Overall, although this study did not establish that hormone/serotonin receptors are the mechanism underlying winner and loser effects, it did show: (1) That receptor-gene expression levels (except AR) are positively correlated with each other, and that baseline hormone levels, especially T, are positively correlated with receptor-gene expression levels (except AR). (2) That baseline hormone levels (T) and receptor-gene expression levels (ERα, ERβ, GR & 5-HT1AR) are positively correlated
with aggressive behavior in the 1st experience training, particularly in those individuals given losing experiences. (3) That experience types affect brain and gonad receptor gene expression levels: individuals with three losing experiences had significantly lower AR gene expression levels in their brains and lower ERα gene expression levels in their gonads. This demonstrated relationships a) between contest experiences and hormone/serotonin receptor-gene expression and b) between both hormones and receptor-gene expressions (AR, ERα, ERβ, GR & 5-HT1AR) and contest behavior in K. marmoratus.
References
Abel, T. & Kandel, E. 1998. Positive and negative regulatory mechanisms that mediate long-term memory storage. Brain Research Reviews, 26, 360-378.
Aldegunde, M., Soengas, J. L. & Rozas, G. 2000. Acute effects of L-tryptophan on tryptophan hydroxylation rate in brain regions (hypothalamus and medulla) of rainbow trout (Oncorhynchus mykiss). Journal of Experimental Zoology, 286, 131-135.
Archer, J. 2006. Testosterone and human aggression: an evaluation of the challenge hypothesis. Neuroscience & Biobehavioral Reviews, 30, 319-345.
Austad, S. N. 1983. A game theoretical interpretation of male combat in the bowl and doily spider (Frontinella pyramitela). Animal Behaviour, 31, 59-73.
Baenninger, R. 1970. Visual reinforcement, habituation, and prior social experience of Siamese fighting fish. Journal of Comparative and Physiological Psychology, 71, 1-5.
Bailey, C. H., Kandel, E. R. & Si, K. 2004. The persistence of long-term memory: a molecular approach to self-sustaining changes in learning-induced synaptic growth.
Neuron, 44, 49-57.
Bergman, D. A. & Moore, P. A. 2003. Field observations of intraspecific agonistic behavior of two crayfish species, Orconectes rusticus and Orconectes virilis, in different habitats. The Biological Bulletin, 205, 26-35.
Borg, B. 1994. Minireview: Androgens in teleost fishes. Comparative Biochemistry and Physiology, 109, 219-245.
Brick, O. 1999. A test of the sequential assessment game: the effect of increased cost of sampling. Behavioral Ecology, 10, 726-732.
Burmeister, S. S., Kailasanath, V. & Fernald, R. D. 2007. Social dominance regulates androgen and estrogen receptor gene expression. Hormones and Behavior, 51, 164-170.
Caldwell, G. S., Glickman, S. E. & Smith, E. R. 1984. Seasonal aggression independent of seasonal testosterone in wood rats. Proceedings of the National Academy of Sciences of the United States of America, 81, 5255-5257.
Carpenter, R. E. & Summers, C. H. 2009. Learning strategies during fear
conditioning. Neurobiology of Learning and Memory, 91, 415-423.
Caramaschi, D., de Boer, S. F. & Koolhaas, J. M. 2007. Differential role of the 5-HT1A receptor in aggressive and non-aggressive mice: An across-strain comparison.
Physiology & Behavior, 90, 590-601.
Clotfelter, E. D., O'Hare, E. P., McNitt, M. M., Carpenter, R. E. & Summers, C.
H. 2007. Serotonin decreases aggression via 5-HT1A receptors in the fighting fish Betta splendens. Pharmacology Biochemistry and Behavior, 87, 222-231.
Costa, W. J. E. M., Lima, S. M. Q. & Bartolette, R. 2010. Androdioecy in Kryptolebias killifish and the evolution of self-fertilizing hermaphroditism. Biological Journal of the Linnean Society, 99, 344-349.
Dias, B. G. & Crews, D. 2006. Serotonergic modulation of male-like pseudocopulatory behavior in the parthenogenetic whiptail lizard, Cnemidophorus uniparens. Hormones and Behavior, 50, 401-409.
Dickens, M., Romero, L. M., Cyr, N. E., Dunn, I. C. & Meddle, S. L. 2009.
Chronic stress alters glucocorticoid receptor and mineralocorticoid receptor mRNA expression in the European starling (Sturnus vulgaris) brain. Journal of Neuroendocrinology, 21, 832-840.
Drummond, H. & Canales, C. 1998. Dominance between booby nestlings involves winner and loser effects. Animal Behaviour, 55, 1669-1676.
Earley, R. L. & Hsu, Y. 2008. Reciprocity between endocrine state and contest behavior in the killifish, Kryptolebias marmoratus. Hormones and Behavior, 53, 442-451.
Edwards, D. H. & Kravitz, E. A. 1997. Serotonin, social status and aggression.
Current Opinion in Neurobiology, 7, 812-819.
Ellis, T., James, J. D., Stewart, C. & Scott, A. P. 2004. A noninvasive stress assay based upon measurement of free cortisol released into the water by rainbow trout.
Journal of Fish Biology, 65, 1233-1252.
Emata, A. C., Meier, A. H. & Hsiao, S. M. 1991. Daily variations in plasma-hormone concentrations during the semilunar spawning cycle of the gulf killifish, Fundulus grandis. Journal of Experimental Zoology, 259, 343-354.
Elofsson, U. O. E., Mayer, I., Damsgård, B. & Winberg, S. 2000. Intermale competition in sexually mature arctic charr: effects on brain monoamines, endocrine stress responses, sex hormone levels, and behavior. General and Comparative
Endocrinology, 118, 450-460.
Francis, R. C., Jacobson, B., Wingfield, J. C. & Fernald, R. D. 1992. Castration lowers aggression but not social dominance in male Haplochromis burtoni (Cichlidae).
Ethology, 90, 247-255.
Francis, R. C., Soma, K. & Fernald, R. D. 1993. Social regulation of the brain-pituitary-gonadal axis. Proceedings of the National Academy of Sciences of the United States of America, 90, 7794-7798.
Fuxjager, M. J., Forbes-Lorman, R. M., Coss, D. J., Auger, C. J., Auger, A. P. &
Marler, C. A. 2010. Winning territorial disputes selectively enhances androgen sensitivity in neural pathways related to motivation and social aggression.
Proceedings of the National Academy of Sciences, 107, 12393-12398.
Genuth, S. M. 1993. The endocrine system. In: Physiology (Berne, R.M. & Levy M.N. ed.), pp. 813-1024. Mosby Year Book, St. Louis.
Giguère, V., Yang, N., Segui, P. & Evans, R. M. 1988. Identification of a new class of steroid hormone receptors. Nature, 331, 91-94.
Goodman, H. M. 2008. Hormonal control of reproduction in the female: the menstrual cycle. In: Basic Medical Endocrinology (Goodman, H. M. ed.), pp. 257-275.
Academic Press, San Diego.
Grizzle, J. M. & Thiyagarajah, A. 1987. Skin histology of Rivulus ocellatus marmoratus: apparent adaptation for aerial respiration. Copeia, 1, 237-240.
Harrington, R. W. J. 1963. Twenty-four-hour rhythms of internal self-fertilizaiotn and of oviposition by hermaphrodites of Rivulus marmoratus. Physiological Zoology, 36, 325-341.
Harrington, R. W. J. & Kallman, K. D. 1968. The homozygosity of clones of the self-fertilizing hermaphroditic fish Rivulus marmoratus Poey (Cyprinodontidae, Atheriniformes). The American Naturalist, 102, 337.
Harrington, R. W. J. 1971. How ecological and genetic factors interact to deternime when self-fertilizing hermaphrodites of Rivulus marmoratus change into functional secondary males, with a reapprisal of the modes of intersexuality among fishes.
Copeia, 3, 389-432.
Harding, C. F. 1983. Hormonal influences on avian aggressive behavior. In:
Hormones and Aggressive Behavior (Svare, B.B. ed.), pp. 435-467. Plenum Press, New York.
Hoefler, C. D. 2002. Is contest experience a trump card? The interaction of residency status, experience, and body size on fighting success in Misumenoides formosipes (Araneae: Thomisidae). Journal of Insect Behavior, 15, 779-790.
Hollis, K. L., Martin, K. A., Cadieux, E. L. & Colbert, M. M. 1984. The biological function of Pavlovian conditioning: Learned inhibition of aggressive behavior in territorial fish. Learning and Motivation, 15, 459-478.
Hollis, K. L. 1999. The role of learning in the aggressive and reproductive behavior of blue gouramis, Trichogaster trichopterus. Environmental Biology of Fishes, 54, 355-369.
Hong, H., Yang, L. & Stallcup, M. R. 1999. Hormone-independent transcriptional activation and coactivator binding by novel orphan nuclear receptor ERR3. Journal of Biological Chemistry, 274, 22618-22626.
Hoyer, D., Hannon, J. P. & Martin, G. R. 2002. Molecular, pharmacological and functional diversity of 5-HT receptors. Pharmacology Biochemistry and Behavior, 71, 533-554.
Hsu, Y. & Wolf, L. L. 1999. The winner and loser effect: integrating multiple experiences. Animal Behaviour, 57, 903-910.
Hsu, Y. & Wolf, L. L. 2001. The winner and loser effect: what fighting behaviours are influenced. Animal Behaviour, 61, 777-786.
Hsu, Y., Earley, R. L. & Wolf, L. L. 2006. Modulation of aggressive behaviour by fighting experience: mechanisms and contest outcomes. Biological Reviews, 81, 33-74.
Hsu, Y. Y., Lee, I. H. & Lu, C. K. 2009. Prior contest information: mechanisms underlying winner and loser effects. Behavioral Ecology and Sociobiology, 63, 1247-1257.
Huhman, K. L., Moore, T. O., Ferris, C. F., Mougey, E. H. & Meyerhoff, J. L.
1991. Acute and repeated exposure to social conflict in male golden hamsters:
increases in plasma POMC-peptides and cortisol and decreases in plasma testosterone.
Hormones and Behavior, 25, 206-216.
Kallman, K. D. & Harrington, R. W., JR. 1964. Evidence for the existence of homozygous clones in the self-fertilizing hermaphroditic teleost Rivulus marmoratus (Poey). The Biological Bulletin, 126, 101-114.
Kanamori, A., Yamamura, A., Koshiba, S., Lee, J. S., Orlando, E. F. & Hori, H.
2006. Methyltestosterone efficiently induces male development in the self-fertilizing hermaphrodite fish, Kryptolebias marmoratus. Genesis, 44, 495-503.
Koutoku, T., Zhang, R., Tachibana, T., Oshima, Y. & Furuse, M. 2003. Effect of acute L-tryptophan exposure on the brain serotonergic system and behavior in the male medaka. Zoological Science, 20, 121-124.
Laidre, M. E. & Elwood, R. W. 2008. Motivation matters: cheliped extension displays in the hermit crab, Pagurus bernhardus, are honest signals of hunger. Animal Behaviour, 75, 2041-2047.
Lan, Y.-T. 2010. Does contest experience from more than a month previously in Kryptolebias marmoratus influence winner/loser effect arising from recent contests?
Master's thesis. Taipei, Taiwan: National Taiwan Normal University.
Larson, E. T. & Summers, C. H. 2001. Serotonin reverses dominant social status.
Behavioural Brain Research, 121, 95-102.
Lee, I. H. 2009. The hormonal mechanisms of the loser effect in Kryptolebias marmoratus. Master's thesis. Taipei, Taiwan: National Taiwan Normal University.
Leshner, A. I. 1983. The hormonal responses to competition and their behavioral significance. In: Hormones and Aggressive Behavior (Svare, B.B. ed.), pp. 393-404.
Plenum Press, New York.
Lu, C. K. 2010. Winner effect and its relationship with testosterone and cortisol in Kryptolebias marmoratus. Master's thesis. Taipei, Taiwan: National Taiwan Normal University.
Mackiewicz, M., Tatarenkov, A., Perry, A., Martin, J. R., Elder, J. F., Jr., Bechler, D. L. & Avise, J. C. 2006a. Microsatellite documentation of male-mediated outcrossing between inbred laboratory strains of the self-fertilizing mangrove killifish (Kryptolebias marmoratus). Journal of Heredity, 97, 508-513.
Mackiewicz, M., Tatarenkov, A., Taylor, D. S., Turner, B. J. & Avise, J. C. 2006b.
Extensive outcrossing and androdioecy in a vertebrate species that otherwise reproduces as a self-fertilizing hermaphrodite. Proceedings of the National Academy of Sciences of the United States of America, 103, 9924-9928.
Malenka, R. C. & Nicoll, R. A. 1999. Long-term potentiation—a decade of progress?
Science, 285, 1870-1874.
Marini, F., Pozzato, C., Andreetta, V., Jansson, B., Arban, R., Domenici, E. &
Carboni, L. 2006. Single exposure to social defeat increases corticotropin-releasing
factor and glucocorticoid receptor mRNA expression in rat hippocampus. Brain Research, 1067, 25-35.
Maxson, S. C. 2000. Genetic influences on aggressive behavior. In: Genetic Influences on Neural and Behavioral Functions (Pfaff, D.W. et al. ed.), pp. 405-416, CRC Press
McEwen, B. S. 2000. The neobiology of stress: from serendipity to clinical relevanceur. Brain Research, 886, 172-189.
Miczek, K., Fish, E., de Bold, J. & de Almeida, R. 2002. Social and neural determinants of aggressive behavior: pharmacotherapeutic targets at serotonin, dopamine and γ-aminobutyric acid systems. Psychopharmacology, 163, 434-458.
Mohanan, V. v., Kaimal, S. B. & Paulose, C. S. 2005. Decreased 5-HT1A receptor gene expression and 5-HT1A receptor protein in the cerebral cortex and brain stem during pancreatic regeneration in rats. Neurochemical Research, 30, 25-32.
Nam, R. H., Kim, W., & Lee, C. J. 2004. NMDA receptor-dependent long-term potentiation in the telencephalon of the zebrafish. Neuroscience Letters, 370, 248-251.
Neat, F. C., Taylor, A. C. & Huntingford, F. A. 1998. Proximate costs of fighting in male cichlid fish: the role of injuries and energy metabolism. Animal Behaviour, 55, 875-882.
Nelson, R. J. & Chiavegatto, S. 2001. Molecular basis of aggression. Trends in Neurosciences, 24, 713-719.
Ogawa, S., Lubahn, D. B., Korach, K. S. & Pfaff, D. W. 1997. Behavioral effects of estrogen receptor gene disruption in male mice. Proceedings of the National Academy of Sciences of the United States of America, 94, 1476-1481.
Ogawa, S., Eng, V., Taylor, J., Lubahn, D. B., Korach, K. S. & Pfaff, D. W. 1998.
Roles of estrogen receptor-alpha gene expression in reproduction-related behaviors in female mice. Endocrinology, 139, 5070-5081.
Ogawa, S., Chan, J., Chester, A. E., Gustafsson, J. A., Korach, K. S. & Pfaff, D.
W. 1999. Survival of reproductive behaviors in estrogen receptor beta gene-deficient (beta ERKO) male and female mice. Proceedings of the National Academy of Sciences of the United States of America, 96, 12887-12892.
Ogawa, S., Chester, A. E., Hewitt, S. C., Walker, V. R., Gustafsson, J. A., Smithies, O., Korach, K. S. & Pfaff, D. W. 2000. Abolition of male sexual behaviors in mice lacking estrogen receptors α and β (α/βERKO). Proceedings of the National Academy
of Sciences of the United States of America, 97, 14737-14741.
Olsen, K., 1983. Genetic determinants of sexual differentiation. In: Hormones and Behaviour of Higher Vertebrates (Balthazart, J. et al. ed), p. 138, Springer-Verlag
Otronen, M. 1990. Mating behavior and sperm competition in the fly, Dryomyza anilis. Behavioral Ecology and Sociobiology, 26, 349-356.
Øverli, Ø., Kotzian, S. & Winberg, S. 2002. Effects of cortisol on aggression and locomotor activity in rainbow trout. Hormones and Behavior, 42, 53-61.
Øverli, Ø., Korzan, W. J., Hoglund, E., Winberg, S., Bollig, H., Watt, M., Forster, G. L., Barton, B. A., E, O. V., Renner, K. J. & Summers, C. H. 2004. Stress coping style predicts aggression and social dominance in rainbow trout. Hormones and Behavior, 45, 235-241.
Oyegbile, T. O. & Marler, C. A. 2005. Winning fights elevates testosterone levels in California mice and enhances future ability to win fights. Hormones and Behavior, 48, 259-267.
Oyegbile, T. O. & Marler, C. A. 2006. Weak winner effect in a less aggressive mammal: Correlations with corticosterone but not testosterone. Physiology &
Behavior, 89, 171-179.
Rosa, M. L. N. M., Guimarães, F. S., Pearson, R. C. A. & Del Bel, E. A. 2002.
Effects of single or repeated restraint stress on GluR1 and GluR2 flip and flop mRNA expression in the hippocampal formation. Brain Research Bulletin, 59, 117-124.
Ruiz-de-la-torre, J. L. & Manteca, X. 1999. Effects of testosterone on aggressive behaviour after social mixing in male lambs. Physiology & Behavior, 68, 109-113.
Sakakura, Y., Tagawa, M. & Tsukamoto, K. 1998. Whole-body cortisol concentrations and ontogeny of aggressive behavior in yellowtail (Seriola quinqueradiata Temminck & Schlegel; Carangidae). General and Comparative Endocrinology, 109, 286-292.
Schmittgen, T. D. & Livak, K. J. 2008. Analyzing real-time PCR data by the comparative CT method. Nature Protocols, 3, 1101-1108.
Schuett, G. W. 1997. Body size and agonistic experience affect dominance and mating success in male copperheads. Animal Behaviour, 54, 213-224.
Schuett, G. W. & Grober, M. S. 2000. Post-fight levels of plasma lactate and corticosterone in male copperheads, Agkistrodon contortrix (Serpentes, Viperidae):
differences between winners and losers. Physiology & Behavior, 71, 335-341.
Simon, N. G. & Gandelman, R. 1978. The estrogenic arousal of aggressive behavior in female mice. Hormones and Behavior, 10, 118-127.
Smith, J. M. & Price, G. R. 1973. The logic of animal conflict. Nature, 246, 15-18.
Smith, J. M. & Parker, G. A. 1976. The logic of asymmetric contests. Animal Behaviour, 24, 159-175.
Sloman, K. A., Metcalfe, N. B., Taylor, A. C. & Gilmour, K. M. 2001. Plasma cortisol concentrations before and after social stress in rainbow trout and brown trout.
Physiological and Biochemical Zoology, 74, 383-389.
Summers, C. H., Larson, E. T., Summers, T. R., Renner, K. J. & Greenberg, N.
1998. Regional and temporal separation of serotonergic activity mediating social stress. Neuroscience, 87, 489-496.
Summers, C. H., Watt, M. J., Ling, T. L., Forster, G. L., Carpenter, R. E., Korzan, W. J., Lukkes, J. L. & Overli, O. 2005. Glucocorticoid interaction with aggression in non-mammalian vertebrates: reciprocal action. European Journal of Pharmacology, 526, 21-35.
Taylor, D. S. 1990. Adaptive specializations of the Cyprinodont fish Rivulus marmoratus. Florida Scientist, 53, 239-248.
Taylor, D. S., Fisher, M. T. & Turner, B. J. 2001. Homozygosity and heterozygosity in three populations of Rivulus marmoratus. Environmental Biology of Fishes, 61, 455-459.
Tilbrook, A. J., Turner, A. I. & Clarke, I. J. 2000. Effects of stress on reproduction in non-rodent mammals: the role of glucocorticoids and sex differences. Reviews of Reproduction, 5, 105-113.
Trainor, B. C., Bird, I. M. & Marler, C. A. 2004. Opposing hormonal mechanisms of aggression revealed through short-lived testosterone manipulations and multiple winning experiences. Hormones and Behavior, 45, 115-121.
Trainor, B. C., Rowland, M. R. & Nelson, R. J. 2007. Photoperiod affects estrogen receptor α, estrogen receptor β and aggressive behavior. European Journal of Neuroscience, 26, 207-218.
Vermeulen G. J., Lambert J. G., van der Looy M. J. & Goos H. J. 1994. Gas chromatographic-mass spectrometric (GC-MS) analysis of gonadal steroids in plasma
of the male African catfish, Clarias gariepinus: effects of castration or treatment with gonadotropin releasing hormone analogue. General and Comparative Endocrinology, 96, 288-297.
Weiger, W. A. 1997. Serotonergic modulation of behaviour: a phylogenetic overview.
Biological Reviews, 72, 61-95.
Wells, M. S. 1988. Effects of body size and resource value on fighting behaviour in a jumping spider. Animal Behaviour, 36, 321-326.
Wendelaar Bonga S. E., Balm P. H. M. & Lamers A. E. 1995. The involvement of ACTH and MSH in the stress response in teleost fish. Netherlands Journal of Zoology, 45, 103-106.
Whitehouse, M. E. A. 1997. Experience influences male-male contests in the spider Argyrodes antipodiana (Theridiidae: Araneae). Animal Behaviour, 53, 913-923.
Wingfield, J. C. & Hahn, T. P. 1994. Testosterone and territorial behaviour in sedentary and migratory sparrows. Animal Behaviour, 47, 77-89.
Winberg, S., Nilsson, G. E., & Olsen, K. H. 1992. Changes in brain serotonergic activity during hierarchic behavior in Arctic charr (Salvelinus alpinus L.) are socially induced. Journal of Comparative Physiology A, 170, 93-99.
Winberg, S. & Nilsson, G. E. 1993. Roles of brain monoamine neurotransmitters in agonistic behaviour and stress reactions, with particular reference to fish.
Comparative Biochemistry and Physiology C, 106, 597-614.
Winberg, S. & Lepage, O. 1998. Elevation of brain 5-HT activity, POMC expression, and plasma cortisol in socially subordinate rainbow trout. American Journal of Physiology - Regulatory, Integrative and Comparative Physiology, 274, R645-654.
Zielinski,W. J., & Vandenbergh, J. G. 1993. Testosterone and competitive ability in male house mice, Mus musculus: laboratory and field studies. Animal Behaviour, 45, 873-891.
Table 1. The experimental design and sample size of this study. This study is a 6 ×3 (6 levels of experience training types and 3 levels of temporal treatments) factorial design; a total of 18 treatments. A total of 298 fish were randomly assigned to the 18 treatments (n = 16 or 17 for each of the treatments). Focal individuals received either 3 forced winning (ET3W), 3 forced losing (ET3L), 3 control (ET3N), 1 forced winning (ET1W), losing (ET1L) or control (ET1N) experience, and receptor gene expression levels were quantified after 0 hour, 3 hours or 48 hours delay.
Decay time
Exp type 0 hr 3 hr 48 hr
ET3N n=17 n=16 n=17
ET3L n=17 n=17 n=16
ET3W n=17 n=16 n=17
ET1N n=17 n=17 n=17
ET1L n=16 n=17 n=16
ET1W n=16 n=16 n=16
Primer for traditional PCR
Gene Ta (ºC) Product size (bp)
Androgen Receptor (AR)
Forward:5’‐ GGTGATGGTGTTTGCGCTGATA‐3’ 61 Reverse:5’‐ CAACGGGAATGATGCTGAAAGAG‐3’ 61 230 Estrogen Receptor α (ERα)
Forward:5’‐ GACTATGCTGCCCCCACCCCT‐3’ 65 Reverse:5’‐ TGTAGACGGGTGTTGAGGCGGT‐3’ 64 230 Estrogen Receptor β (ERβ)
Forward:5’‐ GTCGGGTCGCCAGTCGCAT‐3’ 65 Reverse:5’‐ TGACCGTGCTGCTGGGCTC‐3’ 63 290 5‐HT1A Receptor (5‐HT1AR)
Forward:5’‐TGGAGAAGCGCCGAGGACA ‐3’ 64 Reverse:5’‐ GCCTTCTCAGTTTTCTTCACGGTC‐3’ 61 190 Glucocorticoid Receptor (GR)
Forward: None 61
Reverse: None 61 95
※Ta: annealing temperature
Primer for quantitative PCR
Gene Ta (ºC) Product size (bp)
Androgen Receptor (AR)
Forward:5’‐ GGTGATGGTGTTTGCGCTGATA‐3’ 61 Reverse:5’‐ CAACGGGAATGATGCTGAAAGAG‐3’ 61 230 Estrogen Receptor α (ERα)
Forward:5’‐ GCCCCTACTCCTCTCTACAGCAACTC‐3’ 62 Reverse:5’‐ GCTGAGCCTTGGACTGGTGGG‐3’ 65 150 Estrogen Receptor β (ERβ)
Forward:5’‐ GTCGGGTCGCCAGTCGCAT‐3’ 65 Reverse:5’‐ ATGGTCGGGCTGTAGAAAGAAATGG‐3’ 63 145 5‐HT1A Receptor (5‐HT1AR)
Forward:5’‐TGGAGAAGCGCCGAGGACA ‐3’ 64 Reverse:5’‐ GCCTTCTCAGTTTTCTTCACGGTC‐3’ 61 190 Glucocorticoid Receptor (GR)
Forward:5’‐ TGACACCTCCACCCGCCT‐3’ 61 Reverse:5’‐ TGAACCCTGGCAGAGACTTGG‐3’ 61 95 Ribosomal Protein L8
Forward:5’‐ TGATAAGCCCATCCTGAAGGC‐3’ 60 Reverse:5’‐ TGCTCAACAGGATTCATAGCCA‐3’ 59 100
※Ta: annealing temperature
Table 4. Multiple linear regressions modeling the effect of hormone levels (T & CORT) on contest behavior in the first experience training for individuals assigned to receive winning experiences (ET1W and ET3W), controlling for standard length of trainer (STL), standard length of focal individual, strain type and last contest experience. (T: testosterone; CORT: cortisol; * P < 0.05)
1The baseline group comprised individuals that lost their last fight prior to this experiment.
Latency to moves
(N=98)
Latency to displays (N=98)
Latency to gill displays (N=51)
Lantency to attacks (N=98)
Variable df b±SE F P b±SE F P b±SE F P b±SE F P
CORT 1 ‐0.17±0.21 0.695 0.407 ‐0.25±0.20 1.529 0.219 ‐0.20±0.21 0.963 0.332 ‐0.16±0.19 0.733 0.394 T 1 0.20±0.15 1.663 0.200 0.18±0.15 1.502 0.224 0.18±0.16 1.226 0.274 0.24±0.14 2.925 0.091 Trainer1_SL 1 ‐0.04±0.06 0.496 0.483 ‐0.03±0.06 0.289 0.592 0.01±0.07 0.039 0.845 ‐0.02±0.06 0.214 0.645 Standard length 1 0.16±0.12 1.969 0.164 0.16±0.11 1.976 0.163 ‐0.08±0.13 0.413 0.524 ‐0.01±0.11 0.001 0.988 Strain type 2 3.379 0.039* 4.395 0.015* 0.783 0.463 3.227 0.044*
Last outcome_W1 1 0.36±0.23 2.508 0.117 ‐0.31±0.22 1.945 0.167 0.57±0.24 5.942 0.019* 0.02±0.21 0.006 0.941
Table 5. Multiple linear regressions and logistic regressions modeling the effect of hormone levels (T & CORT) on contest behavior in the first experience training for individuals assigned to receive losing experiences (ET1L and ET3L), controlling for standard length of trainer (STW), standard length of focal individual, strain type and last contest experience. (T: testosterone; CORT: cortisol; * P < 0.05)
1The baseline group comprised individuals that lost their last fight prior to this experiment.
Initiating displays (N=99)
Initiating gill displays (N=99)
Initiating attacks (N=99)
Escalation (N=99)
Contest duration (N=99) Variable df b±SE LRχ2 P b±SE LRχ2 P b±SE LRχ2 P b±SE LRχ2 P b±SE F P CORT 1 ‐0.52±0.52 1.035 0.309 ‐0.05±0.45 0.012 0.911 ‐0.47±0.62 0.608 0.436 0.28±0.46 0.365 0.546 0.13±0.19 0.453 0.503 T 1 0.29±0.35 0.725 0.394 0.74±0.31 5.988 0.014* ‐0.15±0.43 0.125 0.724 ‐0.33±0.33 1.072 0.301 0.31±0.13 5.703 0.019*
Trainer1_SL 1 ‐0.21±0.23 0.887 0.346 ‐0.34±0.21 2.718 0.099 ‐0.12±0.27 0.206 0.650 ‐0.12±0.22 0.287 0.592 ‐0.11±0.09 1.602 0.209 Standard length 1 0.26±0.32 0.697 0.404 0.53±0.28 3.774 0.050* 0.58±0.38 2.367 0.124 0.21±0.29 0.534 0.465 ‐0.02±0.12 0.029 0.866 Strain type 2 1.705 0.426 0.368 0.832 0.330 0.848 2.936 0.230 1.876 0.159 Last outcome_W1 1 ‐0.24±0.51 0.225 0.635 ‐0.11±0.45 0.060 0.806 ‐0.62±0.63 1.004 0.316 1.00±0.48 4.590 0.032* ‐0.37±0.19 3.703 0.057
and baseline hormones (T & CORT) on ARΔCt, ERαΔCt, ERβΔCt, GRΔCt and 5-HT1ARΔCt in brain tissue, controlling for standard length, strain types and last contest experience. (AR: androgen receptor; ERα: estrogen receptor α; ERβ: estrogen receptor β; GR: glucocorticoids receptor, 5-HT1AR: 5-HT1A receptor; T: testosterone; CORT: cortisol; * P < 0.05)
1The baseline was the ET1N group
2The baseline was the 0 h decay time treatment group
3The baseline group comprised individuals that lost their last fight prior to this experiment
AR ΔCt
1 ‐0.05±0.20 0.066 0.797 ‐0.17±0.27 0.386 0.535 ‐0.16±0.27 0.358 0.550 ‐0.40±0.22 3.181 0.076 ‐0.39±0.26 2.172 0.142 ET3N1
1 0.30±0.20 2.292 0.131 0.14±0.27 0.262 0.609 0.08±0.27 0.095 0.758 ‐0.08±0.23 0.129 0.719 ‐0.01±0.26 0.001 0.984 ET3L1
1 0.53±0.20 7.314 0.007* ‐0.18±0.27 0.450 0.503 ‐0.23±0.27 0.716 0.398 ‐0.31±0.22 1.871 0.173 ‐0.34±0.26 1.679 0.196 ET1W1
1 0.11±0.20 0.309 0.579 ‐0.02±0.27 0.003 0.954 ‐0.02±0.27 0.005 0.943 ‐0.16±0.23 0.517 0.473 ‐0.19±0.27 0.527 0.469 ET1L1
1 0.13±0.20 0.416 0.519 ‐0.05±0.27 0.040 0.843 0.05±0.27 0.032 0.858 ‐0.01±0.23 0.001 0.983 0.03±0.26 0.012 0.914
Decay time 2 3.832 0.023* 2.424 0.091 2.244 0.108 2.166 0.117 4.021 0.019*
3h 2 1 ‐0.24±0.14 2.846 0.093 0.39±0.19 4.234 0.041* 0.38±0.19 3.898 0.049* 0.29±0.16 3.459 0.064 0.49±0.19 6.927 0.009*
48h 2 1 ‐0.38±0.14 7.531 0.007* 0.32±0.19 2.912 0.090 0.31±0.19 2.729 0.099 0.28±0.16 3.024 0.083 0.41±0.19 4.972 0.027*
Exp*Time 10 0.661 0.760 0.707 0.718 0.660 0.761 0.697 0.728 0.607 0.808
CORT 1 ‐0.18±0.11 2.514 0.114 0.43±0.15 8.154 0.005* 0.54±0.15 12.561 <.001* 0.25±0.13 3.846 0.051 0.36±0.15 5.769 0.017*
T 1 ‐0.19±0.08 5.817 0.017* ‐0.67±0.11 38.652 <.001* ‐0.68±0.11 39.099 <.001* ‐0.27±0.09 8.631 0.004* ‐0.26±0.11 6.174 0.014*
Standard length 1 0.06±0.06 0.867 0.353 0.03±0.09 0.103 0.748 ‐0.01±0.09 0.021 0.885 ‐0.14±0.07 3.636 0.058 ‐0.14±0.09 2.699 0.102
Strain type 2 0.350 0.705 0.421 0.657 0.371 0.690 0.423 0.655 0.115 0.891
Last outcome_W3 1 ‐0.19±0.11 2.764 0.098 0.14±0.15 0.782 0.377 0.16±0.16 1.076 0.301 0.21±0.13 2.667 0.104 0.25±0.15 2.710 0.101
and baseline hormones (T & CORT) on ARΔCt, ERαΔCt, ERβΔCt, GRΔCt, and 5-HT1ARΔCt in gonad tissue, controlling for standard length, strain types and last experience. (AR: androgen receptor; ERα: estrogen receptor α; ERβ: estrogen receptor β; GR: glucocorticoids receptor, 5-HT1AR: 5-HT1A receptor; T: testosterone; CORT: cortisol; * P < 0.05)
1The baseline was the ET1N group
2The baseline was the 0 h decay time treatment group
3The baseline group comprised individuals that lost their last fight prior to this experiment.
AR ΔCt
CORT 1 ‐0.14±0.09 2.289 0.131 0.11±0.06 3.200 0.075 0.18±0.05 15.128 <.001* 0.22±0.06 12.991 <.001* 0.44±0.18 6.147 0.014*
T 1 0.52±0.06 66.169 <.001* ‐0.18±0.04 16.342 <.001* ‐0.05±0.03 1.833 0.177 ‐0.22±0.04 23.810 <.001* ‐0.54±0.13 18.408 <.001*
Standard length 1 0.01±0.05 0.001 0.989 ‐0.02±0.04 0.329 0.567 ‐0.05±0.03 3.537 0.061 ‐0.02±0.04 0.224 0.637 0.02±0.10 0.059 0.808
Strain type 2 1.265 0.284 0.213 0.808 3.818 0.023* 0.027 0.973 2.830 0.061
Last outcome_W3 1 ‐0.13±0.09 1.956 0.163 ‐0.07±0.06 1.247 0.265 ‐0.08±0.05 2.642 0.105 ‐0.06±0.06 0.972 0.325 ‐0.13±0.18 0.151 0.474
controlling for standard length, strain type and last contest experience. In this model, I only analyzed the behavior of those individuals assigned to receive winning experiences (ET3W and ET1W individuals). In order to avoid the multicollinearity problem, the importance of each type of contest behaviors was tested separately. The first portion of the table shows the effect of decay time, number of experience, standard length, strain types and last experience on ΔCt of receptor genes examined without considering the influence of any types of contest behaviors. The second to the fifth portions of the table show the effect of the contest behaviors on ΔCt of receptor genes examined when the variables in the first portion of the table were already in the models. (AR: androgen receptor; ERα: estrogen receptor α; ERβ: estrogen receptor β; GR:
glucocorticoids receptor, 5-HT1AR: 5-HT1A receptor; * P < 0.05)
1The baseline was the 0h decay time treatment group
2The baseline group was the one experience group
AR ΔCt
(N=98)
ERα ΔCt (N=98)
ERβ ΔCt (N=98)
GR ΔCt (N=98)
5‐HT1AR ΔCt (N=98)
Variable df b±SE F P b±SE F P b±SE F P b±SE F P b±SE F P
Decay time 2 1.031 0.361 1.588 0.210 2.057 0.134 1.208 0.304 2.561 0.083
3h1 1 ‐0.20±0.23 0.781 0.379 0.51±0.32 2.505 0.117 0.52±0.32 2.717 0.103 0.45±0.29 2.403 0.125 0.74±0.33 5.121 0.026*
48h1 1 ‐0.32±0.22 2.019 0.159 0.48±0.32 2.237 0.138 0.58±0.31 3.399 0.069 0.19±0.29 0.449 0.505 0.36±0.33 1.228 0.271 Number of exp_32 1 ‐0.06±0.18 0.117 0.734 ‐0.02±0.26 0.007 0.932 ‐0.03±0.26 0.014 0.907 ‐0.20±0.23 0.724 0.397 ‐0.18±0.27 0.464 0.498 Standard length 1 ‐0.04±0.10 0.182 0.671 0.00±0.14 0.003 0.960 ‐0.03±0.13 0.045 0.833 ‐0.16±0.12 1.665 0.200 ‐0.15±0.14 1.191 0.278
Strain type 2 1.116 0.332 0.529 0.591 0.206 0.814 0.045 0.957 0.045 0.956
Last outcome_W3 1 0.00±0.19 0.022 0.967 ‐0.38±0.27 1.999 0.161 0.34±0.26 1.724 0.193 ‐0.21±0.24 0.769 0.383 0.25±0.27 0.833 0.364 Latency_moves 1 ‐0.04±0.09 0.212 0.646 0.09±0.13 0.526 0.470 0.11±0.12 0.846 0.360 0.24±0.11 4.692 0.033* 0.20±0.13 2.393 0.126 Latency_displays 1 ‐0.07±0.09 0.564 0.455 0.08±0.13 0.341 0.561 0.10±0.13 0.614 0.436 0.23±0.11 4.200 0.043* 0.18±0.13 1.954 0.166 Latency_gill displays 1 0.27±0.17 2.707 0.107 ‐0.57±0.29 3.979 0.053 ‐0.43±0.27 2.554 0.118 ‐0.34±0.27 1.575 0.216 ‐0.31±0.30 1.076 0.306 Latency_attacks 1 ‐0.17±0.09 3.189 0.078 0.09±0.13 0.454 0.502 0.10±0.13 0.539 0.465 0.21±0.12 2.994 0.087 0.19±0.14 2.003 0.161
whether or not the focal individuals initiated displays, gill displays, attacks, probability of escalation and contest duration) in the first experience training on ΔCt of receptor genes, controlling for standard length, strain type and last experience. In this model, I only analyzed the behavior of those individuals assigned to receive losing experiences (ET3L and ET1L individuals). In order to avoid the multicollinearity problem, I analyzed the contest behavior in the same way as I did in Table 8. (AR: androgen receptor; ERα: estrogen receptor α; ERβ: estrogen receptor β; GR:
glucocorticoids receptor, 5-HT1AR: 5-HT1A receptor; * P < 0.05)
1The baseline was the 0h decay time treatment group
2The baseline was the one experience group
AR ΔCt
(N=99)
ERα ΔCt (N=99)
ERβ ΔCt (N=99)
GR ΔCt (N=99)
5‐HT1AR ΔCt (N=99)
Variable df b±SE F P b±SE F P b±SE F P b±SE F P b±SE F P
Decay time 2 0.916 0.404 1.477 0.234 1.715 0.186 1.878 0.159 2.523 0.086
3h1 1 0.09±0.27 0.111 0.740 0.48±0.37 1.710 0.194 0.57±0.36 2.552 0.114 0.43±0.29 2.245 0.138 0.62±0.33 3.622 0.060 48h1 1 ‐0.27±0.27 0.943 0.334 0.60±0.37 2.619 0.109 0.58±0.36 2.585 0.113 0.53±0.29 3.284 0.073 0.66±0.33 3.930 0.056 Number of exp_32 1 0.47±0.22 4.397 0.039* ‐0.07±0.30 0.054 0.817 ‐0.23±0.29 0.644 0.424 ‐0.29±0.24 1.488 0.226 ‐0.37±0.27 1.889 0.173 Standard length 1 0.11±0.13 0.693 0.408 ‐0.11±0.18 0.332 0.566 ‐0.11±0.18 0.350 0.556 ‐0.27±0.15 3.458 0.066 ‐0.29±0.16 3.055 0.084
Strain type 2 0.127 0.881 1.330 0.270 1.475 0.234 2.222 0.114 1.836 0.165
Last outcome_W3 1 ‐0.26±0.22 1.364 0.246 0.01±0.30 0.002 0.977 0.05±0.29 0.035 0.852 0.21±0.24 0.776 0.381 0.15±0.27 0.322 0.572 Initiating displays 1 ‐0.06±0.13 0.689 0.689 ‐0.72±0.17 17.117 <.001* ‐0.64±0.17 13.985 <.001* ‐0.54±0.13 15.360 <.001* ‐0.57±0.15 13.047 <.001*
Initiating gill displays 1 ‐0.16±0.11 2.148 0.146 ‐0.61±0.14 18.647 <.001* ‐0.57±0.14 16.235 <.001* ‐0.26±0.12 4.548 0.036* ‐0.33±0.14 5.987 0.016*
Initiating attacks 1 ‐0.16±0.16 0.926 0.339 ‐0.42±0.22 3.627 0.060 ‐0.31±0.21 2.076 0.153 ‐0.21±0.18 1.392 0.241 ‐0.28±0.20 1.875 0.174 Escalation 1 ‐0.01±0.12 0.004 0.947 ‐0.21±0.16 1.510 0.222 ‐0.14±0.16 0.695 0.407 ‐0.20±0.13 2.342 0.129 ‐0.23±0.15 2.563 0.113 Contest duration 1 ‐0.10±0.12 0.627 0.431 ‐0.41±0.16 6.485 0.013* ‐0.30±0.16 3.655 0.059 ‐0.19±0.13 2.064 0.154 ‐0.18±0.15 1.524 0.220
hormone levels, and between hormone levels and receptor expressions. In this table, the relative gene expression levels are presented as
hormone levels, and between hormone levels and receptor expressions. In this table, the relative gene expression levels are presented as