Association Study of Cyclooxygenase 2 Single Nucleotide Polymorphisms and
Childhood Acute lymphoblastic leukemia in Taiwan
Chung-Hsing Wang1,5,#, Kang-Hsi Wu1,6,#, Yung-Li Yang2,#, Ching-Tien Peng1,
Rou-Fen Wang4, Chia-Wen Tsai4,6, Ru-Yin Tsai4, Dong-Tsamn Lin2,*, Fuu-Jen
Tsai1,3,* and Da-Tian Bau4,5,6,*
Departments of 1Pediatrics, 3Medical Science, and 4Terry Fox Cancer Research Laboratory, China Medical University Hospital, Taichung, Taiwan;
2
Department of Pediatrics, National Taiwan University Hospital, College of Medicine, Taipei, Taiwan;
5
Graduate Institute of Clinical Medical Science, and 6School of Chinese Medicine, China Medical University, Taichung, Taiwan.
# These authors contributed equally to this work
* Correspondence to: Da-Tian Bau, Fuu-Jen Tsai and Dong-Tsamn Lin, Terry Fox Cancer Research Lab, China Medical University Hospital, 2 Yuh-Der Road, Taichung, 404 Taiwan, Tel: +886 422053366 Ext 3312, Fax: +886 422053366 Ext 1511, E-mail: datian@mail.cmuh.org.tw/artbau1@yahoo.com.tw
Abstract. Aim: The relationship between COX-2 gene and childhood leukemia risk is
still ambiguous. In this study, the association and interaction of genotypic
polymorphisms in cyclooxygenase 2 (Cox-2) gene and smoking habits with childhood
leukemia are investigated. Materials and Methods: Up to 266 patients with
childhood leukemia and 266 healthy controls recruited from the China Medical
Hospital in central Taiwan were genotyped by PCR-RFLP method. We investigated
six polymorphic variants of Cox-2, including G-1195A, G-765C, T+8473C, intron 1,
intron 5, and intron 6, and analyzed the association of specific genotype with
susceptibility to childhood leukemia. Results: The data showed that although for each
genotype of Cox-2 G-1195A, G-765C, T+8473C, intron 1, intron 5, and intron 6, there
is no difference in the distribution between the childhood leukemia and control groups
(P > 0.05), the analysis of joint effect for Cox-2 G-765C and intron 6 showed that
individuals with GC at G-765C and GG or AG+AA at intron 6 present a slightly
higher potential for developing childhood leukemia than other groups. Conclusion:
Our findings suggest that the C allele of Cox-2 G-765C may be responsible for
childhood leukemia and may be useful in early detection of child leukemia.
Acute lymphoblastic leukemia (ALL) is the most common cancer in childhood,
accounting for 30% of the childhood malignancies {Karathanasis, 2009 #3}. The
etiology of childhood ALL is mostly unknown. Although infections in the first years
and some environmental factors such as ionizing radiation and parental alcohol and
tobacco use could play a causative role in ALL {Schmiegelow, 2008 #4; Rubnitz,
1997 #6; Liu, 2008 #7}. However, the genomic contributing factors of leukemia are
still largely unknown, both in adult and child leukemia. ALL is known to result from
an accumulation of mutations in tumor suppressor genes and oncogenes, and genetic
alterations affecting several chromosomes {Kawamata, 2008 #8; Armstrong, 2005 #9;
Patterson, 2009 #11; Pui, 2006 #12; Pui, 2004 #13}. Although common genetic
variations may play a role in determining individual susceptibility of leukemia
development in children, limited studies have evaluated the association between
genetic polymorphisms in candidate genes such as CYP, GST, NAT, MTHFR, NQO1,
XRCC1, MDR1, cyclin D1, CCND1, and XRCC4 with childhood ALL risk
{Chokkalingam, 2008 #279; Karathanasis, 2009 #270; Kim, 2006 #281; Sinnett, 2006
#280; Wu #282}. Anyway, it is commonly agreeable that single environmental or
genetic factor can only ambiguously explain a small part of subjects developed child
ALL. Thereafter, the genetic factors may be more comprehensive and less ignorable.
are key enzymes to convert arachidonic acid to prostaglandin H2, a precursor to all of
the other prostanoids {DeWitt, 1991 #231}. There are two forms of human COXs, i.e.,
Cox-1 and Cox-2. It was reported that Cox-2 over-expression may contribute to
carcinogenesis via its regulation on apoptosis, immunosurveillance, angiogenesis, and
also xenobiotic metabolism {Nishihara, 2003 #11; Gumgumji, 2003 #12}. In several
animal and clinical studies, Cox-2 specific inhibitors have both preventive and
therapeutic effects as anticancer drugs for breast, bladder, lung and pancreas cancers
{Davies, 2003 #13; Sanchez-Alcazar, 2003 #14; Levitt, 2002 #15; Mizutani, 2002
#16}. However, the association of Cox-2 genotypes with childhood ALL has never
been investigated. In addition, the mRNA and protein levels of Cox-2 may vary
among individuals, and this variability may be partially genetically determined under
different molecular mechanisms, which may depends on single nucleotide
polymorphisms (SNPs) of Cox-2 {Cok, 2001 #239; Papafili, 2002 #238}.
Although COX-2 over-expression and COX-2 inhibitor drugs have been
extensively studied in cancer, there were very few studies reporting the effects of
COX-2 inhibition in hematologic malignancies, not to mention childhood ALL. In
2002, it was reported that COX-2 over-expression was frequent in patients with
chronic myelocytic leukemia (CML) and also found to be associated with shorter
plausibility that genetic variation in the Cox-2 could alter enzyme expression levels or
biochemical function and consequently may have an impact on modifying the
individual risk of childhood ALL. To clarify the hypothesis that the SNP variants of
Cox-2 are associated with the risk of childhood ALL, we analyzed the genetic
polymorphisms of six Cox-2 SNPs, including G-1195A (rs689466), G-765C (rs20417),
T+8473C (rs5275), intron 1 (rs2745557), intron 5 (rs16825748), and intron 6
(rs2066826), in a large Taiwanese childhood ALL population (control/case=266/266).
Materials and Methods
Study population and sample collection. Two hundred and sixty-six patients
diagnosed with childhood ALL (i.e. the population under 18 years old) were recruited
at the Pediatric Departments at the China Medical University Hospital and National
Taiwan University Hospital, Taiwan, in 2005-2009. Each patient and non-cancerous
healthy person (matched by gender and age after initial random sampling from the
Health Examination Cohort of the two hospitals) completed a self-administered
questionnaire and provided their peripheral blood samples.
Genotyping assays. Genomic DNA was prepared from peripheral blood leukocytes
using a QIAamp Blood Mini Kit (Blossom, Taipei, Taiwan) and further processed
Chiu, 2008 #21; Chiu, 2008 #22; Hsu, 2009 #134; Hsu, 2009 #27; Yang, 2009 #43}. The polymerase chain reaction (PCR) cycling conditions were: one cycle at 94o
C for
5 min; 35 cycles of 94oC for 30 sec, 55oC for 30 sec, and 72oC for 30 sec, and a final
extension at 72oC for 10 min. Pairs of PCR primer sequences and restriction enzyme
for each DNA product are all listed in Table I.
Statistical analyses. Only those with both genotypic and clinical data
(control/case=266/266) were selected for final analysis. To ensure that the controls
used were representative of the general population and to exclude the possibility of
genotyping error, the deviation of the genotype frequencies of Cox-2 SNPs in the
controls from those expected under the Hardy-Weinberg equilibrium was assessed
using the goodness-of-fit test. Pearson’s chi-square test or Fisher’s exact test (when
the expected number in any cell was less than five) was used to compare the
distribution of the genotypes between cases and controls. Data were recognized as
Results
The frequency distributions of selected characteristics of 266 childhood ALL patients
and 266 controls are shown in Table II. These characteristics of patients and controls
are all well matched. None of the differences between both groups were statistically
significant (P>0.05) (Table II).
The frequencies of the genotypes for the Cox-2 SNPs in controls and childhood
ALL patients are shown in Table III. The genotype distributions of the genetic
polymorphisms of Cox-2 of the six polymorphisms investigated were not significant
between the two groups (P>0.05) (Table III). The frequencies of the alleles for Cox-2
SNPs in controls and childhood ALL patients are shown in Table IV. Neither of the
allele of the Cox-2 of the SNPs were found to be associated with lung cancer
(P>0.05).
To further investigate the association of Cox-2 genotype and childhood ALL, the
interactions among SNPs were investigated by genotype analysis. Each of the
frequencies of combined genotypic polymorphisms was analyzed, and here only the
results of G-765C and intron genotypes were shown in Table IV, while other
combinations were not significant (data not shown). There were no significant
differences in frequencies of the combined genotypes between the two groups for
and AG+AA combined genotypes compared with common GG/GG reference
genotype were 1.23 (95% confidence interval, CI=0.76-1.98; P=0.4639), 1.67 (95%
CI=0.97-2.86; P=0.0612), and 1.67 (95% CI=0.58-4.79; P=0.4315), respectively.
Discussion
In order to know the role of Cox-2 and to find potential biomarkers of childhood ALL,
in this study, we selected six SNPs of the Cox-2 gene and investigated their
associations with the susceptibility for childhood ALL in a population in northern and
central Taiwan. We found that as for single SNP, the variant genotypes of Cox-2 were
not significantly associated with the susceptibility for childhood ALL (Tables III and
IV). This may not be due to small sample size (it is relatively large in childhood ALL
studies), but more likely Cox-2 may play a minor role in the etiology of childhood
ALL, which is an outcome of complex genetic and environmental interactions.
Among the SNPs we checked, G-765C (rs20417) was found to be slightly associated
with childhood ALL (P=0.06), although not statistically significant. The genotypic
distribution of GC at G-765C was higher in the childhood ALL group (18%) than the
control group (12%) (Table 3). The lack of CC homozygote at G-765C in the
investigated population of this study may indicate that the individuals with CC
lead to apoptosis of the cells or early lethality of the people. We propose that the C
allele of Cox-2 G-765C, via the differential sensitivity to the transcription factors,
may influence the expression level of Cox-2 and associated with the carcinogenesis of
childhood ALL. The supporting evidence comes from the study documented that
COX-2 is responsible for many processes such as inflammatory, organ development,
and carcinogenesis {Tsujii, 1997 #20}. Also, several studies have reported that
COX-2 over-expression is important in mediating drug resistance to apoptosis in CLL
{Secchiero, 2005 #21}. Pharmacological suppression of COX-2 might enhance the
effect of chemotherapy-mediated apoptosis in lymphoma patients {Wun, 2004 #22},
and COX-2 over-expression in multiple myeloma is closed related to a poor survival
rate {Ladetto, 2005 #23}. Therefore, our non-significant results still meaningfully
suggested that in people who have a risky genetic variant, such as the C allele of
G-765C, may increase their childhood ALL susceptibility.
To sum up, this is the first study which focuses on the SNPs of Cox-2 and their
joint effects on childhood ALL risk. We found that the presence of the C allele of
G-765C may play a minor role, not as strong as XRCC4 G-1394T which we
previously reported {Wu #282}, in childhood ALL. Further investigations of multiple
SNPs of other related genes, gene-gene interactions, and phenotypic assays of the
Acknowledgements
We thank Wen-Shin Chang, Hsiu-Min Hsieh and the Tissue Bank at the China
Medical University for their technical assistance. This study was supported by
research grants from the Terry Fox Cancer Research Foundation, National Science
Council (NSC 98-2320-B-039-010-MY3), Department of Health, Executive Yuan
(DOH99-TD-C-111-005) and China Medical University and Hospital
References
1 Karathanasis NV, Choumerianou DM and Kalmanti M: Gene polymorphisms in childhood ALL. Pediatr Blood Cancer 52: 318-323, 2009.
2 Schmiegelow K, Vestergaard T, Nielsen SM and Hjalgrim H: Etiology of common childhood acute lymphoblastic leukemia: the adrenal hypothesis. Leukemia 22: 2137-2141, 2008.
3 Rubnitz JE and Pui CH: Childhood Acute Lymphoblastic Leukemia. Oncologist 2: 374-380, 1997.
4 Liu CY, Hsu YH, Pan PC, Wu MT, Ho CK, Su L, Xu X, Li Y and Christiani DC: Maternal and offspring genetic variants of AKR1C3 and the risk of childhood leukemia. Carcinogenesis 29: 984-990, 2008.
5 Kawamata N, Ogawa S, Zimmermann M, Kato M, Sanada M, Hemminki K, Yamatomo G, Nannya Y, Koehler R, Flohr T, Miller CW, Harbott J, Ludwig WD, Stanulla M, Schrappe M, Bartram CR and Koeffler HP: Molecular allelokaryotyping of pediatric acute lymphoblastic leukemias by
high-resolution single nucleotide polymorphism oligonucleotide genomic microarray. Blood 111: 776-784, 2008.
6 Armstrong SA and Look AT: Molecular genetics of acute lymphoblastic leukemia. J Clin Oncol 23: 6306-6315, 2005.
7 Patterson D: Molecular genetic analysis of Down syndrome. Hum Genet 126: 195-214, 2009.
8 Pui CH and Evans WE: Treatment of acute lymphoblastic leukemia. N Engl J Med 354: 166-178, 2006.
9 Pui CH, Relling MV and Downing JR: Acute lymphoblastic leukemia. N Engl J Med 350: 1535-1548, 2004.
10 Chokkalingam AP and Buffler PA: Genetic susceptibility to childhood leukaemia. Radiat Prot Dosimetry 132: 119-129, 2008.
11 Kim AS, Eastmond DA and Preston RJ: Childhood acute lymphocytic leukemia and perspectives on risk assessment of early-life stage exposures. Mutat Res 613: 138-160, 2006.
12 Sinnett D, Labuda D and Krajinovic M: Challenges identifying genetic determinants of pediatric cancers--the childhood leukemia experience. Fam Cancer 5: 35-47, 2006.
13 Wu KH, Wang CH, Yang YL, Peng CT, Lin WD, Tsai FJ, Lin DT and Bau DT: Significant association of XRCC4 single nucleotide polymorphisms with childhood leukemia in Taiwan. Anticancer Res 30: 529-533.
14 DeWitt DL: Prostaglandin endoperoxide synthase: regulation of enzyme expression. Biochim Biophys Acta 1083: 121-134, 1991.
15 Nishihara H, Kizaka-Kondoh S, Insel PA and Eckmann L: Inhibition of apoptosis in normal and transformed intestinal epithelial cells by cAMP
through induction of inhibitor of apoptosis protein (IAP)-2. Proc Natl Acad Sci U S A 100: 8921-8926, 2003.
16 Gumgumji AA, Dawood T and Parvez T: Role of COX-2 specific inhibitors in oncogenesis. J Coll Physicians Surg Pak 13: 361-365, 2003.
17 Davies G, Salter J, Hills M, Martin LA, Sacks N and Dowsett M: Correlation between cyclooxygenase-2 expression and angiogenesis in human breast cancer. Clin Cancer Res 9: 2651-2656, 2003.
18 Sanchez-Alcazar JA, Bradbury DA, Pang L and Knox AJ: Cyclooxygenase (COX) inhibitors induce apoptosis in non-small cell lung cancer through cyclooxygenase independent pathways. Lung Cancer 40: 33-44, 2003. 19 Levitt RJ and Pollak M: Insulin-like growth factor-I antagonizes the
antiproliferative effects of cyclooxygenase-2 inhibitors on BxPC-3 pancreatic cancer cells. Cancer Res 62: 7372-7376, 2002.
20 Mizutani Y, Kamoi K, Ukimura O, Kawauchi A and Miki T: Synergistic cytotoxicity and apoptosis of JTE-522, a selective cyclooxygenase-2 inhibitor, and 5-fluorouracil against bladder cancer. J Urol 168: 2650-2654, 2002. 21 Cok SJ and Morrison AR: The 3'-untranslated region of murine
cyclooxygenase-2 contains multiple regulatory elements that alter message stability and translational efficiency. J Biol Chem 276: 23179-23185, 2001. 22 Papafili A, Hill MR, Brull DJ, McAnulty RJ, Marshall RP, Humphries SE and
Laurent GJ: Common promoter variant in cyclooxygenase-2 represses gene expression: evidence of role in acute-phase inflammatory response.
Arterioscler Thromb Vasc Biol 22: 1631-1636, 2002.
23 Giles FJ, Kantarjian HM, Bekele BN, Cortes JE, Faderl S, Thomas DA, Manshouri T, Rogers A, Keating MJ, Talpaz M, O'Brien S and Albitar M: Bone marrow cyclooxygenase-2 levels are elevated in chronic-phase chronic myeloid leukaemia and are associated with reduced survival. Br J Haematol
119: 38-45, 2002.
24 Chang CH, Chang CL, Tsai CW, Wu HC, Chiu CF, Wang RF, Liu CS, Lin CC and Bau DT: Significant association of an XRCC4 single nucleotide
polymorphism with bladder cancer susceptibility in Taiwan. Anticancer Res 29: 1777-1782, 2009.
25 Chang CH, Chiu CF, Liang SY, Wu HC, Chang CL, Tsai CW, Wang HC, Lee HZ and Bau DT: Significant association of Ku80 single nucleotide
polymorphisms with bladder cancer susceptibility in Taiwan. Anticancer Res
26 Chiu CF, Tsai MH, Tseng HC, Wang CL, Wang CH, Wu CN, Lin CC and Bau DT: A novel single nucleotide polymorphism in XRCC4 gene is associated with oral cancer susceptibility in Taiwanese patients. Oral Oncol 44: 898-902, 2008.
27 Chiu CF, Wang CH, Wang CL, Lin CC, Hsu NY, Weng JR and Bau DT: A novel single nucleotide polymorphism in XRCC4 gene is associated with gastric cancer susceptibility in Taiwan. Ann Surg Oncol 15: 514-518, 2008. 28 Chiu CF, Wang HC, Wang CH, Wang CL, Lin CC, Shen CY, Chiang SY and
Bau DT: A new single nucleotide polymorphism in XRCC4 gene is associated with breast cancer susceptibility in Taiwanese patients. Anticancer Res 28: 267-270, 2008.
29 Hsu CF, Tseng HC, Chiu CF, Liang SY, Tsai CW, Tsai MH and Bau DT: Association between DNA double strand break gene Ku80 polymorphisms and oral cancer susceptibility. Oral Oncol 45: 789-793, 2009.
30 Hsu NY, Wang HC, Wang CH, Chiu CF, Tseng HC, Liang SY, Tsai CW, Lin CC and Bau DT: Lung cancer susceptibility and genetic polymorphisms of Exo1 gene in Taiwan. Anticancer Res 29: 725-730, 2009.
31 Yang MD, Hsu YM, Kuo YS, Chen HS, Chang CL, Wu CN, Chang CH, Liao YM, Wang HC, Wang MF and Bau DT: Significant association of Ku80 single nucleotide polymorphisms with colorectal cancer susceptibility in Central Taiwan. Anticancer Res 29: 2239-2242, 2009.
32 Tsujii M, Kawano S and DuBois RN: Cyclooxygenase-2 expression in human colon cancer cells increases metastatic potential. Proc Natl Acad Sci U S A 94: 3336-3340, 1997.
33 Secchiero P, Barbarotto E, Gonelli A, Tiribelli M, Zerbinati C, Celeghini C, Agostinelli C, Pileri SA and Zauli G: Potential pathogenetic implications of cyclooxygenase-2 overexpression in B chronic lymphoid leukemia cells. Am J Pathol 167: 1599-1607, 2005.
34 Wun T, McKnight H and Tuscano JM: Increased cyclooxygenase-2 (COX-2): a potential role in the pathogenesis of lymphoma. Leuk Res 28: 179-190, 2004.
35 Ladetto M, Vallet S, Trojan A, Dell'Aquila M, Monitillo L, Rosato R, Santo L, Drandi D, Bertola A, Falco P, Cavallo F, Ricca I, De Marco F, Mantoan B, Bode-Lesniewska B, Pagliano G, Francese R, Rocci A, Astolfi M, Compagno M, Mariani S, Godio L, Marino L, Ruggeri M, Omede P, Palumbo A and Boccadoro M: Cyclooxygenase-2 (COX-2) is frequently expressed in multiple myeloma and is an independent predictor of poor outcome. Blood 105:
Table I. The primer sequences, polymerase chain reaction and restriction fragment length polymorphism
(PCR-RFLP) conditions for Cox-2 gene polymorphisms.
Polymorphism
(location)
Primers sequences (5’ to 3’) Restriction
enzyme SNP sequence DNA fragment size (bp) G-1195A (rs689466) F: CCCTGAGCACTACCCATGAT R: GCCCTTCATAGGAGATACTGG Hha I A G 273 220 + 53 G-765C (rs20417) F: TATTATGAGGAGAATTTACCTTTCGC R: GCTAAGTTGCTTTCAACAGAAGAAT PvuⅡ C G 100 74 + 26 T+8473C (rs5275) F: GTTTGAAATTTTAAAGTACTTTTGAT R: TTTCAAATTATTGTTTCATTGC Bcl I T C 147 124 + 23 intron 1 (rs2745557) F: GAGGTGAGAGTGTCTCAGAT R: CTCTCGGTTAGCGACCAATT Taq I G A 439 353 + 76 intron 5 (rs16825748) F: GCGGCATAATCATGGTACAA R: CAGCACTTCACGCATCAGTT BsrG I T A 417 314 + 103 intron 6 (rs2066826) F: ACTCTGGCTAGACAGCGTAA R: GCCAGATTGTGGCATACATC Aci I A G 327 233 + 94
Table II. characteristics of 266 childhood ALL patients and 266 controls
Characteristic Controls (n = 266) Patients (n = 266) p-valuea
n % Mean (SD) n % Mean (SD) Age (years) 8.3 (4.8) 7.0 (4.4) 0.64 Gender 1.00 Male 148 55.6% 148 55.6% Female 118 44.4% 118 44.4% a
Table III. Distribution of Cox-2 genotypes among the childhood leukemia patient and control groups.
Genotype Controls % Patients % p-valuea
A-1195G (rs689466) 0.9793 AA 74 27.8% 75 28.1% AG 127 47.7% 128 48.1% GG 65 24.4% 63 23.7% G-765C (rs20417) 0.0684 GG 234 88.0% 218 82.0% GC 32 12.0% 48 18.0% CC 0 0% 0 0% T+8473C (rs5275) 0.7834 TT 178 66.9% 174 65.4% TC 88 33.1% 92 34.6% CC 0 0% 0 0% intron 1 (rs2745557) 0.7575 GG 197 74.1% 204 76.7% AG 65 24.4% 59 22.2% AA 4 1.5% 3 1.1% intron 5 (rs16825748) 1.0000 TT 260 97.7% 261 98.1% AT 6 2.3% 5 1.9% AA 0 0% 0 0% intron 6 (rs2066826) 0.6351 GG 221 83.1% 214 80.5% AG 39 14.6% 43 16.1% AA 6 2.3% 9 3.4% a
Table IV. Cox-2 allelic frequencies among the childhood leukemia patient and control groups.
Allele Controls % Patients % p-valuea
A-1195G (rs689466) 0.8539 Allele A 275 51.7% 278 52.3% Allele G 257 48.3% 254 47.7% G-765C (rs20417) 0.0629 Allele G 500 94.0% 484 91.0% Allele C 32 6.0% 48 9.0% T+8473C (rs5275) 0.7436 Allele T 444 83.5% 440 82.7% Allele C 88 16.5% 92 17.3% intron 1 (rs2745557) 0.4654 Allele G 459 86.3% 467 87.8% Allele A 73 13.7% 65 12.2% intron 5 (rs16825748) 0.7618 Allele T 526 98.9% 527 99.1% Allele A 6 1.1% 5 0.9% intron 6 (rs2066826) 0.3178 Allele G 481 90.4% 471 88.5% Allele A 51 9.6% 61 11.5% a
Table IV. Frequencies of combined Cox-2 G-765C and intron 6 genotype polymorphisms among the childhood leukemia and control groups. Cox-2 G-765C /intron 6 genotype Control n % Patients n % OR (95% CI) P-valuea All 266 100.0 266 100.0 GG/GG 195 73.3 175 65.8 1.00 GG/AG+AA 39 14.7 43 16.2 1.23 (0.76-1.98) 0.4639 GC/GG 26 9.8 39 14.6 1.67 (0.97-2.86) 0.0612 GC/ AG+AA 6 2.2 9 3.4 1.67 (0.58-4.79) 0.4315 a
