Bio-experiments

In accordant with predicted distinct esiRNAs, RNA structure folding, multiple target sites, gene expression profiles as well as the functions of both the cognate and target gene, the

PPM1K, a partial retrotranscript from PPM1K (protein phosphatase, Mg²⁺/Mn²⁺ dependent, 1K), was first collected for detailed model studies. The detailed experiments described following sections.

2.7.1 Samples

Resected primary HCC and nearby non-cancerous tissue samples (n=41) were obtained from 41 patients at the Changhua Christian Hospital. The tumor tissues were composed of 90-100%

tumor cells and frozen immediately after surgical resection, then stored in liquid nitrogen until extraction of either RNA or DNA. All studies were approved by the Institutional Review Board of Changhua Christian Hospital.

Table 2.3 Supported databases and tools in pseudoMap.

Integrated database or tools

Dataset Description

miRBase [79, 94] miRNA annotation This database not only provides published miRNA sequences and annotations but also supplies known/predict targets.

fRNAdb [62] sRNA annotation A database to support mining and annotation of functional RNAs.

Ensembl Genome Browser [95]

Pseudogene,

protein-coding gene

It produces genome databases for vertebrates and other eukaryotic species.

UCSC Genome Browser [80]

Conserved region Genomic view of genes

This browser provides a rapid and reliable display of any requested portion of genomes at any scale, together with dozens of aligned annotation tracks.

GeneCards [96] Gene annotation GeneCards is a searchable, integrated, database of human genes that provides concise genomic related information, on all known and predicted human genes

Mfold [77] RNA folding tool Folding RNA structure GEO [88] Gene expression profiles

and deep sequencing data

A public functional genomics data

BLAST [97] Sequence alignment tool BLAST finds regions of similarity between biological sequences.

2.7.2 Cell culture

Human hepatoma Huh-7 and HepG2 cells were grown using standard procedures for all experiments. Cells were maintained in DMEM supplemented with 10% FBS, 2 mM glutamine, and antibiotics (100 units/ml penicillin and 100 μg/ml streptomycin) at 37°C in a humidified atmosphere of 5% CO2 incubator.

2.7.3 RNA isolation, reverse transcription and real-time quantitative PCR (RT-qPCR) analysis

RNA isolation from specimens or cultured cells and reverse transcription were performed as described [98, 99]. RT-qPCR analysis of PPM1K and in HepG2 and Huh-7 cells, and of PPM1K, NEK8, TBRG1 and BMPR2 in PPM1K-expressing Huh-7/HepG2 stable cell lines, was performed using SYBR Green with the ABI 7500 Real-Time PCR System (Applied Biosystems). RT-qPCR of precursor esiRNA1 (24-144 nt), precursor esiRNA2 (170-273 nt), PPM1K, and NEK8 in paired HCC tumor and non-tumor tissues was performed using a LightCycle 480 (Roche, Mannheim, Germany) with a primer/probe system. The specific primer/probe sets are shown in Table 2.3. All RNA expression levels were normalized to GAPDH (glyceraldehyde-3-phosphate dehydrogenase) RNA with the ΔCt method according to Liu et al [100].

RT-PCR of mature esiRNA1 levels in Huh-7 stable cell lines was performed using a TaqMan MicroRNA Assay designed for esiRNA1 according to the manufacturer’s instructions (Applied Biosystems) following isolation of small RNA with the mirVana miRNA Isolation Kit. U6 small nuclear RNA was used as an internal control.

2.7.1 Northern blot of pseudogene-derived esiRNAs

Northern blotting was performed according to a previous study [101] with minor modifications. Briefly, 10 μg of total RNA from human hepatoma cell line Huh-7 were dissolved in loading buffer (50 mM EDTA, 8 M urea, 20% formamide, xylene cyanol), loaded onto a 2% agarose gel, then run for 1.5 h at 120 V at room temperature. The biotin-labeled esiRNA probes (5′- GTGGCACGCGCCTGTAGTCCCAGC-3′ for esiRNA1 and 5’-GAGGCAGGAGAATGGCGTGAACC-3’ for esiRNA2, Genomics BioSci & Tech Co.,

Taipei, Taiwan) were used as the positive control for the avidin-biotin reaction and the size control for esiRNAs. The agarose gel was incubated sequentially in 0.05 M NaOH/NaCl, 0.05 M Tris/NaCl and 2x sodium citrate. Then RNA was transferred to a nitrocellulose membrane (Pall Corporation, East Hills, NY, USA) followed by cross-linking with 254-nm UV radiation.

The membrane was hybridized with the biotinylated esiRNAs overnight, then membranes were washed sequentially with 2x SSC/0.1% SDS, 1x SSC/0.1% SDS and 0.5x SSC/0.1%

SDS at 42°C. The membrane was incubated with horseradish peroxidase (HRP)-conjugated avidin (Biolegend, SanDiego, CA, USA) and probe detected by chemiluminescence with the WesternBrightTM-ECL kit (Advansta, Menlo Park, CA, USA).

Table 2.4. The sequences of the probes and primers used in RQ-PCR/RT-PCR.

Gene Probe seq. Primer (5’→3’)

siRNA1 (24-144 nt) CTCTGCCT F: GGAGTACAGTGGTGCGGTCT R: GCTGAGGCAGAAGAATCGTT siRNA2 (170-273 nt) GGCTGGAG F: GAGAAGGAGTCTCTCTCTGTCACC

R: CAGTGAGCCGAGATCGTG

PPM1K TGGGGCAG F: TGACCATTGACCATACTCCAGA

R: CAAGCCTGCCATTTACGTG NEK8 (for tissues) CTGGGGCC F: TGTCCACTGAGCGAGAACTATT

R: TCTGACCCCGATCCGTGG

GAPDH TGGGGAAG F: AGCCACATCGCTCAGACAC

R: GCCCAATACGACCAAATCC

TPG_PPM1K - F: GGAATTCCTCCATCAGCTGTTCGTTTG

R: GCTCTAGATGGCAAAACCCCATCTCTAC

NEK8 (for cell) - F: TCCACTGAGCGAGAACTATTTGC

R: GGATCATGGAGGAATCGATACC

TBRG1 - F: CCGTGGGCTATTGCAGTACTC

R: AAGAGCTGACAATGGCATTCTG

BMPR2 - F: GGCCATCAAAGCCCAGAAG

R: CTGATCCTGATTTGCCATCTTG

2.7.2 Fluorescent in situ hybridization (FISH)

Nocodazole and colchicine were added to cell lines before FISH was performed. Interphase and metaphase spreads were prepared for FISH using standard methods [102]. DNA probes (S1: GTGGCACGCGCCTGTAGTCCCAGC, antisense of esiRNA1; S2:

GAGGCAGGAGAATGGCGTGAACC, antisense of esiRNA2; scramble 1:

GTGGCTCATGCCTGTAATCCCAGCACTTTG; and scramble 2:

TTAAGACATACAAAGATCTGGCCAGGTGCG) were mixed with hybridization buffer, centrifuged, and heated to 73°C for 5 min in a water bath. Slides were immersed in 70%

formamide/2× standard saline citrate for 5 min at 73°C, followed by dehydration, dried, and hybridized with probe mix in a 42°C incubator for 30 min. Slides were then washed in 0.4×

standard saline citrate/0.3% NP-40 for 2 min, air dried in the dark, and counterstained with DAPI (4, 6-diamidino-2-phenylindole) (1 μg/ml, Abbott, Illinois, USA). Imaging was performed on a Nikon E600 microscope with cytovision software.

2.7.3 Transduction of the pseudogene transcript in Huh-7 and HepG2 stable cell lines

TPG-expressing (and vector control) Huh-7/HepG2 stable cell lines were established by G418 selection after transfection with the PPM1K-expression plasmid or blank vector. Total RNA was isolated from cells and subjected to RT-PCR analysis to amplify PPM1K mRNA (primers showed in Table 2.4). The PCR was performed with a denaturing step at 95°C for 2 minutes, then 30 cycles of 30 s at 95°C, 1 min at 60°C and 1 min at 72°C, followed by a final 7 min at 72°C.

2.7.4 Cell proliferation assay

To investigate the proliferation of PPM1K-expressing Huh-7 stable cell lines, 2.5 × 10⁴ cells were plated in each well of a 12-well plate. Cells were trypsinized and counted with a hematocytometer every day until day 4. Each experiment was repeated twice in triplicate wells, separately. Huh-7 TPG7 cells were transfected with NEK8-overexpressing plasmid or empty vector using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The NEK8-overexpressing plasmid, which contains the human NEK8 ORF without 3’-UTR in the pCMV6-Entry vector, was obtained from Origene (Rockville, MD, USA). Twenty-four hours after transfection, 2.5 × 10⁴ cells were plated in each well of a 12-well plate. Cells were trypsinized and counted with a hematocytometer every day until day 4.

2.7.5 Clonogenic activity

For determination of clonogenic activity, we plated 1000 cells of mock2, TPG1, TPG2 and TPG7 in 10 ml growth medium in 100 mm dishes. Soft agar culture was also performed by inoculating 500 cells/ml in 0.3% agar-growth medium over 0.5% agar-growth medium in 6-well culture dishes. The dishes were incubated under normoxic 19% O2 and hypoxic 3% O2

in 5% CO2 incubators for 12 days and fixed/stained for counting colony formation. We also took serial photographs of the same colonies at day 5, day 7 and day 9 to visualize the two-dimensional growth of mock2 and three transfected clones.

2.7.6 Transfection of synthetic siRNA1 into Huh-7 cells

siRNA1 was chemically synthesized by Invitrogen (Carlsbad, CA, USA). Oligonucleotides were annealed before use in annealing buffer containing 100 mM potassium acetate, 30 mM Hepes-KOH (pH 7.4), and 2 mM magnesium acetate. Negative Control #1 siRNA was also

obtained from Invitrogen. Huh-7 cells in 6 cm culture plates were transfected with 200 pmol siRNA using 10 l Lipofectamine 2000 according to manufacturer’s instructions.

2.7.7 Construction of the esiRNA1-deleted

 PPM1K-expressing plasmid

To delete the esiRNA1 sequence from PPM1K, the overlap extension method of PCR-based mutagenesis was used. First, two complementary mutagenic primers, forward

5’-CCTCAGCCTCCTGAGTACACCCCTGGCTAATTTT-3’ and reverse

5’-AAAATTAGCCAGGGGTGTACTCAGGAGGCTGAGG-3’, were synthesized. Two PCRs using the mutagenic forward primer/outer PPM1K reverse primer pair and the mutagenic reverse primer/outer PPM1K forward primer pair were performed to amplify the right and left PPM1K fragments, respectively. The two fragments were then mixed and further amplified using the outer PPM1K primers to generate the esiRNA1-deleted

PPM1K fragment. Finally, this fragment was inserted between the EcoRI and XbaI sites of the pCI-neo vector to generate the esiRNA1-deleted PPM1K-expressing plasmid.

2.7.8 Mitochondrial activities

For indirect assay of mitochondrial membrane potential and permeability transition pore activity [103], overnight-plated monolayer cells on 100 mm dishes were exposed to 0.5 g/ml or 1.0 g/ml Rh123 in the growth medium [104]. The kinetics of dye uptake were determined by harvesting the cells after 10 min, 30 min, 5 h and 24 h incubation in Rh123-containing media. To determine Rh123 retention activity of cancer cells [103-105], monolayer cells exposed to Rh123-containing medium for 30 min were rinsed 3x with Hanks’ balanced salt solution (HBSS) to remove the dye, and replenished with fresh medium for a further 18 h

incubation before harvest. Cells harvested by trypsinization were washed 2x with cold PBS and collected by centrifugation at 300x g at 4°C for 5 min. With or without further reaction with fluorescent monoclonal antibody against cell surface markers, e.g. CD133/Prominin (BD Pharmingen), the doubly- or triply-labeled washed cells were analyzed in a fluorocytometer.

2.7.9 miRNA-mediated knockdown of PPM1K and

 PPM1K

The stable negative control (siCon: 5’FAM-UUC UCC GAA CGU GUC ACG UTT), has-miR-650 (miR-650: 5’-AGG AGG CAG CGC UCU CAG GAC) and has-miR-3174 (miR-3174: 5’-UAG UGA GUU AGA GAU GCA GAG CC-3’ ) miRNAs were purchased from GeneDireX, Inc. (Las Vegas, NV, USA) and transfected into cells by Lipofetamine^TM RNAiMax (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The efficacy of mRNA knockdown after miRNA transfection for 48 h was determined by RT-qPCR.

2.7.10 Statistical analysis

Student’s t-test was used for analysis of the cell assays. Significance was accepted at P-value

< 0.05.