Oligohydramnios Decreases Platelet-Derived Growth Factor Expression in Fetal Rat Lungs (in press)

(1)

Fax +41 61 306 12 34 E-Mail karger@karger.ch www.karger.com

Original Paper

Neonatology 2007;92:187–193 DOI: 10.1159/000XXXXXX

Oligohydramnios Decreases

Platelet-Derived Growth Factor

Expression in Fetal Rat Lungs

Chung-Ming Chen

a

_{Leng-Fang Wang}

b

_{Hsiu-Chu Chou}

c

_{Yaw-Dong Lang}

d a

Department of Pediatrics, Taipei Medical University Hospital, Departments of b Biochemistry and c Anatomy and d

Graduate Institute of Medical Sciences, College of Medicine, Taipei Medical University, Taipei , Taiwan

Introduction

Pulmonary hypoplasia is common in the perinatal pe-riod and is a significant cause of death in newborn infants [1] . Oligohydramnios is one of the most common associ-ated abnormalities. Oligohydramnios may retard fetal lung growth and results in pulmonary hypoplasia in ex-perimental animals and in human fetuses, with pro-longed rupture of the membrane [2–4] . Platelet-derived growth factor (PDGF) is important for alveolarization of the normally developing lung [5] . PDGFs are homodi-mers or heterodihomodi-mers consisting of two distinct polypep-tide chains (A and B) which can be dimerized via sulfhy-dryl bridges to form three bioactive isoforms (AA, BB, and AB) [6] . Physical forces are important in regulating fetal lung growth and maturation [7, 8] . The main physi-cal force that the lung experiences is stretching induced by lung fluid in the airspaces during normal lung devel-opment [9] . The fluid maintains the lungs in an

Key Words

Alveolarization Elastin Pulmonary hypoplasia

Abstract

Objective: To evaluate the effects of experimental oligohy-dramnios on lung growth, expression of platelet-derived growth factor (PDGF) and its receptors, and lung morphology in fetal rats. Methods: On day 16 of gestation, we anesthe-tized timed pregnant Sprague-Dawley dams and punctured uterine wall and fetal membranes of each uterine sac which resulted in oligohydramnios. The fetuses in the opposite uter-ine horn served as controls. On days 19 and 21 of gestation, the fetuses were delivered by cesarean section and weighed, and the lungs were dissected free and weighed. Results: Rats exposed to oligohydramnios exhibited significantly lower lung/body weight ratios on days 19 and 21 of gestation and significantly lower radial saccular counts on day 21 of gesta-tion than did the control rats. Lung PDGF-A and PDGF-B gene and protein expression and elastin level were significantly de-creased in rats exposed to oligohydramnios on days 19 and 21 of gestation. The PDGF receptor alpha and beta gene ex-pression levels were significantly decreased in rats exposed to oligohydramnios on day 19 of gestation. Conclusion: A de-creased PDGF expression may be important in the

Received: September 4, 2006 Accepted after revision: January 3, 2007 Published online: $ $ $

formerly Biology of the Neonate

Dr. Chung-Ming Chen Department of Pediatrics Taipei Medical University Hospital Taipei 110 (Taiwan)

1661–7800/07/0923–0187$23.50/0 Accessible online at:

www.karger.com/neo

NEO008.indd 187

(2)

Chen /Wang /Chou /Lang

Neonatology 2007;92:187–193

188

ed state and provides the tissue with the mechanical stretching that is necessary for normal lung development [10] . Mechanical stretching may increase growth factor expression through intracellular signal transduction pathways [11] . PDGD-A and its receptor are essential in lung elastogenesis and alveolarization [12] . It has been demonstrated that mechanical strain increases the PDGF production and activates the PDGF receptors in vascular smooth muscle cells [13, 14] . Little is known about the ef-fects of oligohydramnios on lung PDGF and elastin in vivo. We hypothesized that oligohydramnios causes a decrement in lung distension and induces a smaller amount of mechanical stretch-induced PDGF activation and retarded lung development. Understanding the fac-tors that are associated with oligohydramnios will en-hance the development of therapies capable of promoting lung growth in such diseases, for which currently no spe-cific treatment is available.

Materials and Methods Animals

This study was approved by the Animal Care and Use Com-mittee at Taipei Medical University and was performed with timed pregnant Sprague-Dawley rats. On day 16 of gestation, pregnant dams were anesthetized with pentobarbital (50 mg/kg i.p.). Oligohydramnios _{was induced as previously described, with}

minor _{modifications [15–17] . An abdominal midline incision was}

made, and the two uterine horns were exposed and kept moist with phosphate-buffered saline. Uterine wall and fetal mem-branes of each uterine sac in one horn were punctured using a 19-gauge needle which resulted in immediate visible leakage of amniotic fluid and a decrease in the size of the uterine sac. Fe-tuses in the opposite uterine horn served as controls. The uterus was returned to the abdomen, and the abdominal incision was repaired. On days 19 and 21 of gestation, the dams were anesthe-tized by pentobarbital (50 mg/kg i.p.), and the fetuses were deliv-ered by cesarean section, killed by pentobarbital (100 mg/kg i.p.) before beginning to breathe, and weighed. The lungs were re-moved and weighed and the values expressed as percentage of body weight.

Reverse Transcription-Polymerase Chain Reaction

The left lung was ground into powder in liquid nitrogen, and the gene expression was measured with reverse transcription-polymerase chain reaction. Total RNA was extracted using the TRIzol reagent (Invitrogen Life Technologies, Paisley, UK), ac-cording to the manufacturer’s instructions. Reverse transcription was performed on 3 g of RNA with an oligo-dT primer and avi-an myeloblastosis virus reverse travi-anscriptase (Roche Molecular Biochemicals, Indianapolis, Ind., USA). The polymerase chain re-actions were carried out with the primers shown in table 1 . The polymerase chain reaction products were analyzed by electroresis on an agarose gel, stained with ethidium bromide, and pho-tographed. To determine the linear range of the polymerase chain

reaction, the intensity of amplified products was plotted against the cycle number. At least five samples on each gestational day were analyzed for each gene in each group and the results ex-pressed as percentage of -actin.

Western Blot Analysis

Lung tissues were homogenized in Tris buffer with protease

inhibitor cocktail tablets. Proteins were separated on SDS-PAGE under a nonreducing condition and electrotransferred to a poly-vinylidene difluoride membrane. The blots were incubated _for

2 h at room temperature in blocking buffer with mouse

monoclo-nal antibody against PDGF-AA and goat polyclomonoclo-nal antibody against PDGF-BB. After incubation with horseradish-peroxi-dase-conjugated anti-mouse or anti-goat IgG antibody, the im-munoreactive bands were detected by incubation with SuperSig-nal West Pico Chemiluminescent Substrate reagent (Pierce Bio-technology, Rockford, Ill., USA). The data were normalized to -actin for each animal.

Determination of Lung Elastin

Lung elastin was dye precipitated and quantified _{according to}

the manufacturer’s instructions using the Fastin elastin assay (Biocolor, Newtownabbey, Northern Ireland, UK). Briefly, 30 g of the extracted protein was mixed with 300 l reagent, and the tubes were shaken for 30 min to allow elastin-dye binding to complete. The unbound dye was removed by centrifugation at 16,000 g for 15 min, washed with ethanol, and dissolved in the alkaline dye. Finally, the samples were introduced into a micro-plate reader, and the absorbance was determined at 550 nm. The calibration curve for the spectrometer had been drawn using the supplied elastin standard. The elastin level in each specimen was obtained as an average of three readings.

Table 1. Oligonucleotide sequences of the primers used

Primer Sequence 5ʹ→3ʹ Product size, bp PDGF-A Forward AGGTGAGGTTAGAGGAGCAC 318 Reverse TCGCTCTCTGTGACAAGG PDGF-B Forward CACATTCTGGAGTCGAGTCG 426 Reverse TCACCCGAGTTTGAGGTGTC PDGFR- Forward AAGAGAGAGGACGAGACCAT 204 Reverse ACTTCTGTCTCCACATCACC PDGFR- Forward TACGTGTGAAGGTGTCAGAA 564 Reverse CAGACTCAATGACCTTCCAT Tropoelastin Forward TGGAGCCCTGGGATATCAAG 369 Reverse GAAGCACCAACATGTAGCAC -Actin Forward TTGTAACCAACTGGGACGATATGG 764 Reverse GATCTTGATCTTCATGGTGCTAGG NEO008.indd 188 NEO008.indd 188 30.04.2007 14:01:3930.04.2007 14:01:39

(3)

Oligohydramnios Decreases PDGF Expression

Neonatology 2007;92:187–193 189

Morphological Analysis

The right lungs were removed and fixed in 10% neutral buff-ered formalin on each gestational day in each group. Serial lung sections were cut at a thickness of 4 m and stained with hema-toxylin and eosin. The number of distal air sacs across the termi-nal respiratory units was estimated by the radial saccular count method [18] . This assessment was repeated for ten terminal respi-ratory units in random tissue sections per rat in each group (n = 6).

Immunohistochemistry

Immunohistochemical staining for PDGF-A and PDGF-B was performed on paraffin sections with immunoperoxidase visual-ization. After deparaffinization in xylene and rehydration in an alcohol series, the sections were first preincubated for 1 h at room temperature in 0.1 M phosphate-buffered saline containing 10% normal goat serum and 0.3% H 2 O 2 to block endogenous

peroxi-dase activity and nonspecific binding of antibody before being incubated for 20 h at 4 ° C with mouse monoclonal antibody

against AA and goat polyclonal antibody against PDGF-BB. The sections were then treated for 1 h at room temperature with biotinylated anti-mouse and anti-goat IgG. This was fol-lowed by reaction with the reagents from an ABC kit (avidin-bio-tin complex; Vector Laboratories, Burlingame, Calif., USA), ac-cording to the manufacturer’s recommendations, and the reac-tion products were visualized by 3,3 -diaminobenzidine and 0.003% H 2 O 2 in 0.5 M Tris buffer (pH 7.6), before the sections were

mounted on gelatin-coated slides using Permount (Fisher Scien-tific, Pittsburgh, Pa., USA).

Statistics

The results are presented as mean values 8 SEM. Compari-sons between control and oligohydramnios groups at equivalent gestational age were made using unpaired Student’s t test. Differ-ences were considered significant at p ! 0.05.

Results

There were 3 and 6 pregnant dams used on days 19 and 21 of gestation, respectively. Control fetuses were all alive at the time of the cesarean section. 3 of 26 (11.5%) and 30

of 53 (56.6%) oligohydramnios-exposed fetuses were dead on days 19 and 21 of gestation, respectively.

Body Weight, Lung Weight, and Lung/Body Weight Ratio

Rats exposed to oligohydramnios exhibited signifi-cantly lower lung/body weight ratios on day 19 of gesta-tion and lower lung weights and lower lung/body weight ratios on day 21 of gestation when compared with control rats ( table 2 ).

PDGF and PDGF Receptor (PDGFR) Gene Expression

Rats exposed to oligohydramnios had significantly de-creased PDGF-AA and PDGF-BB and PDGFR- and PDGFR- gene expression levels on day 19 of gestation ( fig. 1 a). On day 21 of gestation, rats exposed to oligohy-dramnios also had a decreased PDGF and PDGFR gene expression, and the values reached statistical significance for PDGF-AA and PDGF-BB only ( fig. 1 b).

Western Blot Analysis of PDGF

PDGF-AA and PDGF-BB proteins were significantly decreased in fetal lung tissues exposed to oligohydram-nios on day 16 and harvested on days 19 ( fig. 2 a) and 21 ( fig. 2 b) of gestation.

Immunohistochemistry for PDGF-AA and PDGF-BB

Immunoreactivities of AA ( fig. 3 a) and PDGF-BB ( fig. 3 b) were detected mainly in airway epithelial and in some mesenchymal cells, and the immunoreactivity was markedly reduced in oligohydramnios-exposed rats on days 19 and 21 of gestation.

Lung Tropoelastin Gene Expression and Elastin Level

The lung tropoelastin gene expression was significant-ly decreased in rats exposed to oligohydramnios than in

Treatment n Body weight g Lung weight g Lung/body weight ratio % Gestational day 19 Control 16 2.0280.13 0.0880.01 3.7180.10 Oligohydramnios 23 2.0880.11 0.0780.00 3.1880.10*** Gestational day 21 Control 27 4.1080.12 0.1580.01 3.6580.11 Oligohydramnios 23 3.8880.20 0.1280.01** 3.0480.08*** ** p < 0.01; *** p < 0.001 versus control rats at each gestational age.

Table 2. Body weight, lung weight, and

lung/body weight ratio determined on gestational days 19 and 21 in control rats and rats exposed to oligohydramnios

NEO008.indd 189

(4)

190

control rats on days 19 and 21 of gestation ( fig. 4 ). The

lung elastin levels ( g/mg protein) were significantly

lower in the rats exposed to oligohydramnios when com-pared to control rats on days 19 (371.7 8 13.1 vs. 430.9 8 10.1, p ! 0.05) and 21 (334.4 8 32.8 vs. 483.8 8 12.0, p ! 0.01) of gestation ( fig. 5 ).

Histology

Examination of random fields under a light micro-scope revealed fewer epithelial tubules in rats exposed to oligohydramnios as compared with the control rats on day 19 of gestation. Lung section depicts fewer saccules in oligohydramnios rats on day 21 of gestation ( fig. 6 a). The radial saccular count was significantly lower in rats exposed to oligohydramnios than in control rats on day 21 of gestation ( fig. 6 b).

*

Control Oligohydramnios PDGFR- PDGFR- PDGF-AA PDGF-BB

***

0 50 100 150 P e rc ent of -ac tin

*

Control Oligohydramnios -Actin Control a b Oligohydramnios PDGF-BB PDGFR- PDGF-AA PDGFR- -Actin PDGFR- PDGFR- PDGF-BB PDGF-AA Control Oligohydramnios PDGFR-_PDGFR- PDGF-AA PDGF-BB

*

0 50 100 150 P e rc ent of -ac tin

Fig. 1. PDGF and PDGFR gene expression in fetal rat lungs on

days 19 ( a ) and 21 ( b ) of gestation. Data were normalized to -ac-tin for each animal. * p ! 0.05; * * * p ! 0.001 versus control group. Control Oligohydramnios Control Oligohydramnios -Actin -Actin a b 150 100 50 0 P e rc ent of -ac tin Control Oligohydramnios Oligohydramnios PDGF-AA PDGF-BB -Actin -Actin PDGF-AA PDGF-BB PDGF-AA PDGF-BB Control

***

150 100 50 0 P e rc ent of -ac tin PDGF-AA PDGF-BB

***

Fig. 2. Representative Western blots and quantitative data

deter-mined by densitometry for PDGF-AA and PDGF-BB proteins in fetal rat lungs exposed to oligohydramnios on day 16 and harvest-ed on days 19 ( a ) and 21 ( b ) of gestation. Data were normalized to -actin for each animal. * * * p ! 0.001 versus control group.

NEO008.indd 190

(5)

Neonatology 2007;92:187–193 191

Discussion

Moessinger et al. [15] induced oligohydramnios from days 15 to 21 of gestation and found a significant reduc-tion in lung weight and lung/body weight ratio as well as reduced DNA per lung and lung protein/DNA ratio. Kit-terman et al. [16] punctured fetal rat amniotic sacs on day 16 of gestation and found a significant reduction in lung weight, lung/body weight ratio, and total DNA and pro-tein contents on day 21 of gestation. Blachford and Thurl-beck [17] performed amniocentesis on day 16 of gestation

in fetal rats and found significant reductions in lung weight and lung/body weight ratio and comparable DNA and protein concentrations on day 21 of gestation. The general manifestations of retarded lung growth induced

Control Oligohydramnios

a

Control Oligohydramnios

b

Fig. 3. Immunohistochemistry for PDGF-AA ( a ) and PDGF-BB

( b ) in fetal rat lung sections on days 19 and 21 of gestation. Posi-tive staining is shown as black. ! 400.

Control Oligohydramnios Tropoelastin 19 days -Actin Tropoelastin 21 days -Actin Control Oligohydramnios 150 100 50 0 19 21

Gestational age (days)

P e rc ent of -ac tin

***

Fig. 4. Tropoelastin gene expression in fetal rat lungs on days 19

and 21 of gestation. Data were normalized to -actin for each animal. * * * p ! 0.001 versus control group.

600 400 200 0

19 21

Gestational age (days)

Elastin ( g/mg pr ot ein) Control Oligohydramnios

**

*

Fig. 5. Lung elastin levels in fetal rat lungs on days 19 and 21 of

gestation. * p ! 0.05; * * p ! 0.01 versus control group.

NEO008.indd 191

(6)

192

by oligohydramnios are reduced lung weight and reduced lung/body weight ratio. In the present study, we induced oligohydramnios on day 16 of gestation and found sig-nificant reductions in lung/body weight ratio and lung development on days 19 and 21 of gestation. The magni-tude of lung growth retardation was greater on day 21 of gestation. Therefore, oligohydramnios did produce pul-monary hypoplasia based on lung/body weight ratio and histological findings.

Alveolarization predominantly occurs within the first 2 weeks of postnatal life in rats. In this study, alveolariza-tion was measured in the fetal rats on day 21 of gestaalveolariza-tion during the saccular stage. Consequently, the term ‘sac-cules’ replaced ‘alveoli’ for the radial alveolar count. We found that maternal oligohydramnios created on day 16 of gestation induced pulmonary hypoplasia with

de-creased lung/body weight ratio on days 19 and 21 of ges-tation and decreased the radial saccular count on day 21 of gestation.

PDGF is a powerful stimulator of fibroblast chemo-taxis and proliferation [19, 20] . Han et al. [21, 22] reported that both PDGF and its receptors are present in fetal rat lungs. Our study showed that rats exposed to oligohy-dramnios exhibited downregulation of PDGF and re-duced lung development. These results were compatible with results reported by Souza et al. [23, 24] who used antisense oligonucleotides in embryonic rat lung explant cultures and found that PDGF plays critical roles in early lung growth and branching morphogenesis.

The mechanism that downregulates the expression of PDGF in the setting of oligohydramnios-induced pulmonary hypoplasia is not clear. Two major stimuli to fetal lung growth result from stretching due to intermit-tent and repetitive fetal breathing movements and a constant distending pressure, when fetal breathing

movements are absent [9] . The constant distending

pressure is produced by the secretion of lung fluid and the resistance to outflow in the upper airways [25] . In the fetus, the lungs are filled with a fluid that is secreted from the pulmonary epithelium into the potential air-spaces and leaves the lungs via the trachea. Oligohy-dramnios does not influence fetal breathing movements, but it decreases the volume of fluid within the potential airways and airspaces [3, 26] . The fluid maintains the lungs in an expanded state and provides mechanical stretching for the tissue that is necessary for normal lung development [10] . Mechanical stretching increases growth factor expression through intracellular signal

transduction pathways [11] . Elastin is an important

structural component of alveolar wall and conducting airways and allows expansion and recoil of the lung that are essential to its mechanical performance [27] . There is a strong temporal and spatial relationship between the expression of elastin and the development of terminal airspaces. In the developing lung, elastin is deposited in the mesenchyme surrounding the developing distal air-ways before alveolarization and at the apex of the sec-ondary septal crests during the process of alveolariza-tion [28] . In this study, we found that oligohydramnios decreased the elastin levels in hypoplastic fetal rat lungs. This result is consistent with the observation of Haider et al. [29] who found that elastic tissue was missing in hypoplastic human fetal lungs associated with oligohy-dramnios. Joyce et al. [30] found that sustained reduc-tions in lung expansion by tracheal drainage decreased the elastin expression. The above studies further

sup-Control Oligohydramnios a b 5 4 1 0 R adial sac cular c ounts 3 2 Control Oligohydramnios

***

Fig. 6. a Representative histological appearance of HE-stained

lungs. ! 200. b Radial saccular counts in fetal rats on day 21 of gestation (n = 6). * * * p ! 0.001 versus control group.

NEO008.indd 192

(7)

Neonatology 2007;92:187–193 193

port our suggestion that pulmonary hypoplasia associ-ated with oligohydramnios results from a reduction in fetal lung expansion.

In conclusion, these results show that maternal oligo-hydramnios during late gestation decreases the expres-sion of PDGF and its receptors, decreases elastin gene ex-pression and concentration, and arrests fetal lung devel-opment in rats. These data suggest that a decreased PDGF expression may be important in the pathogenesis of

oli-gohydramnios-induced pulmonary hypoplasia. The un-derlying mechanism is unclear, and its elucidation may provide useful therapeutic strategies.

Acknowledgment

This work was supported by a grant from the National Science Council, Taiwan (NSC94-2314-B-038-025).

References

1 Husain AN, Hessel RG: Neonatal pulmo-nary hypoplasia: an autopsy study of 25

cas-es. Pediatr Pathol 1993; 13: 475–484.

2 Adzick NS, Harrison MR, Glick PL, Villa RL, Finkbeiner W: Experimental pulmonary hy-poplasia and oligohydramnios: relative con-tributions of lung fluid and fetal breathing

movements. J Pediatr Surg 1984; 19: 658–

665.

3 Dickson KA, Harding R: Decline in lung liq-uid volume and secretion rate during oligo-hydramnios in fetal sheep. J Appl Physiol

1989; 67: 2401–2407.

4 Thibeault DW, Beatty EC Jr, Hall RT, Bowen SK, O’Neill DH: Neonatal pulmonary hypo-plasia with premature rupture of fetal

mem-branes and oligohydramnios. J Pediatr 1985;

107: 273–277.

5 Lindahl P, Boström H, Karlsson L, Hellström M, Kalen M, Betsholtz C: Role of platelet-de-rived growth factors in angiogenesis and

al-veogenesis. Curr Top Pathol 1999; 93: 27–33.

6 Ross R: Platelet-derived growth factor.

Lan-cet 1989; 1: 1179–1182.

7 Harding R, Hooper SB: Regulation of lung expansion and lung growth before birth. J

Appl Physiol 1996; 81: 209–224.

8 Joe P, Wallen LD, Chapin CJ, Lee CH, Allen L, Han VK, Dobbs LG, Hawgood S, Kitter-man JA: Effects of mechanical factors on growth and maturation of the lung in fetal

sheep. Am J Physiol 1997; 272(1 Pt 1):L95–

L105.

9 Kitterman JA: The effects of mechanical forces on fetal lung growth. Clin Perinatol

1996; 23: 727–740.

10 Alcorn D, Adamson TM, Lambert TF, Malo-ney JE, Ritchie BC, Robinson PM: Morpho-logical effects of chronic tracheal ligation and drainage in the fetal lamb lung. J Anat

1977; 123: 649–660.

11 Liu M, Tanswell AK, Post M: Mechanical force-induced signal transduction in lung

cells. Am J Physiol 1999; 277(4 Pt 1):L667–

L683.

12 Lindahl P, Karlsson L, Hellström M, Gebre-Medhin S, Willetts K, Heath JK, Betsholtz C: Alveogenesis failure in PDGF-A-deficient mice is coupled to lack of distal spreading of alveolar smooth muscle cell progenitors

dur-ing lung development. Development 1997;

124: 3943–3953.

13 Wilson E, Mai Q, Sudhir K, Weiss RH, Ives HE: Mechanical strain induces growth of vascular smooth muscle cells via autocrine

action of PDGF. J Cell Biol 1993; 123: 741–

747.

14 Hu Y, Bock G, Wick G, Xu Q: Activation of PDGF receptor alpha in vascular smooth muscle cells by mechanical stress. FASEB J

1998; 12: 1135–1142.

15 Moessinger AC, Bassi GA, Ballantyne G, Collins MH, James LS, Blanc WA: Experi-mental production of pulmonary hypoplasia following amniocentesis and

oligohydram-nios. Early Hum Dev 1983; 8: 343–350.

16 Kitterman JA, Chapin CJ, Vanderbilt JN, Porta NF, Scavo LM, Dobbs LG, Ertsey R, Goerke J: Effects of oligohydramnios on lung growth and maturation in the fetal rat. Am J

Physiol Lung Cell Mol Physiol 2002; 282:

L431–L439.

17 Blachford KG, Thurlbeck WM: Lung growth and maturation in experimental

oligohy-dramnios in the rat. Pediatr Pulmonol 1987;

3: 328–333.

18 Thébaud B, Tibboel D, Rambaud C, Mercier JC, Bourbon JR, Dinh-Xuan AT, Archer SL: Vitamin A decreases the incidence and se-verity of nitrofen-induced congenital dia-phragmatic hernia in rats. Am J Physiol

1999; 277(2 Pt 1):L423–L429.

19 Osornio-Vargas AR, Goodell AL, Hernan-dez-Rodriguez NA, Brody AR, Coin PG, Badgett A, Bonner JC: Platelet-derived growth factor (PDGF)-AA, -AB, and -BB in-duce differential chemotaxis of early-pas-sage rat lung fibroblasts in vitro. Am J Respir

Cell Mol Biol 1995; 12: 33–40.

20 Zhang K, Phan SH: Cytokines and

pulmo-nary fibrosis. Biol Signals 1996; 5: 232–239.

21 Han RN, Mawdsley C, Souza P, Tanswell AK, Post M: Platelet-derived growth factors and growth-related genes in rat lung. III. Immu-nolocalization during fetal development.

Pe-diatr Res 1992; 31(4 Pt 1):323–329.

22 Han RN, Liu J, Tanswell AK, Post M: Ontog-eny of platelet-derived growth factor

recep-tor in fetal rat lung. Microsc Res Tech 1993;

26: 381–388.

23 Souza P, Kuliszewski M, Wang J, Tseu I, Tan-swell AK, Post M: PDGF-AA and its receptor influence early lung branching via an epithe-lial-mesenchymal interaction. Development

1995; 121: 2559–2567.

24 Souza P, Sedlackova L, Kuliszewski M, Wang J, Liu J, Tseu I, Liu M, Tanswell AK, Post M: Antisense oligodeoxynucleotides targeting PDGF-B mRNA inhibit cell proliferation during embryonic rat lung development.

De-velopment 1994; 120: 2163–2173.

25 Harding R, Bocking AD, Sigger JN: Upper airway resistances in fetal sheep: the influ-ence of breathing activity. J Appl Physiol

1986; 60: 160–165.

26 Savich RD, Guerra FA, Lee CC, Padbury JF, Kitterman JA: Effects of acute oligohydram-nios on respiratory system of fetal sheep. J

Appl Physiol 1992; 73: 610–617.

27 Starcher BC: Elastin and the lung. Thorax

1986; 41: 577–585.

28 Wendel DP, Taylor DG, Albertine KH, Keat-ing MT, Li DY: Impaired distal airway devel-opment in mice lacking elastin. Am J Respir

Cell Mol Biol 2000; 23: 320–326.

29 Haidar A, Ryder TA, Wigglesworth JS: Fail-ure of elastin development in hypoplastic lung associated with oligohydramnios: an electron microscopic study. Histopathology

1991; 18: 471–473.

30 Joyce BJ, Wallace MJ, Pierce RA, Harding R, Hooper SB: Sustained changes in lung ex-pansion alter tropoelastin mRNA levels and elastin content in fetal sheep lungs. Am J

Physiol Lung Cell Mol Physiol 2003; 284:

L643–L649.

NEO008.indd 193