Jakob, Differential expression of CCN-family members in primary human bone marrow-derived mesenchymal stem cells during osteogenic, chondrogenic and adipogenic differentiation, Cell Commun Signal, 3 (2005) 5.
[35] H. Heuer, S. Christ, S. Friedrichsen, D. Brauer, M. Winckler, K. Bauer, G. Raivich, Connective tissue growth factor: a novel marker of layer VII neurons in the rat cerebral cortex, Neuroscience, 119 (2003) 43-52.
[36] T. Shakunaga, T. Ozaki, N. Ohara, K. Asaumi, T. Doi, K. Nishida, A. Kawai, T. Nakanishi, M. Takigawa, H. Inoue, Expression of connective tissue growth factor in cartilaginous tumors, Cancer, 89 (2000) 1466-1473.
[37] C.C. Chang, J.Y. Shih, Y.M. Jeng, J.L. Su, B.Z. Lin, S.T. Chen, Y.P. Chau, P.C. Yang, M.L. Kuo, Connective tissue growth factor and its role in lung adenocarcinoma invasion and metastasis, J Natl Cancer Inst, 96 (2004) 364-375.
[38] S. Croci, L. Landuzzi, A. Astolfi, G. Nicoletti, A. Rosolen, F. Sartori, M.Y. Follo, N. Oliver, C. De Giovanni, P. Nanni, P.L. Lollini, Inhibition of connective tissue growth factor (CTGF/CCN2) expression decreases the survival and myogenic differentiation of human rhabdomyosarcoma cells, Cancer Res, 64 (2004) 1730-1736.
[39] N.H. Moritani, S. Kubota, T. Nishida, H. Kawaki, S. Kondo, T. Sugahara, M. Takigawa, Suppressive effect of overexpressed connective tissue growth factor on tumor cell growth in a human oral squamous cell carcinoma-derived cell line, Cancer Lett, 192 (2003) 205-214.
[40] B. Wang, Q. Xiong, Q. Shi, X. Le, J.L. Abbruzzese, K. Xie, Intact nitric oxide
synthase II gene is required for interferon-beta-mediated suppression of growth and metastasis of pancreatic adenocarcinoma, Cancer Res, 61 (2001) 71-75.
[41] C. Yang, S. Yang, K.B. Wood, F.J. Hornicek, J.H. Schwab, G. Fondren, H. Mankin, Z. Duan, Multidrug resistant osteosarcoma cell lines exhibit deficiency of GADD45alpha expression, Apoptosis : an international journal on programmed cell death, 14 (2009) 124-133.
[42] C. Yang, F.J. Hornicek, K.B. Wood, J.H. Schwab, H. Mankin, Z. Duan, RAIDD expression is impaired in multidrug resistant osteosarcoma cell lines, Cancer 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597
chemotherapy and pharmacology, 64 (2009) 607-614.
[43] H.J. Kim, S.G. Lee, Y.J. Kim, J.E. Park, K.Y. Lee, Y.H. Yoo, J.M. Kim, Cytoprotective role of autophagy during paclitaxel-induced apoptosis in Saos-2 osteosarcoma cells, International journal of oncology, 42 (2013) 1985-1992.
[44] S.G. Prabhudesai, S. Rekhraj, G. Roberts, A.W. Darzi, P. Ziprin, Apoptosis and chemo-resistance in colorectal cancer, Journal of surgical oncology, 96 (2007) 77-88. [45] T. Endoh, N. Tsuji, K. Asanuma, A. Yagihashi, N. Watanabe, Survivin enhances telomerase activity via up-regulation of specificity protein 1- and c-Myc-mediated human telomerase reverse transcriptase gene transcription, Exp Cell Res, 305 (2005) 300-311.
[46] L. Wang, G.M. Zhang, Z.H. Feng, Down-regulation of survivin expression reversed multidrug resistance in adriamycin-resistant HL-60/ADR cell line, Acta Pharmacol Sin, 24 (2003) 1235-1240.
[47] S. Mehrotra, L.R. Languino, C.M. Raskett, A.M. Mercurio, T. Dohi, D.C. Altieri, IAP regulation of metastasis, Cancer Cell, 17 (2010) 53-64.
[48] S.L. Fossey, A.T. Liao, J.K. McCleese, M.D. Bear, J. Lin, P.K. Li, W.C. Kisseberth, C.A. London, Characterization of STAT3 activation and expression in canine and human osteosarcoma, BMC Cancer, 9 (2009) 81.
[49] F. Li, E.J. Ackermann, C.F. Bennett, A.L. Rothermel, J. Plescia, S. Tognin, A. Villa, P.C. Marchisio, D.C. Altieri, Pleiotropic cell-division defects and apoptosis induced by interference with survivin function, Nat Cell Biol, 1 (1999) 461-466.
[50] J. Zou, M. Gan, N. Mao, X. Zhu, Q. Shi, H. Yang, Sensitization of osteosarcoma cell line SaOS-2 to chemotherapy by downregulating survivin, Arch Med Res, 41 (2010) 162-169. 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623
Figure legends
Figure 1. CTGF increases resistance to paclitaxel-mediated cell death.
(A) Immunohistochemistry of CTGF expression in normal bone and osteosarcoma tissues [normal (n = 7); IIb stage OS (n = 6); IIIb stage OS (n = 7)]. (B) Quantitative data from the tissues shown in panel A. (C–E) Cells were treated with paclitaxel for 24 h, and the cell viability was analyzed by using the MTT assay. (F) U-2 OS cells were transfected with control or CTGF shRNA, and the expression of CTGF was examined by western blotting. (G) Cells were treated with paclitaxel (10 M) for 48 h and then transferred to fresh medium. After culture for 14 days, the colonies were stained by crystal violet. Each experiment was done in triplicate. Results are expressed as means ± S.E.M. *, difference between the means of U-2 OS/CTGF shRNA group and the mean of U-2 OS/control shRNA group was statistically significant at p < 0.05.
Figure 2. CTGF-induced resistance is mediated through inhibition of apoptosis.
(A) Cells were treated with paclitaxel (10 M) for 24 h, and the PARP expression was examined by western blotting. (B-G) Cells were treated with paclitaxel (10 M) for 24 h, and cell apoptosis was examined by using TUNEL analysis (B and C), a DAPI assay (D and E), and caspase 3 activity (F and G). Each experiment was done in triplicate. Results are expressed as means ± S.E.M. *, difference between means and the mean of the control group was statistically significant at p < 0.05.
Figure 3. Survivin is involved in CTGF-mediated chemoresistance.
(A) Expression of survivin protein examined by western blotting and (B) expression of survivin mRNA measured by q-PCR. (C and D) Cells were transfected with control or survivin siRNA. (C) Cell viability and apoptosis were analyzed by using the MTT 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649
assay and (D) TUNEL analysis. Each experiment was done in triplicate. Results are expressed as means ± S.E.M. *, difference between means and the mean of the control group was statistically significant at p < 0.05.
Figure 4. AMPK and NF-B signaling pathways are involved in CTGF-mediated
chemoresistance and survivin expression.
(A) Cells were treated with paclitaxel (10 M) for the time intervals indicated, and phosphorylation of AMPK, IB, p65 and -tubulin was examined by western blotting. (B) Cells transiently transfected with NF-B-luciferase plasmid for 24 h before incubation with paclitaxel (10 M) for 24 h. Luciferase activity was measured, and the results were normalized to the -galactosidase activity. (C–F) Cells were pretreated with Ara A (0.5 mM), compound C (10 M), PDTC (10 M), TPCK (10 M), and NBD peptide (50 μg/ml), or were transfected with AMPK1 and AMPK2 siRNAs, followed by stimulation with paclitaxel for 24 h. Apoptosis was assessed using the MTT assay (C and E) and TUNEL analysis (D and F). (G) MG-63/CTGF cells were pretreated with Ara A, compound C, PDTC, or TPCK for 1 h; this was followed by stimulation with paclitaxel for 24 h, and p65 phosphorylation and survivin expression were examined by western blotting. Each experiment was done in triplicate. Results are expressed as means ± S.E.M. *, difference between means and the mean of the control group and #, difference between means and the mean of the MG-63 cells treated with paclitaxel group, which were statistically significant at p < 0.05.
Figure 5. CTGF increases resistance to paclitaxel in a nude mouse xenograft model.
(A and B) Tumor growth curves of human osteosarcoma cells treated with paclitaxel 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675
for 45 days. (C) Tumor weight measured after mice were sacrificed. (D) Representative photomicrographs of MG-63/vector, MG-63/CTGF, U-2 OS/Control shRNA, and U-2 OS/CTGF shRNA cells from nude mice. (E) Western blotting analysis to determine the protein levels of CTGF, survivin, and -tubulin (control) in tumor cells. 676 677 678 679 680