Table 1. List of antibodies
Antibody Manufacturer Catalog
Number Application Dilution Fold Primary Antibodies
Anti-Actin Santa Cruz
Biotechnology Sc-1616 WB* 1/5000
(in gelatin-NET) Anti-Alb Bethyl
Laboratories A90-234A IF† 1/300
Anti-β-catenin Abcam Ab-2365 IF 1/300
Anti-β-catenin Santa Cruz
Biotechnology Sc-1496 IF 1/100
Anti-CK19 Santa Cruz
Biotechnology Sc-33119 IF 1/100
Anti-CK19 Home made FC‡ 1/250
Anti-EpCAM BD Bioscience 552370 IF 1/300
Anti-EpCAM Biolegend 324203 FC 1/250
Anti-HIF1α Novus
Biologicals NB-100-105 WB 1/1000
(in 4% skim milk)
IF 1/300
Anti-HIF1α Santa Cruz
Biotechnology Sc-10790 IF 1/100
Anti-HIF2α Novus
*WB: Western blotting ; †IF: immunofluorescence staining ; ‡FC: flow cytometry
Table 1. List of antibodies (continues)
Antibody Manufacturer Catalog
Number Application Dilution Fold Secondary Antibodies
Anti-goat AF488#
Life
Technologies A11055 IF 1/1000
Anti-goat AF647
Life
Technologies A21447 IF 1/1000
Anti-goat HRP
Bethyl
Laboratories A50-100P WB 1/10000
Anti-mouse HRP
Jackson
ImmunoResearch 115-035-003 WB 1/10000 Anti-rabbit
AF488
Life
Technologies A21206 IF 1/1000
Anti-rabbit AF647
Life
Technologies A21443 IF 1/1000
Anti-rabbit HRP
Jackson
ImmunoResearch 111-035-003 WB 1/10000 Anti-rat
AF488
Life
Technologies A21208 IF 1/1000
#AF: Alexa Fluoro
Table 2. List of qRTPCR primers
Table 2. List of qRTPCR primers (continues) Axin2 Forward CT TAAAGGTCTTGAGGGTTGAC
Reverse CAACAGATCATCCCATCCAACA Cyclin D1 Forward CAATGACCCCGCACGATTTC
Reverse CATGGAGGGCGGATTGGAA
Figure 1. H&E staining of mice liver
H&E staining of mice underwent 0, 2, 4, 6 weeks of CCl4 injection. Blue arrows
represented degenerated and ballooned hepatocytes. Black arrow indicated immune cell infiltration.
Magnification: 100×
Figure 2. Masson’s trichrome staining of mice liver
Masson’s trichrome stain of mice underwent 0, 2, 4, 6 weeks of CCl4 injection.
Collagen fibers were stained blue.
Magnification: 100×
Figure 3. Fibrotic marker mRNA expression level in whole mice liver
qRTPCR analysis of fibrotic marker (αSMA and Col1a1) of RNA isolated from whole mice liver with or without 6 weeks of CCl4 injection. Results were normalized to the expression of control (0w) groups using GAP and β-actin as reference genes. ***p<0.01;
Student’s t-test.
Figure 4. Immunofluorescence staining of HIF1α in mice liver
8µm thick cryostats from non- and 6 week-CCl4-treated livers were stained with HIF1α antibodies. Hoechst represented Hoechst 33342. Magnification: 200×
Figure 5. mRNA expression level of HIF1α in whole mice liver
qRTPCR analysis of HIF1α of mRNA isolated from whole mice liver with or without 6 weeks of CCl4 injection. Results were normalized to the expression of control (0w) groups using GAP and β-actin as reference genes.
Figure 6. Fibrotic markers and HIF1α mRNA expression level in LMD liver qRTPCR analysis of RNA isolated from LMD liver with or without 6 weeks of CCl4
injection. αSMA, Col1a1 and Timp2 represented fibrotic marker. Results were
normalized to the expression of Ctrl groups using GAP and β-actin as reference genes.
*p<0.05; Student’s t-test.
Figure 7. Immunofluorescence staining of HIF1α and HPC markers
Figure 7. Immunofluorescence staining of HIF1α and HPC markers (continue) (A) 8µm thick cryostats from non- and 6 week-CCl4-treated liver were stained with Alb
antibody.
(B) 8µm thick cryostats from non- and 6 week-CCl4-treated liver were stained with HIF1α and EpCAM antibodies.
(C) 8µm thick cryostats from non- and 6 week-CCl4-treated liver were stained with HIF1α and CK19 antibodies.
(D) 8µm thick cryostats from non- and 6 week-CCl4-treated liver were stained with EpCAM and CK19 antibodies.
Hoechst represented Hoechst 33342. Magnification: 200×
Figure 8. mRNA expression level of HPC markers in LMD liver
qRTPCR analysis of RNA isolated from LMD liver with or without 6 weeks of CCl4
injection. Results were normalized to the expression of Ctrl groups using GAP and β-actin as reference genes. *p<0.05; Student’s t-test.
Figure 9. Immunofluorescence staining of Wnt/β-catenin signaling activation
(A) 8µm thick cryostats from non- and 6 week-CCl4-treated liver were stained with HIF1α and β-catenin antibody.
(B) 8µm thick cryostats from non- and 6 week-CCl4-treated liver were stained with EpCAM and β-catenin antibodies.
(C) 8µm thick cryostats from non- and 6 week-CCl4-treated liver were stained with CK19 and β-catenin antibodies.
Hoechst represented Hoechst 33342. Magnification: 200×
Figure 10. mRNA expression level of Wnt downstream targets in LMD liver
qRTPCR analysis of RNA isolated from LMD liver with or without 6 weeks of CCl4
injection. Results were normalized to the expression of Ctrl groups using GAP and β-actin as reference genes. *p<0.05; ***p<0.01; Student’s t-test.
Figure 11. Confirmation of Huh7 hypoxic culture by HIF1α and HIF2α proteins
Western analysis of HIF1α and HIF2α of Huh7 cultured under normoxia or hypoxia for 24 or 48 hours. β-actin served as loading control.
Figure 12. Confirmation of Huh7 hypoxic culture by HIFs downstream targets
qRTPCR analysis of RNA isolated from normoxic or hypoxic cultured Huh7. Duration of cultures were shown in the figure. Results were normalized to the expression of the normoxic groups of each time points using β-actin and 18S rRNA as reference genes.
***p<0.01; Student’s t-test.
Figure 13. mRNA expression level of HPC markers in Huh7
qRTPCR analysis of RNA isolated from normoxic or hypoxic cultured Huh7. Duration of cultures were shown in the figure. Results were normalized to the expression of the normoxic groups of each time points using β-actin and 18S rRNA as reference genes.
***p<0.01; Student’s t-test.
Figure 14. mRNA expression level of Wnt downstream target genes in Huh7
qRTPCR analysis of RNA isolated from normoxic or hypoxic cultured Huh7. Duration of cultures were shown in the figure. Results were normalized to the expression of the normoxic groups of each time points using β-actin and 18S rRNA as reference genes.
***p<0.01; Student’s t-test.
Figure 15. EpCAM protein expression in Huh7
Flow cytometry assay of EpCAM in Huh7 cultured under normoxia or hypoxia for 48 hours. Data were analyzed using FlowJo software and histogram overlays were displayed as %Max, scaling each curve to mode = 100%.
Figure 16. CK19 protein expression in Huh7
Flow cytometry assay of CK19 in Huh7 cultured under normoxia or hypoxia for 48 hours. Data were analyzed using FlowJo software and histogram overlays were displayed as %Max, scaling each curve to mode = 100%.
Figure 17. Immunofluorescence staining of β-catenin in Huh7
Huh7 cultured under normoxic or hypoxic conditions for 24 hours were stained with HIF1α and β-catenin antibodies. Hoechst represented Hoechst 33342.
Magnification: 100×
Figure 18. Possible mechanisms
During liver fibrosis, collagen accumulation would cause hypoxic environment around portal vein, where HPC resides, and induce the activation of HIF signaling (○1 ). Wnt signaling would also be stimulated during hepatic fibrosis (○2 ). The activation of both HIF and Wnt signaling would cause stabilize β-catenin, leading to its accumulation in cytoplasm (○3 ). HIF and Wnt signaling would also upregulate EpCAM expression (○4 ).
Upregulated EpCAM and accumulated β-catenin would translocate into nucleus and act together with Lef as a transcription complex to induceWnt and EpCAM target genes expression, modulating the differentiation fates of HPC (○5 ).
Reference
Apte, U., Thompson, M.D., Cui, S., Liu, B., Cieply, B., and Monga, S.P. (2008).
Wnt/beta-catenin signaling mediates oval cell response in rodents. Hepatology 47, 288-295.
Bao, B., Ahmad, A., Kong, D., Ali, S., Azmi, A.S., Li, Y., Banerjee, S., Padhye, S., and Sarkar, F.H. (2012). Hypoxia induced aggressiveness of prostate cancer cells is linked with deregulated expression of VEGF, IL-6 and miRNAs that are attenuated by CDF.
PLoS One 7, e43726.
Bengochea, A., de Souza, M.M., Lefrancois, L., Le Roux, E., Galy, O., Chemin, I., Kim, M., Wands, J.R., Trepo, C., Hainaut, P., et al. (2008). Common dysregulation of
Wnt/Frizzled receptor elements in human hepatocellular carcinoma. Br J Cancer 99, 143-150.
Bogaerts, E., Heindryckx, F., Vandewynckel, Y.P., Van Grunsven, L.A., and Van Vlierberghe, H. (2014). The roles of transforming growth factor-beta, Wnt, Notch and hypoxia on liver progenitor cells in primary liver tumours (Review). Int J Oncol 44, 1015-1022.
Boulter, L., Govaere, O., Bird, T.G., Radulescu, S., Ramachandran, P., Pellicoro, A., Ridgway, R.A., Seo, S.S., Spee, B., Van Rooijen, N., et al. (2012). Macrophage-derived Wnt opposes Notch signaling to specify hepatic progenitor cell fate in chronic liver
disease. Nat Med 18, 572-579.
Cannito, S., Paternostro, C., Busletta, C., Bocca, C., Colombatto, S., Miglietta, A., Novo, E., and Parola, M. (2014). Hypoxia, hypoxia-inducible factors and fibrogenesis in
chronic liver diseases. Histol Histopathol 29, 33-44.
Carpino, G., Renzi, A., Onori, P., and Gaudio, E. (2013). Role of hepatic progenitor cells in nonalcoholic fatty liver disease development: cellular cross-talks and molecular networks. Int J Mol Sci 14, 20112-20130.
Chen, S., Xu, L., Lin, N., Pan, W., Hu, K., and Xu, R. (2011). Activation of Notch1 signaling by marrow-derived mesenchymal stem cells through cell-cell contact inhibits proliferation of hepatic stellate cells. Life Sci 89, 975-981.
Chen, Y., Wong, P.P., Sjeklocha, L., Steer, C.J., and Sahin, M.B. (2012a). Mature hepatocytes exhibit unexpected plasticity by direct dedifferentiation into liver progenitor cells in culture. Hepatology 55, 563-574.
Chen, Y.F., Tseng, C.Y., Wang, H.W., Kuo, H.C., Yang, V.W., and Lee, O.K. (2012b).
Rapid generation of mature hepatocyte-like cells from human induced pluripotent stem cells by an efficient three-step protocol. Hepatology 55, 1193-1203.
Clevers, H., and Nusse, R. (2012). Wnt/beta-catenin signaling and disease. Cell 149, 1192-1205.
Cunningham, L.A., Candelario, K., and Li, L. (2012). Roles for HIF-1alpha in neural
stem cell function and the regenerative response to stroke. Behav Brain Res 227, 410-417.
Dong, Z.Z., Yao, M., Wang, L., Wu, W., Gu, X., and Yao, D.F. (2013).
Hypoxia-inducible factor-1alpha: molecular-targeted therapy for hepatocellular carcinoma. Mini Rev Med Chem 13, 1295-1304.
Espanol-Suner, R., Carpentier, R., Van Hul, N., Legry, V., Achouri, Y., Cordi, S., Jacquemin, P., Lemaigre, F., and Leclercq, I.A. (2012). Liver progenitor cells yield functional hepatocytes in response to chronic liver injury in mice. Gastroenterology 143, 1564-1575 e1567.
Friedman, S.L. (2008). Hepatic fibrosis -- overview. Toxicology 254, 120-129.
Ge, W.S., Wang, Y.J., Wu, J.X., Fan, J.G., Chen, Y.W., and Zhu, L. (2014). beta-catenin is overexpressed in hepatic fibrosis and blockage of Wnt/beta-catenin signaling inhibits hepatic stellate cell activation. Mol Med Rep 9, 2145-2151.
Hemmann, S., Graf, J., Roderfeld, M., and Roeb, E. (2007). Expression of MMPs and TIMPs in liver fibrosis - a systematic review with special emphasis on anti-fibrotic strategies. J Hepatol 46, 955-975.
Herlyn, D., Herlyn, M., Steplewski, Z., and Koprowski, H. (1979). Monoclonal antibodies in cell-mediated cytotoxicity against human melanoma and colorectal carcinoma. Eur J Immunol 9, 657-659.
Holland, J.D., Klaus, A., Garratt, A.N., and Birchmeier, W. (2013). Wnt signaling in stem and cancer stem cells. Curr Opin Cell Biol 25, 254-264.
Imanirad, P., and Dzierzak, E. (2013). Hypoxia and HIFs in regulating the development of the hematopoietic system. Blood Cells Mol Dis 51, 256-263.
Kanta, J., and Chlumska, A. (1991). Regenerative ability of hepatocytes is inhibited in early stages of liver fibrosis. Physiol Res / Academia Scientiarum Bohemoslovaca 40, 453-458.
Katoh, M. (2011). Network of WNT and other regulatory signaling cascades in pluripotent stem cells and cancer stem cells. Curr Pharm Biotechnol 12, 160-170.
Kuhl, S.J., and Kuhl, M. (2013). On the role of Wnt/beta-catenin signaling in stem cells.
Biochim Biophys Acta 1830, 2297-2306.
Kumar, V., Abbas, A.K., Aster, J.C., and Robbins, S.L. (2013). Robbins basic pathology (Philadelphia, PA: Elsevier/Saunders).
Kuramitsu, K., Sverdlov, D.Y., Liu, S.B., Csizmadia, E., Burkly, L., Schuppan, D., Hanto, D.W., Otterbein, L.E., and Popov, Y. (2013). Failure of fibrotic liver regeneration in mice is linked to a severe fibrogenic response driven by hepatic progenitor cell activation. Am J Pathol 183, 182-194.
Lee, U.E., and Friedman, S.L. (2011). Mechanisms of hepatic fibrogenesis. Best Pract Res Clin Gastroenterol 25, 195-206.
Lefton, H.B., Rosa, A., and Cohen, M. (2009). Diagnosis and epidemiology of cirrhosis.
Medical Clin North Am 93, 787-799, vii.
Maetzel, D., Denzel, S., Mack, B., Canis, M., Went, P., Benk, M., Kieu, C., Papior, P., Baeuerle, P.A., Munz, M., et al. (2009). Nuclear signalling by tumour-associated antigen EpCAM. Nat Cell Biol 11, 162-171.
Malato, Y., Naqvi, S., Schurmann, N., Ng, R., Wang, B., Zape, J., Kay, M.A., Grimm, D., and Willenbring, H. (2011). Fate tracing of mature hepatocytes in mouse liver homeostasis and regeneration. J Clin Invest 121, 4850-4860.
Marshall, A., Rushbrook, S., Davies, S.E., Morris, L.S., Scott, I.S., Vowler, S.L., Coleman, N., and Alexander, G. (2005). Relation between hepatocyte G1 arrest, impaired hepatic regeneration, and fibrosis in chronic hepatitis C virus infection.
Gastroenterology 128, 33-42.
Mathieu, J., Zhang, Z., Zhou, W., Wang, A.J., Heddleston, J.M., Pinna, C.M., Hubaud, A., Stadler, B., Choi, M., Bar, M., et al. (2011). HIF induces human embryonic stem cell markers in cancer cells. Cancer Res 71, 4640-4652.
Mazumdar, J., O'Brien, W.T., Johnson, R.S., LaManna, J.C., Chavez, J.C., Klein, P.S., and Simon, M.C. (2010). O2 regulates stem cells through Wnt/β-catenin signalling. Nat Cell Biol 12, 1007-1013.
Michalopoulos, G.K. (2007). Liver regeneration. J Cell Physiol 213, 286-300.
Moeini, A., Cornella, H., and Villanueva, A. (2012). Emerging Signaling Pathways in Hepatocellular Carcinoma. Liver cancer 1, 83-93.
Mohyeldin, A., Garzon-Muvdi, T., and Quinones-Hinojosa, A. (2010). Oxygen in stem cell biology: a critical component of the stem cell niche. Cell Stem Cell 7, 150-161.
Munz, M., Baeuerle, P.A., and Gires, O. (2009). The emerging role of EpCAM in cancer and stem cell signaling. Cancer Res 69, 5627-5629.
Ogawa, K., Tanaka, S., Matsumura, S., Murakata, A., Ban, D., Ochiai, T., Irie, T., Kudo, A., Nakamura, N., Tanabe, M., et al. (2014). EpCAM-targeted therapy for human hepatocellular carcinoma. Ann Surg Oncol 21, 1314-1322.
Osta, W.A., Chen, Y., Mikhitarian, K., Mitas, M., Salem, M., Hannun, Y.A., Cole, D.J., and Gillanders, W.E. (2004). EpCAM is overexpressed in breast cancer and is a
potential target for breast cancer gene therapy. Cancer Res 64, 5818-5824.
Ramakrishna, G., Rastogi, A., Trehanpati, N., Sen, B., Khosla, R., and Sarin, S.K.
(2013). From Cirrhosis to Hepatocellular Carcinoma: New Molecular Insights on Inflammation and Cellular Senescence. Liver cancer 2, 367-383.
Schepers, A., and Clevers, H. (2012). Wnt signaling, stem cells, and cancer of the gastrointestinal tract. Cold Spring Harb Perspect Biol 4, a007989.
Semenza, G.L. (2007). Hypoxia-Inducible Factor 1 (HIF-1) Pathway. Sci STKE 2007, 407-cm8.
Shin, S., and Kaestner, K.H. (2014). The origin, biology, and therapeutic potential of facultative adult hepatic progenitor cells. Curr Top Dev Biol 107, 269-292.
Si-Tayeb, K., Noto, F.K., Nagaoka, M., Li, J., Battle, M.A., Duris, C., North, P.E., Dalton, S., and Duncan, S.A. (2010). Highly efficient generation of human
hepatocyte-like cells from induced pluripotent stem cells. Hepatology 51, 297-305.
Taura, K., Miura, K., Iwaisako, K., Osterreicher, C.H., Kodama, Y., Penz-Osterreicher, M., and Brenner, D.A. (2010). Hepatocytes do not undergo epithelial-mesenchymal transition in liver fibrosis in mice. Hepatology 51, 1027-1036.
Trzpis, M., McLaughlin, P.M., van Goor, H., Brinker, M.G., van Dam, G.M., de Leij, L.M., Popa, E.R., and Harmsen, M.C. (2008). Expression of EpCAM is up-regulated during regeneration of renal epithelia. J Pathol 216, 201-208.
Wang, Y., Huang, Y., Guan, F., Xiao, Y., Deng, J., Chen, H., Chen, X., Li, J., Huang, H., and Shi, C. (2013). Hypoxia-inducible factor-1alpha and MAPK co-regulate activation of hepatic stellate cells upon hypoxia stimulation. PLoS One 8, e74051.
Wells, R.G. (2008). Cellular sources of extracellular matrix in hepatic fibrosis. Clin Liver Dis 12, 759-768, viii.
Williams, M.J., Clouston, A.D., and Forbes, S.J. (2014). Links between hepatic fibrosis, ductular reaction, and progenitor cell expansion. Gastroenterology 146, 349-356.
Yamada, S., Utsunomiya, T., Morine, Y., Imura, S., Ikemoto, T., Arakawa, Y., Kanamoto,
M., Iwahashi, S., Saito, Y., Takasu, C., et al. (2014). Expressions of Hypoxia-Inducible Factor-1 and Epithelial Cell Adhesion Molecule are Linked with Aggressive Local Recurrence of Hepatocellular Carcinoma After Radiofrequency Ablation Therapy. Ann Surg Oncol. 21, 436-442
Yamashita, T., Budhu, A., Forgues, M., and Wang, X.W. (2007). Activation of hepatic stem cell marker EpCAM by Wnt-beta-catenin signaling in hepatocellular carcinoma.
Cancer Res 67, 10831-10839.
Yamashita, T., Forgues, M., Wang, W., Kim, J.W., Ye, Q., Jia, H., Budhu, A., Zanetti, K.A., Chen, Y., Qin, L.X., et al. (2008). EpCAM and alpha-fetoprotein expression defines novel prognostic subtypes of hepatocellular carcinoma. Cancer Res 68, 1451-1461.
Yanger, K., and Stanger, B.Z. (2011). Facultative stem cells in liver and pancreas: fact and fancy. Dev Dyn 240, 521-529.
Yoon, S.M., Gerasimidou, D., Kuwahara, R., Hytiroglou, P., Yoo, J.E., Park, Y.N., and Theise, N.D. (2011). Epithelial cell adhesion molecule (EpCAM) marks hepatocytes newly derived from stem/progenitor cells in humans. Hepatology 53, 964-973.
Zhang, L., Theise, N., Chua, M., and Reid, L.M. (2008). The stem cell niche of human livers: symmetry between development and regeneration. Hepatology 48, 1598-1607.
Zhang, Q., Bai, X., Chen, W., Ma, T., Hu, Q., Liang, C., Xie, S., Chen, C., Hu, L., Xu,
S., et al. (2013). Wnt/beta-catenin signaling enhances hypoxia-induced
epithelial-mesenchymal transition in hepatocellular carcinoma via crosstalk with hif-1alpha signaling. Carcinogenesis 34, 962-973.
Zhao, J.H., Luo, Y., Jiang, Y.G., He, D.L., and Wu, C.T. (2011). Knockdown of beta-Catenin through shRNA cause a reversal of EMT and metastatic phenotypes induced by HIF-1alpha. Cancer Invest 29, 377-382.
Appendix
EpCAM Epithelial cell adhesion molecule EpEx EpCAM extracellular domain EpICD EpCAM intracellular domain
GAP Glyceraldehyde-3-phosphate dehydrogenase HIF Hypoxia inducible factor
Lef1 Lymphoid enhancer-binding factor 1 PDGFa Platelet-derived growth factor a αSMA α smooth muscle actin
Tcf7 Transcription factor 7 TGFβ Tumor growth factor β
Timp2 Tissue inhibitor of metalloproteinase 2 VEGFa Vascular endothelial growth factor a
Cell HSC Hepatic stellate cell
HPC Hepatic progenitor cell
Others
AF Alexa Fluoro
ECM Extracellular matrix
FC Flow cytometry
HCC Hepatocellular carcinoma
ICC Intrahepatic cholangiocellular carcinoma IF Immunofluorescence staining
LMD Laser microdissection WB Western blotting