R E S E A R C H A R T I C L E Open Access
Squamocin modulates histone H3
phosphorylation levels and induces G
1phase arrest and apoptosis in cancer cells
Chien-Chih Lee1, Yi-Hsiung Lin1, Wen-Hsin Chang2, Pei-Chin Lin3, Yang-Chang Wu1,4,5*, Jan-Gowth Chang6,7,8,9*
Abstract
Background: Histone modifications in tumorigenesis are increasingly recognized as important epigenetic factors leading to cancer. Increased phosphorylation levels of histone H3 as a result of aurora B and pMSK1 overexpression were observed in various tumors. We selected aurora B and MSK1 as representatives for testing various compounds and drugs, and found that squamocin, a bis-tetrahydrofuran annonaceous acetogenin, exerted a potent effect on histone H3 phosphorylation.
Methods: GBM8401, Huh-7, and SW620 cells were incubated with 15, 30, and 60μM squamocin for 24 h. The expressions of mRNA and proteins were analyzed by qRT-PCR and Western blotting, respectively. The cell viability was determined by an MTT assay. Cell cycle distribution and apoptotic cells were analyzed by flow cytometry.
Results: Our results showed that squamocin inhibited the proliferation of GBM8401, Huh-7, and SW620 cells, arrested the cell cycle at the G1 phase, and activated both intrinsic and extrinsic pathways to apoptosis. In addition, we demonstrated that squamocin had the ability to modulate the phosphorylation levels of H3S10 (H3S10p) and H3S28 (H3S28p) in association with the downregulation of aurora B and pMSK1 expressions.
Conclusions: This study is the first to show that squamocin affects epigenetic alterations by modulating histone H3 phosphorylation at S10 and S28, providing a novel view of the antitumor mechanism of squamocin.
Background
Cancer is generally viewed as a set of diseases driven by genetic and epigenetic alterations. Epigenetics include the interrelated processes of DNA methylation, genomic imprinting, and histone modifications, and epigenetic aberrations may result in human cancers [1-4]. In the case of histone modifications, covalent modifications of the N-terminal tail domains, such as acetylation, methy- lation, and phosphorylation, are recognized as crucial epigenetic marks that modulate gene expression and genomic function. Aberrant histone modifications may be caused by improper activities of histone-modifying enzymes, leading to inappropriate expression of tumori- genesis-related genes [5,6].
In mammalian cells, phosphorylation of histone H3 is correlated with processes of chromosome condensation during mitosis and transcription. In addition, H3 phos- phorylation occurs at two serine residues, S10 and S28, which can be mediated by histone kinases including mitogen- and stress-activated protein kinase 1 (MSK1) and aurora B kinase [7-9]. Recent studies demonstrated that phosphorylation of histone H3 at Ser10 (H3S10p) is critical during neoplastic transformation, and the steady state level of H3S10p is elevated in oncogene-trans- formed cells and human tumor cell lines [10-13]. More- over, increased phosphorylation levels of H3S10 resulting from aurora B and pMSK1 overexpression is a precipitating factor in chromosome instability and may play a role in carcinogenesis [14,15]. It was suggested that regulating phosphorylation levels of histone H3 may be a possible target for cancer treatment.
Under the assumption that targeting histone H3 phos- phorylation by histone-modifying enzymes may have therapeutic potential for cancer treatment, we have been
* Correspondence: [email protected]; [email protected]
1Graduate Institute of Natural Products, College of Pharmacy, Kaohsiung Medical University, Kaohsiung, Taiwan
6Institute of Clinical Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan
Full list of author information is available at the end of the article
© 2011 Lee et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
searching for small molecules that modulate enzymes involved in histone H3 phosphorylation in human cancer cells. Choosing aurora B and MSK1 as represen- tatives to test various compounds and drugs, we found that squamocin (Figure 1) exerted a potent effect on his- tone H3 phosphorylation. We further used different cancer cell lines such as GBM8401, Huh-7, and SW620 to evaluate whether it has similar effects on different caners. We analyzed changes in the cell cycle and apop- tosis, as well as histone H3 phosphorylation levels in association with expressions of these histone-modifying enzymes, in an effort to investigate the possible antitu- mor mechanism of squamocin.
Methods
Materials and Chemicals
Dulbecco’s modified Eagle medium (DMEM), fetal bovine serum (FBS), trypan blue, penicillin G, and strep- tomycin were obtained from GIBCO BRL (Gaithersburg, MD, USA). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenylte- trazolium bromide (MTT), dimethyl sulfoxide (DMSO), ribonuclease (RNase), and propidium iodide (PI) were purchased from Sigma-Aldrich (St. Louis, MO, USA).
An Annexin V-FITC Staining Kit was purchased from Strong Biotech (Taipei, Taiwan). Antibodies against aur- ora B, H3S10p, and H3S28p were purchased from Abcam (Cambridge, UK). Antibodies against pERK, pMSK1, caspase-3, caspase-8, caspase-9, and GAPDH were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-PARP was purchased from Upstate Biotechnology (Charlottesville, VA, USA). Anti- mouse and anti-rabbit immunoglobulin G (IgG) peroxi- dase-conjugated secondary antibodies were purchased from Pierce (Rockford, IL, USA). Polyvinylidene difluor- ide (PVDF) membranes and an enhanced chemilumines- cence (ECL) Western blotting detection kit were obtained from Amersham Life Science (Buckingham- shire, UK).
Preparation of the squamocin solution
Squamocin was provided by Prof. Yang-Chang Wu, Graduate Institute of Natural Products, Kaohsiung Med- ical University, Kaohsiung, Taiwan. The structure of this compound was verified by means of mass spectrometry
and spectroscopic techniques [16]. Squamocin was dis- solved in DMSO (< 0.01%) and made up immediately prior to the experiments.
Cell culture
The GBM8401, Huh-7, and SW620 cell lines were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA), and are derived from brain, liver and colon cancers, respectively. Cells were maintained in DMEM which was supplemented with 10% FBS, 2 mM glutamine, and antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin) at 37°C in a humidified atmosphere of 5% CO2.
Cell growth inhibition assay
Cell viability was determined by an MTT assay, and results are presented as a percentage of the control. For the MTT assay, 10 μl of MTT (5 mg/ml) dye was directly added to the cell cultures. The medium was removed 2 h later, and cells were lysed with 100 μl of DMSO. The absorbance at 570 nm was read on a microplate reader.
Flow cytometry
Externalization of phosphatidylserine (PS) and the mem- brane integrity were quantified using an Annexin V-FITC Staining Kit. Cells were washed twice with phosphate-buffered saline (PBS), and collected by centri- fugation at 200 × g for 5 min at 25°C. Cells were resus- pended in 100 μl of binding buffer and labeled with 2 μl of annexin V-FITC and PI for 15 min at 25°C. After labeling, cells were resuspended in 500 μl of binding buffer and detected on a flow cytometer using 488-nm excitation and a 515-nm band-pass filter for fluoresce detection and a filter > 600 nm for PI detection. To ana- lyze the cell cycle distribution, cells were washed twice with PBS, collected by centrifugation at 200 × g for 5 min at 4°C, and fixed in 70% (v/v) ethanol at 4°C for 30 min. After fixation, cells were treated with 0.2 ml of the DNA extraction buffer (0.2 M Na2HPO4 and 0.1 M citric acid buffer; pH 7.8) for 30 min, centrifuged, and then resuspended in 1 ml of PI staining buffer (0.1%
TritonX-100, 100μg/ml RNase A, and 500 μg/ml PI in PBS) at 37°C for 30 min. Cells were detected using a
Figure 1 Structure of squamocin. Squamocin is characterized by a long alkyl chain bearing a terminala, b-unsaturated g-lactone ring, two tetrahydrofuran rings, and some oxygenated substitutes along the chain.
flow cytometer and analyzed by FACScan and the Cell Quest program (Becton Dickinson, San Jose, CA, USA).
Western blot analysis
Total proteins were extracted as previously described [17]. Proteins were extracted from the experimental and control samples and analyzed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) as fol- lows: after electrophoresis, proteins were transferred from the gel onto PVDF membranes. The membranes were blocked with a skim milk solution (5% skim milk in PBS) and agitated for 30 min at room temperature.
Membranes were exposed to the primary antibody and agitated for 1 h at room temperature before being washed three times for 10-min periods with PBST (0.05% Tween 20 in PBS), and then incubated for 1 h with the secondary antibody at a 1:2500 dilution. After incubation with the antibody, the membranes were washed three times with PBST for 10 min each and then immersed in an ECL solution (combining solutions A and B of the ECL kit in a 1:1 ratio) with agitation for 1 min. After washing, the blots were developed by ECL.
Quantitative real-time reverse-transcriptase polymerase chain reaction (qRT-PCR)
RNA was isolated from cultured cells, and the analysis was performed as previously described [18]. The PCR was per- formed in a final volume of 20μl using a LightCycler instrument (Roche Diagnostics) according to the manufac- turer’s recommendations. The amounts of complementary (c)DNA were normalized to the housekeeping gene, GAPDH, to calculate the relative expressions of aurora B and MSK1 RNA (Table 1). Primers used to detect these genes were designed using ProbeFinder software http://
www.roche.com and were synthesized by custom oligonu- cleotide synthesis (Genomics, Taipei, Taiwan). The qRT- PCR cycling parameters were set as follows: 40 cycles of 95°C for 10 s (denaturation), followed by 60°C for 30 s (annealing), and 72°C for 1 s (extension).
Statistical analysis
Results from multiple experiments are expressed as the mean ± standard error. The difference between the treat- ment and control groups was analyzed by Student’s t-test.
A probability (p) value of < 0.05 was considered significant.
Results
Squamocin decreased aurora B and pMSK1 RNA and protein expression levels
Aurora B and MSK1 are thought to be involved in chro- matin organization, gene expression, and carcinogenesis [14,15]. More than 20 compounds with cytotoxic effects were screened, and we found a compound, squamocin, isolated from several genera of the plant family Annona- ceae, which decreased (m)RNA expression levels of aur- ora B and MSK1 in cancer cells. The expressions of aurora B and MSK1 were significantly downregulated in squamocin-treated GBM8401, Huh-7, and SW620 cells compared to the control (Figure 2). Similarly, squamocin treatment decreased the protein expression levels of aur- ora B and phosphorylated MSK1 (pMSK1) (Figure 3).
These results imply that squamocin regulates aurora B and MSK1 activities at the transcriptional and transla- tion levels.
Squamocin downregulated phosphorylation levels of histone H3 at Ser10 and Ser28
In eukaryotes, aurora B and MSK1 are linked to the phos- phorylation of H3S10 and H3S28 [7-9]. In order to investi- gate the effects of squamocin on H3S10p and H3S28p, cells were treated with squamocin for 24 h, and the pro- tein expression levels were analyzed by Western blotting.
The results showed that decreased H3S10p and H3S28p protein expression levels were detected in squamocin-trea- ted cells (Figure 3). Our experiment revealed that squamo- cin treatment decreased phosphorylation of histone H3S10 and H3S28, as well as caused declines in the pro- tein and RNA expression levels of aurora B and pMSK1.
The modulation of H3S10 and H3S28 phosphorylation by aurora B and/or pMSK1 indicates that squamocin prob- ably decreased the phosphorylation of H3S10 and H3S28 by downregulating aurora B and pMSK1 in cancer cells.
Effects of squamocin on cell viability
The growth-inhibitory activity of squamocin was assessed by an MTT assay. GBM8401, Huh-7, and SW620 cells were treated with different concentrations (15~120μM) of squamocin for 24 h. The results showed that squamocin-treated cancer cells exhibited significant loss of viability in dose-dependent manners (Figure 4).
The 50% inhibitory concentrations (IC50) of GBM8401, Huh-7, and SW620 cells were 46.1, 39.4, and 40.4 μM, respectively.
Squamocin arrested the cell cycle at the G1phase and induced apoptosis
To further evaluate the potential relevance of histone H3 phosphorylation in cancer therapy, we examined the effects of squamocin on cell growth and viability. Cells Table 1 Information about the primers and probes used
in qRT-PCR
Gene Forward primer Reverse primer Probe
aurora B attgctgacttcggctggt gtccagggtgccacacat 69 GAPDH agccacatcgctcagacac gcccaatacgaccaaatcc 60 MSK1 tggtgctgacagattttggt caaaaggaatatgctctttcagtttc 5
were treated with squamocin for 24 h, and the cell cycle distribution and apoptosis were measured by a flow cyto- metric analysis. Squamocin treatment significantly increased the population of G1phase cells (Figure 5).
Also, high levels of apoptosis were detected in squamo- cin-treated cells (Figure 6). As shown in Figure 5, treat- ment of cells with 0, 15, 30, and 60μM of squamocin resulted in G1phase accumulation of cells corresponding to 37.8%, 46.7%, 60.6% and 56.3%, respectively in GBM841 cells (Figure 5A), 41%, 59.7%, 53.6%, and 54.5%, respectively in Huh-7 cells (Figure 5B), and 53.2%, 64.9%, 59.1%, 54.5%, respectively in SW620 cells (Figure 5C).
Moreover, squamocin-treated cells were stained with propidium iodide (PI) and annexin V to determine the apoptotic cells. Cells were differentiated among viable (annexin V, PI double negative), early-apoptotic (annexin V positive, PI negative) and late-apoptotic (annexin V, PI double positive) cells. Treatment of cells with 0, 15, 30, and 60μM of squamocin increased the percentage of early apoptosis from 0.7% to 14.1%, 4.3%, and 5.3%,
respectively and late apoptosis from 4.1% to 5.5%, 21.9%, and 49%, respectively in GBM8401 cells (Figure 6A), early apoptosis from 1.8% to 15.1%, 21%, and 7.6%, respectively and late apoptosis from 3.0% to 8.6%, 12.1%, and 62.9%, respectively in Huh-7 cells (Figure 6B), and early apoptosis from 3.0% to 21.2%, 20.1%, and 22.8%, respectively and late apoptosis from 1.2% to 2.4%, 20.2%, and 36.9%, respectively in SW620 cells (Figure 6C).
Further, we extended our study to apoptosis-associated molecules and found that increasing levels of caspase-3, -8, and -9 activities and cleavage of poly ADP-ribose polymerase (PARP) were observed in squamocin- induced apoptosis (Figure 7). From the results, it is evi- dent that squamocin affected cell cycle progression and apoptosis.
Effects of squamocin on mitogen-activated protein kinase (MAPK)
The MAPK signaling pathway is implicated in a wide range of cellular functions, including cell proliferation,
Figure 3 Downregulation of aurora B, pMSK1, H3S10p, and H3S28p protein expression levels was observed with squamocin treatment. Cells were incubated with 15, 30, and 60μM squamocin for 24 h. Proteins were extracted and analyzed by Western blotting. GAPDH was used as a loading control. (A) GBM841 cells. (B) Huh-7 cells. (C) SW620 cells. Data are representative of three independent experiments.
Figure 2 Squamocin decreased expression levels of RNA ofaurora B and MSK1. GBM841, Huh-7 and SW620 cells were incubated with 30 and 60μM squamocin for 24 h. mRNA was extracted and detected by qRT-PCR. Data represent fold change versus controls, and values were normalized to GAPDH. Data are the mean of three independent experiments. *p < 0.05, compared to the control.
differentiation, survival, and apoptosis [19]. To assess whether activation of the MAPK signaling pathway is involved in squamocin-induced apoptosis, we investi- gated the activities of MAPK. The results showed that squamocin treatment significantly decreased ERK
phosphorylation (pERK) levels and increased JNK phos- phorylation (pJNK) levels (Figure 7). It was determined that activation of JNK affects members of the Bcl-2 family and activates caspases-3, -8, and -9 which results in apoptosis, whereas ERK is connected to cell survival
Figure 5 Squamocin induced cell cycle arrest at the G1phase. Cells were treated with 15, 30, and 60μM squamocin for 24 h, and then cells were stained with propidium iodide (PI) and analyzed for DNA content by flow cytometry. G1, S, and G2/M indicate cell phase. Cells without squamocin treatment served as a control. (A) GBM841 cells. (B) Huh-7 cells. (C) SW620 cells. Data are the mean of three independent experiments. * p < 0.05, compared to the control.
Figure 4 Inhibition of cancer cell growth by squamocin. GBM8401, Huh-7, and SW620 cells were treated with the indicated concentrations of squamocin, and cell viability was determined by an MTT assay. Data are the mean of three independent experiments. * p < 0.05, compared to the control.
[20,21] Our results indicate that inhibition of ERK and activation of JNK may participate in squamocin-induced apoptosis.
Discussion
Annonaceous acetogenins are highly neurotoxic mole- cules and have been considered as new antitumor agents found in the plant family, the Annonaceae [22-24].
Extensive studies on annonaceous acetogenins indicated that these naturally occurring compounds possess a broad range of biological activities, including anticancer, antiparasitic, insecticidal, and immunosuppressive effects [25,26]. On the other hand, recent studies demonstrated that annonaceous acetogenins can be converted to activ- ity-based probes for chemical proteomics. These probes were able to identify new putative targets including mitochondrial, cytosolic, and reticulum associated enzymes [27,28]. Squamocin, an annonaceous aceto- genin, is a major component of various genera of the Annonaceae. Our previous studies showed that squamo- cin induces potent cytotoxicity against a variety of cancer cells [29]. In this report, we found that
squamocin caused cell cycle arrest and apoptosis in three cancer cell lines. In addition, squamocin decreased the phosphorylation levels of H3S10 and H3S28 by downregulating aurora B and pMSK1 expressions, which might be the antitumor mechanism of squamocin.
Apoptosis, or programmed cell death, is known to participate in various biological processes. Two main apoptotic pathways were described: the mitochondrial (intrinsic) pathway and the death receptor (extrinsic) pathway. Both pathways induce activation of caspases and cause cell death. The intrinsic apoptotic pathway results from cytochrome c release from mitochondria into the cytosol and activates the initiator caspase-9 and the extrinsic apoptotic pathway results from activation of death-domain receptors and activates the initiator caspase-8 [30]. In addition, it is generally accepted that the biological activity of annonaceous acetogenins is the inhibition of nicotinamide adenine dinucleotide (NADH)-ubiquinone oxidoreductase (complex I) of the mitochondrial electron transport [25]. This inhibition suppresses mitochondrial membrane potential and ATP production as well as leads to intrinsic apoptotic pathway
Figure 6 High levels of early and late apoptosis were detected after squamocin treatment. Cells were incubated with 15, 30, and 60μM squamocin for 24 h. Apoptotic cells were determined by a PI and annexin V double-staining assay and analysis by flow cytometry. Annexin V-/ PI-, annexin V+/PI-and annexin V+/PI+cells were respectively considered to be viable, early-apoptotic, and late-apoptotic cells. Cells without squamocin treatment served as a control. (A) GBM841 cells. (B) Huh-7 cells. (C) SW620 cells. Data are the mean of three independent experiments. * p < 0.05, compared to the control.
[31-33]. In our experiment, increasing levels of caspase- 8 and -9 activities were detected in squamocin-treated cells, indicating that squamocin activated both intrinsic and extrinsic pathways to apoptosis in cancer cells.
In mammals, the ERK signaling pathway is the best studied of the MAPK pathways. Inappropriate regulation of the ERK pathway is connected to neoplastic transfor- mation and tumor development. Most cancer-associated lesions that lead to constitutive ERK activation are asso- ciated with uncontrolled cell proliferation [34]. Thus, therapeutic targeting of individual components of the ERK pathway has attracted much attention for develop- ing antitumor agents. Inhibition of ERK signaling could induce an early depletion in cellular ATP coincident with a loss of mitochondrial membrane potential, and lead to cytosolic release of mitochondrial proteins and caspases activation [35]. Besides, cell cycle arrest and apoptosis caused by ERK inhibition were observed in various cancer cell lines, indicating the potential utility in antitumor agent activity [36,37]. MSK1 is a serine/threonine protein kinase that can be phosphorylated by activated ERK (phos- phorylated ERK) to promote kinase catalytic activity in response to multiple stimuli [38,39]. In our experiment, pERK downregulation was detected in squamocin-treated cells, and simultaneously caused a decline in the expres- sion of pMSK1. It is probable that squamocin decreased the ERK cascade to reduce MSK1 phosphorylation.
Cancer cells frequently undergo mitosis, and many mitotic regulators are aberrantly expressed in these cells.
Aurora B, a chromosomal segregation protein, is expressed during mitosis and carries out vital functions such as chromosome alignment, a spindle-checkpoint function, and cytokinesis [40]. Abnormally elevated expression of aurora B was detected in many human cancer cells, and this overexpression is linked to
genomic instability which contributes to tumorigenesis [41]. Accordingly, aurora B inhibitors are important fac- tors in cancer therapeutics. In this study, squamocin treatment decreased the expression of aurora B and also of pERK in cancer cells. The data suggest that squamo- cin may have potential therapeutic value in treating cancer.
Several studies demonstrated the roles of histone H3S10 and H3S28 phosphorylation in response to stimuli or other stresses [42,43]. In eukaryotes, histone H3 phosphor- ylation is altered along with cell mitosis. This phosphoryla- tion is correlated with chromosome condensation prior to mitosis, and when chromosomes are dephosphorylated in mitosis, it induces chromosome decondensation [9]. In addition, it was reported that phosphorylation of H3S10 and H3S28 appears in the G2/M phase, and thus, both of them are widely used as cell cycle markers to index the G2/M stages [44,45]. Our experiment showed that histone H3 phosphorylation at S10 and S28 was reduced by squa- mocin, and the cell cycle was accordingly arrested at the G1phase. This indicates that the decreased phosphoryla- tion of H3S10 and H3S28 presumably caused a failure of cell cycle progression and resulted in G1phase arrest with squamocin treatment.
It is well known that annonaceous acetogenins are the most potent inhibitors of the mitochondrial respiratory chain complex I [25]. The number of compounds that inhibit complex I is increasing, and parts of the diverse inhibitors, such as rotenoids, piericidins, and myxobac- terial antibiotics could be gained from natural products.
These inhibitors have been reported to display various activities in the inhibition of mitochondrial complex I [46]. Moreover, several reports have showed that the mitochondrial complex I inhibitor can reduce the phos- phorylation levels of ERK [47], promote the activity of
Figure 7 Effects of squamocin on apoptosis. Cells were treated with 15, 30, and 60μM squamocin for 24 h. Proteins were extracted and analyzed by Western blotting. GAPDH was used as a loading control. Squamocin enhanced caspase-3, -8, and -9 activities, cleaved the functional protein of PARP, increased phosphorylation levels of ERK, and decreased phosphorylation levels of JNK. (A) GBM841 cells. (B) Huh-7 cells. (C) SW620 cells. Data are representative of three independent experiments.
JNK [47,48] and caspases [49,50] as well as cause cell cycle arrest [51] and apoptosis [50]. Although the effects of these inhibitors were similar to the effects of squamo- cin, the squamocin treatment showed a new effect on histone modifications. Therefore, inhibition of mito- chondrial complex I, modulation of histone or both may lead to the squamocin-induced cell cycle arrest and apoptosis, but the real mechanism needs further investigation.
Conclusions
Taken together, squamocin, a bis-tetrahydrofuran anno- naceous acetogenin isolated from several genera of the plant family, the Annonaceae, induces G1 phase arrest and activates both intrinsic and extrinsic pathways to apoptosis in cancer cell lines. This study is the first to show that squamocin affects epigenetic alterations by modulating histone H3 phosphorylation at S10 and S28 (Figure 8), providing a novel view of the antitumor mechanism of squamocin.
Acknowledgements
This work was supported by research grant DOH100-TD-C-111-002 from the Cancer Center, Kaohsiung Medical University Hospital, Taiwan and KMU-EM- 99-5-1 from the Center of Excellence for Environmental Medicine, Kaohsiung Medical University, Taiwan.
Author details
1Graduate Institute of Natural Products, College of Pharmacy, Kaohsiung Medical University, Kaohsiung, Taiwan.2Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan.
3Department of Pediatrics, Kaohsiung Medical University Hospital, Kaohsiung,
Taiwan.4Graduate Institute of Integrated Medicine, College of Chinese Medicine, China Medical University, Taichung, Taiwan.5Natural Medicinal Products Research Center, China Medical University Hospital, Taichung, Taiwan.6Institute of Clinical Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan.7Department of Laboratory Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan.8Center of Excellence for Environmental Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan.9Cancer Center, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan.
Authors’ contributions
CCL performed the experiments and drafted the manuscript. YHL and WHC helped to design the study. PCL participated in the coordination of the study. YCW and JGC design the study. All authors read and approved the final manuscript.
Competing interests
The authors declare that they have no competing interests.
Received: 6 September 2010 Accepted: 8 February 2011 Published: 8 February 2011
References
1. Kouzarides T: Chromatin modifications and their function. Cell 2007, 128(4):693-705.
2. Jones PA, Baylin SB: The fundamental role of epigenetic events in cancer.
Nat Rev Genet 2002, 3(6):415-428.
3. Jones PA, Baylin SB: The epigenomics of cancer. Cell 2007, 128(4):683-692.
4. Hake SB, Xiao A, Allis CD: Linking the epigenetic‘language’ of covalent histone modifications to cancer. Br J Cancer 2007, 96(Suppl):R31-39.
5. Seligson DB, Horvath S, McBrian MA, Mah V, Yu H, Tze S, Wang Q, Chia D, Goodglick L, Kurdistani SK: Global levels of histone modifications predict prognosis in different cancers. Am J Pathol 2009, 174(5):1619-1628.
6. Strahl BD, Allis CD: The language of covalent histone modifications.
Nature 2000, 403(6765):41-45.
7. Perez-Cadahia B, Drobic B, Davie JR: H3 phosphorylation: dual role in mitosis and interphase. Biochem Cell Biol 2009, 87(5):695-709.
8. Peterson CL, Laniel MA: Histones and histone modifications. Curr Biol 2004, 14(14):R546-551.
9. Prigent C, Dimitrov S: Phosphorylation of serine 10 in histone H3, what for? J Cell Sci 2003, 116(Pt 18):3677-3685.
10. Graber MW, Schweinfest CW, Reed CE, Papas TS, Baron PL: Isolation of differentially expressed genes in carcinoma of the esophagus. Ann Surg Oncol 1996, 3(2):192-197.
11. Chadee DN, Hendzel MJ, Tylipski CP, Allis CD, Bazett-Jones DP, Wright JA, Davie JR: Increased Ser-10 phosphorylation of histone H3 in mitogen- stimulated and oncogene-transformed mouse fibroblasts. J Biol Chem 1999, 274(35):24914-24920.
12. Choi HS, Choi BY, Cho YY, Mizuno H, Kang BS, Bode AM, Dong Z:
Phosphorylation of histone H3 at serine 10 is indispensable for neoplastic cell transformation. Cancer Res 2005, 65(13):5818-5827.
13. Kim HG, Lee KW, Cho YY, Kang NJ, Oh SM, Bode AM, Dong Z: Mitogen- and stress-activated kinase 1-mediated histone H3 phosphorylation is crucial for cell transformation. Cancer Res 2008, 68(7):2538-2547.
14. Espino PS, Pritchard S, Heng HH, Davie JR: Genomic instability and histone H3 phosphorylation induction by the Ras-mitogen activated protein kinase pathway in pancreatic cancer cells. Int J Cancer 2009, 124(3):562-567.
15. Adams RR, Maiato H, Earnshaw WC, Carmena M: Essential roles of Drosophila inner centromere protein (INCENP) and aurora B in histone H3 phosphorylation, metaphase chromosome alignment, kinetochore disjunction, and chromosome segregation. J Cell Biol 2001,
153(4):865-880.
16. Chen CY, Chang FR, Chiu HF, Wu MJ, Wu YC: Aromin-A, an Annonaceous acetogenin from Annona cherimola. Phytochemistry 1999, 51(3):429-433.
17. Chan CH, Ko CC, Chang JG, Chen SF, Wu MS, Lin JT, Chow LP: Subcellular and functional proteomic analysis of the cellular responses induced by Helicobacter pylori. Mol Cell Proteomics 2006, 5(4):702-713.
18. Andreassi C, Angelozzi C, Tiziano FD, Vitali T, De Vincenzi E, Boninsegna A, Villanova M, Bertini E, Pini A, Neri G, et al: Phenylbutyrate increases SMN expression in vitro: relevance for treatment of spinal muscular atrophy.
Eur J Hum Genet 2004, 12(1):59-65.
Figure 8 Hypothetical schematic diagram of squamocin- induced cell cycle arrest and apoptosis in cancer cells. Based on our results, squamocin could induce the activation of JNK and caspases, and decrease the phosphorylation levels of H3S10 and H3S28 by downregulating the expression of pERK, pMSK1, and aurora B. We proposed the hypothesis that histone
dephosphorylation and activation of JNK and caspases contribute to squamocin induced cell cycle arrest and apoptosis.
19. Kim EK, Choi EJ: Pathological roles of MAPK signaling pathways in human diseases. Biochim Biophys Acta 2010, 1802(4):396-405.
20. Junttila MR, Li SP, Westermarck J: Phosphatase-mediated crosstalk between MAPK signaling pathways in the regulation of cell survival.
FASEB J 2008, 22(4):954-965.
21. Liu CJ, Lo JF, Kuo CH, Chu CH, Chen LM, Tsai FJ, Tsai CH, Tzang BS, Kuo WW, Huang CY: Akt mediates 17beta-estradiol and/or estrogen receptor-alpha inhibition of LPS-induced tumor necresis factor-alpha expression and myocardial cell apoptosis by suppressing the JNK1/2- NFkappaB pathway. J Cell Mol Med 2009, 13(9B):3655-3667.
22. Caparros-Lefebvre D, Steele J, Kotake Y, Ohta S: Geographic isolates of atypical Parkinsonism and tauopathy in the tropics: possible synergy of neurotoxins. Mov Disord 2006, 21(10):1769-1771.
23. Kotake Y, Okuda K, Kamizono M, Matsumoto N, Tanahashi T, Hara H, Caparros-Lefebvre D, Ohta S: Detection and determination of reticuline and N-methylcoculaurine in the Annonaceae family using liquid chromatography-tandem mass spectrometry. J Chromatogr B Analyt Technol Biomed Life Sci 2004, 806(1):75-78.
24. Alali FQ, Liu XX, McLaughlin JL: Annonaceous acetogenins: recent progress. J Nat Prod 1999, 62(3):504-540.
25. Bermejo A, Figadere B, Zafra-Polo MC, Barrachina I, Estornell E, Cortes D:
Acetogenins from Annonaceae: recent progress in isolation, synthesis and mechanisms of action. Nat Prod Rep 2005, 22(2):269-303.
26. Kojima N, Tanaka T: Medicinal chemistry of Annonaceous acetogenins:
design, synthesis, and biological evaluation of novel analogues.
Molecules 2009, 14(9):3621-3661.
27. Derbre S, Roue G, Poupon E, Susin SA, Hocquemiller R: Annonaceous acetogenins: the hydroxyl groups and THF rings are crucial structural elements for targeting the mitochondria, demonstration with the synthesis of fluorescent squamocin analogues. Chembiochem 2005, 6(6):979-982.
28. Derbre S, Gil S, Taverna M, Boursier C, Nicolas V, Demey-Thomas E, Vinh J, Susin SA, Hocquemiller R, Poupon E: Highly cytotoxic and neurotoxic acetogenins of the Annonaceae: new putative biological targets of squamocin detected by activity-based protein profiling. Bioorg Med Chem Lett 2008, 18(21):5741-5744.
29. Liaw CC, Wu TY, Chang FR, Wu YC: Historic Perspectives on Annonaceous Acetogenins from the Chemical Bench to Preclinical Trials. Planta Med 2010, 76(13):1390-404.
30. Philchenkov A: Caspases: potential targets for regulating cell death. J Cell Mol Med 2004, 8(4):432-444.
31. Duval RA, Poupon E, Romero V, Peris E, Lewin G, Cortes D, Brandt U, Hocquemiller R: Analogues of cytotoxic squamocin using reliable reactions: new insights into the reactivity and role of theα,β- unsaturated lactone of the annonaceous acetogenins. Tetrahedron 2006, 62(26):6258-6257.
32. Duval RA, Poupon E, Brandt U, Hocquemiller R: Remarkable substituent effect: beta-aminosquamocin, a potent dual inhibitor of mitochondrial complexes I and III. Biochim Biophys Acta 2005, 1709(3):191-194.
33. Derbre S, Duval R, Roue G, Garofano A, Poupon E, Brandt U, Susin SA, Hocquemiller R: Semisynthesis and screening of a small library of pro- apoptotic squamocin analogues: selection and study of a benzoquinone hybrid with an improved biological profile. ChemMedChem 2006, 1(1):118-129.
34. Dhillon AS, Hagan S, Rath O, Kolch W: MAP kinase signalling pathways in cancer. Oncogene 2007, 26(22):3279-3290.
35. Monick MM, Powers LS, Barrett CW, Hinde S, Ashare A, Groskreutz DJ, Nyunoya T, Coleman M, Spitz DR, Hunninghake GW: Constitutive ERK MAPK activity regulates macrophage ATP production and mitochondrial integrity. J Immunol 2008, 180(11):7485-7496.
36. Roy SK, Srivastava RK, Shankar S: Inhibition of PI3K/AKT and MAPK/ERK pathways causes activation of FOXO transcription factor, leading to cell cycle arrest and apoptosis in pancreatic cancer. J Mol Signal 2010, 5:10.
37. Nishioka C, Ikezoe T, Yang J, Yokoyama A: Inhibition of MEK signaling enhances the ability of cytarabine to induce growth arrest and apoptosis of acute myelogenous leukemia cells. Apoptosis 2009, 14(9):1108-1120.
38. Thomson S, Clayton AL, Hazzalin CA, Rose S, Barratt MJ, Mahadevan LC: The nucleosomal response associated with immediate-early gene induction is mediated via alternative MAP kinase cascades: MSK1 as a potential histone H3/HMG-14 kinase. EMBO J 1999, 18(17):4779-4793.
39. Dyson MH, Thomson S, Inagaki M, Goto H, Arthur SJ, Nightingale K, Iborra FJ, Mahadevan LC: MAP kinase-mediated phosphorylation of distinct pools of histone H3 at S10 or S28 via mitogen- and stress- activated kinase 1/2. J Cell Sci 2005, 118(Pt 10):2247-2259.
40. Yeung SC, Gully C, Lee MH: Aurora-B kinase inhibitors for cancer chemotherapy. Mini Rev Med Chem 2008, 8(14):1514-1525.
41. Katayama H, Brinkley WR, Sen S: The Aurora kinases: role in cell transformation and tumorigenesis. Cancer Metastasis Rev 2003, 22(4):451-464.
42. Mahadevan LC, Willis AC, Barratt MJ: Rapid histone H3 phosphorylation in response to growth factors, phorbol esters, okadaic acid, and protein synthesis inhibitors. Cell 1991, 65(5):775-783.
43. Lee YJ, Shukla SD: Histone H3 phosphorylation at serine 10 and serine 28 is mediated by p38 MAPK in rat hepatocytes exposed to ethanol and acetaldehyde. Eur J Pharmacol 2007, 573(1-3):29-38.
44. Juan G, Traganos F, James WM, Ray JM, Roberge M, Sauve DM, Anderson H, Darzynkiewicz Z: Histone H3 phosphorylation and expression of cyclins A and B1 measured in individual cells during their progression through G2 and mitosis. Cytometry 1998, 32(2):71-77.
45. Goto H, Yasui Y, Nigg EA, Inagaki M: Aurora-B phosphorylates Histone H3 at serine28 with regard to the mitotic chromosome condensation. Genes Cells 2002, 7(1):11-17.
46. Degli Esposti M: Inhibitors of NADH-ubiquinone reductase: an overview.
Biochim Biophys Acta 1998, 1364(2):222-235.
47. Kwak HB, Lee BK, Oh J, Yeon JT, Choi SW, Cho HJ, Lee MS, Kim JJ, Bae JM, Kim SH, et al: Inhibition of osteoclast differentiation and bone resorption by rotenone, through down-regulation of RANKL-induced c-Fos and NFATc1 expression. Bone 2010, 46(3):724-731.
48. Deng YT, Huang HC, Lin JK: Rotenone induces apoptosis in MCF-7 human breast cancer cell-mediated ROS through JNK and p38 signaling. Mol Carcinog 2010, 49(2):141-151.
49. Hoglinger GU, Lannuzel A, Khondiker ME, Michel PP, Duyckaerts C, Feger J, Champy P, Prigent A, Medja F, Lombes A, et al: The mitochondrial complex I inhibitor rotenone triggers a cerebral tauopathy. J Neurochem 2005, 95(4):930-939.
50. Lyamzaev KG, Izyumov DS, Avetisyan AV, Yang F, Pletjushkina OY, Chernyak BV: Inhibition of mitochondrial bioenergetics: the effects on structure of mitochondria in the cell and on apoptosis. Acta Biochim Pol 2004, 51(2):553-562.
51. Bai J, Nakamura H, Ueda S, Kwon YW, Tanaka T, Ban S, Yodoi J:
Proteasome-dependent degradation of cyclin D1 in 1-methyl-4- phenylpyridinium ion (MPP+)-induced cell cycle arrest. J Biol Chem 2004, 279(37):38710-38714.
Pre-publication history
The pre-publication history for this paper can be accessed here:
http://www.biomedcentral.com/1471-2407/11/58/prepub doi:10.1186/1471-2407-11-58
Cite this article as: Lee et al.: Squamocin modulates histone H3 phosphorylation levels and induces G1phase arrest and apoptosis in cancer cells. BMC Cancer 2011 11:58.
Submit your next manuscript to BioMed Central and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at www.biomedcentral.com/submit