• 沒有找到結果。

None of the authors of this paper has a financial or personal relationship with other people or organizations that could inappropriately influence or bias the content of the paper.

107

The authors greatly appreciate funding support of National Applied Research Laboratories, the valuable histological technical support from Miss Shiow-Ling Liao and Yi-Ying Chiu, helpful comments of Dr. Richard J. Montali and Dr. Sarah L.

Poynton, Johns Hopkins University School of Medicine, Baltimore, USA.

108

Table 1. RT-PCR primer sequence of the phosphoprotein (P) gene of CDV Onderstepoort, strain(AF378705)

Primer Nucleotide sequence (5’-3’) Nucleotide position

Target Set 1

F2 TAAGGGAATCGAAGATGC 2160-2177 -

R1 CCATCAGCATGCTCACATC 2359-2341 200

R2 GATCCCCCAGTTGACTTG 2585-2568 426

Set 2

P2 (F) ATGTTTATGATCACAGCGGT 2132-2151 429

P2b (F) ATTAAAAAGGG(G/C)ACAGGAGAGAGATCAGCC 2482-2511 78

P1(R) ATTGGGTTGCACCACTTGTC 2560-2540 -

109

group of CDV infected dogs. Data is presented as number of positive cases, and percentage of positive cases.

Diagnostic Lesions Shelter (N=20) Clinic (N=32) Chi-square test Intranuclear inclusion

body 11(55%) 28(87%) **

Demyelination, Cerebrum 7(35%) 25(78%) **

Demyelination,

Cerebellum 4(20%) 23(71%) **

Demyelination, Brain stem 6(30%) 25(78%) **

Lymphoid depletion 10(50%) 31(96%) **

Catarrhal enteritis 6(30%) 11(34%) ns

Interstitial pneumonia 11(55%) 26(81%) *

Hyperkeratosis 4(20%) 9(28%) ns

Syncytium 6(30%) 14(43%) ns

**, statistically significant, P<.01; * , statistically significant, P<.05; ns, not statistically significant

110

111

112

C 98-5102 NA + - - + - - - NA

C dog1 NA - - + + + + - NA

C 09-997 NA - - + + + + - -

C 09-887 NA - + + + - + + NA

No.

detected

17 21 20 18 15 13 14 14 7

% positive 68 65 62 56 46 40 43 43 25

C:clinic ; CV: clinic treatment with CDV vaccination history; +: positive; -: negative; NA: not available; r

113

Table 5. Comparison of the frequency of intranuclear and intracytoplasmic inclusion bodies (INIB/ICIB) in 9 sites in shelter and clinic CDV-infected dogs.

Data presented are number of INIB/ICIB positive dogs, total number of dogs examined, and the percentage of dogs INIB/ICIB positive.

Sites of INIB/ICIB Shelter group Clinic group chi-square test

nos % nos %

Urinary bladder 5/19 26 17/25 68 **

Lymphoid tissues 7/20 35 21/32 65 *

Lung 3/20 15 20/32 62 **

Cerebellum 7/20 35 18/32 56 ns

Cerebrum 4/20 20 15/32 46 ns

Brain stem 6/20 30 13/32 40 ns

Ependymal cells 5/20 25 14/32 43 ns

Alimentary tract 2/20 10 14/32 43 *

Skin 2/20 10 7/28 25 ns

+ positive; - negative; statistically significant * P < 0.05, ** P < 0.01; ns, not significant; nos number of samples

114

clinical group of CDV infected dogs (Percentage of different lesions and co-infections /total animal counted

Co-infections /Organ

Co-infections and associated lesions Shelter group, (N=20) (%)

Clinic group (N=32) (%) Co-infections

Virus Adenovirus infection, liver, type I  

Adenovirus infection, lung, type II  

Potozoa Coccidiosis  

Toxoplasmosis  

Babesiosis  

Mycoplasma Hemobartonellosis  

Fungi Aspergillosis 0 3

Suppurative bronchopneumonia  

Lung abscess  

Heart Myocarditis  

Liver Hepatitis  

Adrenal gland Nodular hyperplasia of adrenal gland  

Hemorrhage and necrosis of adrenal gland

115

co-infections and associated lesions, there were no significant differences in frequency of occurrence between shelter and clinic dogs (X2 chi-square test); the exception was interstitial nephritis, which was significantly more common in the shelter dogs than in the clinic dogs.

116

Table7. Diagnostic Criteria of CDV cases included in this study, N=52

Single test RT-PCR IHC Demyelination INIB/ICIB

positive 38(73%) 33(63%)

34(65%) 39(75%)

negative 0 1

not available 14(27%); S 2; C12 18(35%); S 13;C5

Combined tests 20

positive 19 negative 1

C: clinic; INIB/ICIB: intranuclear or intracytoplasmic inclusion bodies; IHC: immunohistochemistry;

RT-PCR: Reverse Transcription Polymerase Chain Reaction, S: shelter.

117

Figure 1. Comparison between H & E and IHC labelling in two CDV infected dogs.

A, B. Case 58, brain. A. H & E, showing multifocal spongy form of the mid-brain thalamus neuropil B, non-biotin HRP (AEC) with haematoxylin counterstain, showing diffuse immunolabelling of thalamus neuropil. C, D. Case 57, lung. A. H & E, showing interstitial pneumonia with exfoliated pulmonary macrophages and necrotic debris in the alveolar lumen. D, non-biotin HRP (AEC) with haematoxylin counterstain showing intracytoplasmic immunoreactivity in the bronchiolar epithelium and macrophages. All scale bars = 40 μm.

118

Figure 2. Eosinophilic intranuclear and intracytoplasmic inclusion bodies in four dogs with CDV. H & E. A, multifocal spongy form of the mid-brain thalamus neuropil with eosinophilic intranuclear inclusion bodies in the sub-ependymal astrocytes (arrowhead), case 58. B, splenic lymphoid depletion and necrosis with eosinophilic intranuclear inclusion bodies (arrowhead) in the white pulp, case 49. C, eosinophilic intranuclear and intracytoplasmic inclusion bodies (arrowhead) in the bladder ballooning mucosa epithelium, case 51. D, eosinophilic intranuclear inclusion bodies (arrowhead) in the gastric mucosa gland, case 50. All scale bars = 10 μm.

119

Figure 3. Co-infections and associated lesion in four dogs with CDV. H & E. A, purulent bronchointerstitial pneumonia with smudge 8-10μm adenovirus, basophilic intranuclear inclusion bodies in the pulmonary bronchiolar epithelium (arrow), case 58. B, 10-40μm (body length) microfilaria of Dirofilaria immitis (arrows)deposited in the pulmonary alveolar septa, and capillaries with nodular aggregates of pyogranulomatous epithelioid macrophages, eosinophilic intranuclear inclusion bodies in the macrophages(arrowhead), case 49. C, hepatic cell necrosis with 5-8μm basophilic adenovirus, intranuclear inclusion bodies (arrows) in the hepatocytes, case 51. D, hemorrhagic to necrotizing pneumonia with numerous, 4-8 x 2-4 um, intra-lesional, curvilinear tachyzoites (arrow) free within areas of pulmonary necrotic parenchyma, case 50. All scale bars =10 μm.

120

REFERENCES

1. Appel MJ: Pathogenesis of canine distemper. Am J Vet Res 1969;30: 1167-1182.

2.Baumgartner W, Boyce RW, Alldinger S, Axthelm MK, Weisbrode SE, Krakowka S, Gaedke K: Metaphyseal bone lesions in young dogs with systemic canine distemper virus infection. Vet Microbiol 1995; 44: 201-209.

3.Beineke A, Puff C, Seehusen F, Baumgartner W: Pathogenesis and immunopathology of systemic and nervous canine distemper. Vet Immunol

Immunopathol 2009;127: 1-18.

4.Blixenkrone-Moller M: Biological properties of phocine distemper virus and canine distemper virus. APMIS Suppl 1993;36: 1-51.

5.Chvala S, Benetka V, Mostl K, Zeugswetter F, Spergser J, Weissenbock H,:Simultaneous canine distemper virus, canine adenovirus type 2, and

Mycoplasma cynos infection in a dog with pneumonia. Vet Pathol 2007; 44:

508-512.

6.Damian M, Morales E, Salas G, Trigo FJ,: Immunohistochemical detection of antigens of distemper, adenovirus and parainfluenza viruses in domestic dogs with pneumonia. J Comp Pathol 2005;133; 289-293.

7.Fukushima K, Helman RG: Cryptosporidiosis in a pup with distemper. Vet Pathol 1984;21: 247-248.

121

Immunohistochemical detection of canine distemper virus in haired skin, nasal mucosa, and footpad epithelium: a method for antemortem diagnosis of infection. J Vet Diagn Invest 1999; 11: 396-399.

9.Headley SA, Shirota K, Baba T, Ikeda T, Sukura A: Diagnostic exercise: Tyzzer's disease, distemper, and coccidiosis in a pup. Vet Pathol 2009;46:151-154.

10.Higgins RJ, Krakowka S, Metzler AE, Koestner A: Canine distemper virus-associated cardiac necrosis in the dog. Vet Pathol 1981;18: 472-486.

11.Kabay MJ, Robinson WF, Huxtable CR, McAleer R: The pathology of disseminated Aspergillus terreus infection in dogs. Vet Pathol 1985;22:

540-547.

12.Koutinas AF, Baumgartner W, Tontis D, Polizopoulou Z, Saridomichelakis MN, Lekkas S: Histopathology and immunohistochemistry of canine distemper virus-induced footpad hyperkeratosis (hard Pad disease) in dogs with natural canine distemper. Vet Pathol 2004;41: 2-9.

13.Liang CT, Chueh, L.L., Lee, K.H.,Huang, H.S., Takehara, K., Miura, R., Kai, C., Liang, S.C., Yu, C.K., Liu, C.H.2008, Isolation and the phylogenetic analysis of canine distemper viruses in Taiwan. Taiwan Vet J 2008; 34: 198-210.

14.Liang CT, Chueh LL, Pang VF, Zhuo YX, Liang SC, Yu CK, Chiang H, Lee CC,

122

immunohistochemical diagnosis of canine distemper. J Comp Pathol 2007;136:57-64.

15.Lisiak JA, Vandevelde M: Polioencephalomalacia associated with canine distemper virus infection. Vet Pathol 1979;16: 650-660.

16.Messick JB: New perspectives about Hemotrophic mycoplasma (formerly, Haemobartonella and Eperythrozoon species) infections in dogs and cats. Vet