• 沒有找到結果。

To investigate the interplay between HSA32 from higher and lower plant origins, HSA32 and HSP101 homologs have been introduced into HSA32 and HSP101 knockout mutant, respectively. However, HA-tagged HSP101 could neither complement the defect of hsp101 in SAT nor promote the expression of HSA32 (Fig. 9 and 10). It had been reported that overexpression of AtHSP101 in rice showed significantly better thermotolerance (Katiyar-Agarwal et al., 2003). Constitutive HSP101 expression also provides a thermotolerance advantage to Arabidopsis (Queitsch et al., 2000). Therefore, introducing HSP101 homologs without any tags into hsp101 could be a feasible strategy and the availability of a suitable antibody against lower plant HSP101 homologs is critical.

We tried to solve the mechanism of HSA32 in prolonging heat stress memory at molecular level. Current cues suggest that HSA32 may probably act as a sulfotransferase or an enzyme involved in sulfur metabolism. Sulfotransferase involves in post-translational modification of proteins and altering biological efficacy of many natural compounds by transferring sulfate group from PAPS to various kinds of substrates (Ravilious and Jez, 2012); it is expected that the PAPS-binding motif is essential for their function. GGK→AAA point mutations were used to determine the importance of hamster estrogen sulfotransferase (Komatsu et al., 1994). The same point mutations can also be introduced in Arabidopsis HSA32 to determine the importance of its putative

PAPS-binding motif.

To identify candidate substrate or product of HSA32, comparing sulfur metabolite profiles between wild type and hsa32-1 after heat stress might be a feasible way. Sulfur-containing compounds are sometimes reactive. Preserving the redox state of sulfur metabolites during extraction is important for further analysis (Godat et al., 2010). Cold organic solvents or boiling strong acid solvents (hydrochloric acid, phosphoric acid, or

perchloric acid) were used to stop enzymatic reaction (Noctor and Foyer, 1998; Lenton et al., 1999; Hammermeister et al., 2000; Guček et al., 2002). Liquid chromatography

coupled to mass detectors (LC-MS) methods were often utilized to analyze sulfur metabolites (Godat et al., 2010; Mushtaq et al., 2014). Powerful data analysis software and high-quality database are required to select candidate HSA32 products.

Gidda and Varin (2006) created a substrate library comprises more than 100 compounds of plant and animal origin including phenolic acids, brassinosteroids, desulfoglucosinolates, salicylic acid, gibberellic acid, phenylpropanoids, hydroxy jasmonates, flavones, flavonols and hydroxycoumarins to test substrate specificity of SOT5. If the PAPS-binding motif is important for HSA32, similar in vitro sulfotransferase assays could be performed by using 35S-labeled PAPS and various kinds of compounds containing hydroxyl group as substrates. After the enzyme reaction, the compounds in the reaction mixture can be separated by TLC to identify any 35S-labeled compound.

Tables and Figures

Table 2. The distribution of 973 hits of HSA32 homologs from 1KP database in twelve divisions of Viridiplantae.

Divisions Hits

Chlorophyta 4

Charophyta 2

Marchantiophyta 24

Anthocerotophyta 4

Bryophyta 23

Lycopodiophyta 23

Pteridophyta 99

Cycadophyta 4

Gnetophyta 3

Ginkgophyta 1

Pinophyta 76

Magnoliophyta 710

Total 973

Figure 1. Alignment and phylogenic analysis of HSA32 homologs. (A) Amino acid sequences alignment of HSA32 homologs from 1 KP database. PAPS-binding motif

sequence (GXXGXXK) is indicated underneath. (B) Phylogenic analysis of HSA32 homologs from 1KP database. The bootstrap values (as a proportion of the 1000 replicates) are indicated at the branches. The scale bar represents 20 amino acid replacements/100 positions. (C) Amino acid sequences alignment of HSA32 homologs from NCBI database.

PAPS-binding motif sequence (GXXGXXK) is indicated in red on the top of the alignment. (D) Phylogenic analysis of HSA32 homologs from NCBI database. The bootstrap values (as a proportion of the 1000 replicates) are indicated at the branches. The scale bar represents 50 amino acid replacements/100 positions. The accession numbers are listed in Appendix Table 7.

Figure 2. (A) Analysis of 35S-labeled metabolites in Arabidopsis wide type (WT) and hsa32-1 by TLC before (C) and after heat (H) treatment. Choline sulfate (CS) and PAPS

were used as standards. The 0.6 Rf signals were quantified by using ImageJ. Results are

presented as mean values of three biological replicates ± SD. *P < 0.05 (versus control, Student’s t-test). (B) Choline sulfate content was measured by UPLC-MS/MS in WT and

hsa32-1 before (C) and after (H) 24 h of recovery from 1 h heat stress at 37°C. Results

are presented as mean values of three biological replicates ± SD.

Figure 3. Construction of binary vector containing PpHSA32. (A) Vector map of pCR8-PpHSA32. (B) PCR products of PpHSA32 (left) and the purified PCR product (right). (C) Eight clones of pCR8-PpHSA32 were separately digested by KpnI and SacI. (D) Binary vector map of 3HA-PpHSA32. (E) Eight clones of pCAMBIA1390-3HA-PpHSA32 were digested by KpnI and SacI. m: DNA marker (bp); -: plasmids without restriction enzyme digestion; +: plasmids digested by restriction enzymes.

Figure 4. Phenotype and protein expression pattern of HSA32 homolog complementation

lines after heat stress. (A) Phenotype of six independent transgenic lines of PpHSA32 after seven days of recovery from LAT assay. (B) Immunoblotting analysis of HSP101 and HSA32 homologs in four PpHSA32 independent transgenic lines. The numbers below indicate the relative amount of HSP101 from 48-h recovered samples. (C) Phenotype of HSA32 homologs complementation lines after seven days of recovery from LAT assay. (D) Immunoblotting analysis of HSP101 and HSA32 homologs in HSA32 homolog complementation lines. Relative amount of HSP101 from 48-hrecovered sample were quantified. (E) Quantitative PCR analysis of relative transcript level of HSA32 in wild type (WT) and AtHSA32 complementation line (AtHSA32). Relative amount of HSA32 protein quantified from immunoblotting was normalized to TUBULIN. Results are presented as mean values of three biological replicates ± SD. *P < 0.05 (versus control, Student’s t-test).

Figure 5. Construction of binary vector containing AtHSP101. (A) Vector map of pCR8-AtHSP101p::3HA-AtHSP101. (B) PCR products of AtHSP101 promoter, 3X HA, and

AtHSP101 cDNA. (C) Overlap extension PCR product of AtHSP101 promoter-3X

HA-AtHSP101. (D) Eight clones of pCR8-AtHSP101p::3HA-AtHSP101 were separately

digested by ApaI and BglII. (E) Binary vector map of pCAMBIA1390- AtHSP101. (F) Eight clones of pCAMBIA1390- AtHSP101p::3HA-AtHSP101 were separately digested by ApaI and BglII. m: DNA marker (bp); -: plasmids without restriction enzyme digestion; +: plasmids digested by restriction enzymes.

Figure 6. Construction of binary vector containing OsHSP101. (A) Vector map of pCR8-AtHSP101p::3HA-OsHSP101. (B) PCR products of 3X HA and OsHSP101 cDNA. (C)

Overlap extension PCR product of 3X HA-OsHSP101. (D) Eight clones of 3HA-OsHSP101 were separately digested by NsiI. (E) Three clones of pCR8-AtHSP101p::3HA-OsHSP101 were separately digested by NsiI. (F) Binary vector map of pCAMBIA1390- AtHSP101p::3HA-OsHSP101. (G) Six clones of pCAMBIA1390- AtHSP101p::3HA-OsHSP101 were separately digested by ApaI and BglII. m: DNA marker (bp); -: plasmids without restriction enzyme digestion; +: plasmids digested by restriction enzymes.

Figure 7. Construction of binary vector containing PpClpB-1. (A) Vector map of pCR8-AtHSP101p::3HA-PpClpB-1. (B) PCR products of 3X HA and PpCLpB-1 cDNA. (C)

Overlap extension PCR product of 3X HA-PpClpB-1. (D) Nine clones of pCR8-3HA-PpClpB-1 were separately digested by NsiI. (E) Eight clones of pCR8-AtHSP101p::3HA-PpClpB-1 were separately digested by ApaI and BglII. (F) Binary vector map of pCAMBIA1390- AtHSP101p::3HA-PpClpB-1. (G) Eight clones of pCAMBIA1390- AtHSP101p::3HA-PpClpB1 were separately digested by ApaI and BglII. m: DNA marker (bp); -: plasmids without restriction enzyme digestion; +: plasmids digested by restriction enzymes.

Figure 8. Construction of binary vector containing PpClpB-2. (A) Vector map of pCR8-AtHSP101p::3HA-PpClpB-2. (B) PCR products of 3X HA and PpCLpB-2 cDNA. (C)

Overlap extension PCR product of 3X HA-PpClpB-2. (D) Eight clones of 3HA-PpClpB-2 were separately digested by BglII. (E) Eight clones of pCR8-AtHSP101p::3HA-PpClpB-2 were separately digested by ApaI and BglII. (F) Binary vector map of pCAMBIA1390- AtHSP101p::3HA-PpClpB-2. (G) Eight clones of pCAMBIA1390- AtHSP101p::3HA-PpClpB2 were separately digested by ApaI and BglII. m: DNA marker (bp); -: plasmids without restriction enzyme digestion; +: plasmids digested by restriction enzymes.

Figure 9. SAT assay of the transgenic lines harboring HSP101 homologs. (A) Immunoblotting analysis of HSP101 homologs in HSP101 homolog complementation lines before HS and after 2 h of recovery from 37°C for 1 h. The numbers below indicate the relative amount of AtHSP101 and OsHSP101 recognized by an antibody against AtHSP101. (B) Phenotypes of HSP101 homolog complementation lines after seven days of recovery from SAT assay.

Figure 10. Protein expression pattern of HSP101 and HSA32 in wild type (WT), hsp101 (101), and twoAtHSP101 complementation lines (#7 and #10) after 2 and 24 h of recovery from 37°C 1 h heat stress.

Appendix

Appendix Table 1. BIC scores, AICc value, and lnL value of maximum likelihood of HSA32 homologs from NCBI fits of 56 different amino acid substitution models.

Model BIC AICc lnL

LG+G 88111.42029 83897.03091 -41465.96588

LG+G+I 88122.25604 83899.06917 -41465.96588

LG+G+F 88431.62404 84050.09609 -41523.12813

LG+G+I+F 88442.45979 84052.13588 -41523.12813

WAG+G 88749.4346 84535.04523 -41784.97304

WAG+G+I 88760.27035 84537.08348 -41784.97304

WAG+G+F 88969.49762 84587.96967 -41792.06492

WAG+G+I+F 88980.33337 84590.00946 -41792.06492 rtREV+G+F 89035.08914 84653.56118 -41824.86068 rtREV+G+I+F 89045.92489 84655.60098 -41824.86068

rtREV+G 89231.26418 85016.87481 -42025.88783

rtREV+G+I 89242.09993 85018.91307 -42025.88783

JTT+G 89253.2769 85038.88753 -42036.89419

JTT+G+I 89264.11265 85040.92578 -42036.89419

JTT+G+F 89565.00479 85183.47684 -42089.81851

JTT+G+I+F 89575.84054 85185.51663 -42089.81851 Dayhoff+G 90132.39102 85918.00165 -42476.45125 Dayhoff+G+I 90143.22677 85920.0399 -42476.45125

cpREV+G 90168.59388 85954.20451 -42494.55268

cpREV+G+I 90179.42964 85956.24277 -42494.55268 Dayhoff+G+F 90275.48088 85893.95293 -42445.05655 Dayhoff+G+I+F 90286.31663 85895.99272 -42445.05655 cpREV+G+F 90495.16891 86113.64095 -42554.90056 cpREV+G+I+F 90506.00466 86115.68075 -42554.90056 mtREV24+G+F 90775.00556 86393.4776 -42694.81889 mtREV24+G+I+F 90785.84131 86395.5174 -42694.81889

LG 91461.09177 87255.49998 -43146.2195

LG+I 91471.92753 87257.53816 -43146.2195

WAG 91665.91258 87460.32079 -43248.6299

WAG+I 91676.74833 87462.35895 -43248.6299

LG+F 91767.86248 87395.13056 -43196.66523

LG+I+F 91778.69823 87397.17028 -43196.66523

WAG+F 91901.28384 87528.55192 -43263.37591

WAG+I+F 91912.11959 87530.59164 -43263.37591

rtREV+F 92387.3549 88014.62298 -43506.41143

rtREV+I+F 92453.66868 88072.14073 -43534.15045

JTT 92522.20847 88316.61668 -43676.77785

rtREV 92532.72434 88327.13255 -43682.03578

JTT+I 92533.11224 88318.72287 -43676.81186

rtREV+I 92543.62696 88329.23758 -43682.06922

JTT+F 92858.69094 88485.95902 -43742.07946

JTT+I+F 92932.79499 88551.26704 -43773.71361 Dayhoff 93471.56601 89265.97422 -44151.45662 Dayhoff+I 93482.40176 89268.01239 -44151.45662

mtREV24+G 93639.6203 89425.23093 -44230.06589

mtREV24+G+I 93650.45605 89427.26918 -44230.06589

cpREV 93660.56407 89454.97227 -44245.95565

Dayhoff+F 93661.06259 89288.33067 -44143.26528 Dayhoff+I+F 93671.89834 89290.37039 -44143.26528

cpREV+I 93732.41689 89518.02752 -44276.46418

cpREV+F 94037.73305 89665.00113 -44331.60051

cpREV+I+F 94045.95812 89664.43017 -44330.29517

mtREV24+F 94602.03192 90229.3 -44613.74995

mtREV24+I+F 94612.86767 90231.33972 -44613.74995

mtREV24 98463.90572 94258.31392 -46647.62647

mtREV24+I 98623.66235 94409.27298 -46722.08691 Abbreviations: BIC: Bayesian Information Criterion; AICc: Akaike Information Criterion; lnL: Maximum Likelihood value; GTR: General Time Reversible; JTT:

Jones-Taylor-Thornton; rtREV: General Reverse Transcriptase; cpREV: General Reversible Chloroplast; mtREV24: General Reversible Mitochondrial; G: Gamma distribution; I: evolutionarily invariable; F: amino acid frequencies.

Appendix Table 2. BIC scores, AICc value, and lnL value of maximum likelihood of HSA32 homologs from 1KP database fits of 56 different amino acid substitution models.

Model BIC AICc lnL

JTT+G+I 13815.70615 13416.59932 -6648.751929

JTT+G 13817.62745 13425.26704 -6654.104124

LG+G 13846.97595 13454.61554 -6668.778375

LG+G+I 13853.85269 13454.74586 -6667.825198

WAG+G 13959.60784 13567.24743 -6725.094322

WAG+G+I 13959.64849 13560.54166 -6720.723098

JTT+G+F 13969.30813 13448.874 -6646.505115

JTT+G+I+F 13969.44793 13442.27942 -6642.18347

cpREV+G 13976.87426 13584.51384 -6733.727527

cpREV+G+I 13997.07727 13597.97044 -6739.437488

LG+G+F 13998.61478 13478.18064 -6661.158437

LG+G+I+F 14001.7979 13474.62938 -6658.358451

JTT+I 14057.30854 13664.94813 -6773.944672

Dayhoff+G+I 14091.47277 13692.36594 -6786.635238 Dayhoff+G 14092.49341 13700.13299 -6791.537102

WAG+G+F 14094.95266 13574.51852 -6709.327377

WAG+G+I+F 14096.6048 13569.43628 -6705.761903

rtREV+G 14101.90372 13709.54331 -6796.242262

rtREV+G+I 14110.89002 13711.7832 -6796.343867

LG+I 14113.48608 13721.12567 -6802.033441

cpREV+G+F 14151.408 13630.97386 -6737.555047

rtREV+G+F 14152.59511 13632.16098 -6738.148603 rtREV+G+I+F 14157.04203 13629.87351 -6735.980516 mtREV24+G+F 14166.02336 13645.58922 -6744.862726 mtREV24+G+I+F 14168.62 13641.45149 -6741.769505 cpREV+G+I+F 14177.08029 13649.91177 -6745.999648 Dayhoff+G+F 14177.12078 13656.68665 -6750.411438 Dayhoff+G+I+F 14178.22302 13651.0545 -6746.571013

WAG+I 14180.54172 13788.18131 -6835.561259

JTT+I+F 14215.41318 13694.97905 -6769.557638

JTT 14241.57911 13855.96574 -6870.471502

LG+I+F 14267.00561 13746.57148 -6795.353855

LG 14273.01118 13887.39781 -6886.187534

WAG+I+F 14327.88235 13807.44821 -6825.792221

WAG 14334.8798 13949.26642 -6917.121843

cpREV+I 14345.96468 13953.60426 -6918.272737

Dayhoff+I 14360.41334 13968.05293 -6925.497071 rtREV+I 14381.29055 13988.93014 -6935.935676

JTT+F 14387.50711 13873.808 -6859.996149

cpREV 14395.47896 14009.86558 -6947.421422

LG+F 14420.56274 13906.86362 -6876.523961

rtREV+I+F 14434.00014 13913.566 -6878.851116

Dayhoff+I+F 14451.16635 13930.73221 -6887.434222

WAG+F 14467.66046 13953.96135 -6900.072824

mtREV24+I+F 14472.31499 13951.88085 -6898.008541 cpREV+I+F 14514.92054 13994.48641 -6919.311319

rtREV 14523.27313 14137.65976 -7011.31851

Dayhoff 14546.07583 14160.46245 -7022.719858

cpREV+F 14564.8674 14051.16829 -6948.676295

rtREV+F 14574.91024 14061.21112 -6953.697711 mtREV24+G 14607.4108 14215.05038 -7048.995798 mtREV24+G+I 14614.54459 14215.43776 -7048.171148 mtREV24+F 14618.56875 14104.86963 -6975.526968 Dayhoff+F 14622.28079 14108.58167 -6977.382986 mtREV24+I 15068.52972 14676.1693 -7279.555258

mtREV24 15210.4003 14824.78693 -7354.882094

Abbreviations: BIC: Bayesian Information Criterion; AICc: Akaike Information

Jones-Taylor-Thornton; rtREV: General Reverse Transcriptase; cpREV: General Reversible Chloroplast; mtREV24: General Reversible Mitochondrial; G: Gamma distribution; I: evolutionarily invariable; F: amino acid frequencies.

Appendix Table 3. Component of PCR reaction

Volume

5X Phusion® HF Buffer 12.0 μL

2.5 mM dNTP 4.8 μL

10 μM forward primer 3.0 μL

10 μM reverse primer 3.0 μL

Template 3.0 μL

Phusion DNA Polymerase 0.6 μL

MQ H2O 33.6 μL

Total volume 60.0 μL

Appendix Table 4. PCR reaction settings

Cycle number Denature Anneal Extend Hold

1 98°C, 30 sec

2~36 98°C, 10 sec 30 sec 72°C

37 72°C, 10 min

38 4°C hold

Appendix Table 5. Annealing temperature and extension time for each gene

Gene Annealing temperature Extension time

PpHSA32 50°C 30 sec

AtHSP101 promoter 50°C 60 sec

3X HA for AtHSP101 50°C 15 sec

AtHSP101 50°C 90 sec

AtHSP101p-3X HA-AtHSP101 60°C 3 min

OsHSP101 60°C 90 sec

3X HA for OsHSP101 50°C 10 sec

3X HA-OsHSP101 60°C 90 sec

PpClpB-1 53°C 95 sec

3X HA for PpClpB-1 50°C 10 sec

3X HA-PpClpB-1 60°C 3 min

PpClpB-2 53°C 95 sec

3X HA for PpClpB-2 50°C 10 sec

3X HA-PpClpB-2 60°C 3 min

Appendix Table 6. Primers used for plasmid construct and sequencing

# Name Sequence (5'-3') Purpose

18 AtHsp101-seq-F01 CCGCTATAATCTGCTTGATTCTC Sequencing 19 AtHsp101-seq-R01 GAACTGGGTTTGTTTCGTTGA Sequencing

20 AtHsp101-seq-F02 CGTGGGAAAGAAGGGAAGA Sequencing 21 AtHsp101-seq-R02 TCACAGGATCAAGCTTCCCT Sequencing 22 AtHsp101-seq-F03 CCTTGAAAGGAAGAGGATGC Sequencing 23 AtHsp101-seq-R03 AAGCTCTTTCCGCACCTCTA Sequencing 24 AtHsp101-seq-F04 GGCTCATGTTGCTGTCTTCA Sequencing 25 AtHsp101-seq-R04 CTGAAATCGACTGTCCTGCC Sequencing

26 AtHsp101p-F02 CCCCCCGGGCCCCAGTACCACC

31 Pp3c8Hsp101-seq-F01 GCAACAGCCATTTCACTCTG Sequencing 32 Pp3c8Hsp101-seq-R01 AGGACCAGCATTGACCAGAC Sequencing 33 Pp3c8Hsp101-seq-F02 GACGCTGCATCCAGATTTTA Sequencing 34 Pp3c8Hsp101-seq-R02 TCCTTGCACAATACGCTGAG Sequencing 35 Pp3c8Hsp101-seq-F03 GGAGTTGACAGATCAATGGGA Sequencing 36 Pp3c8Hsp101-seq-R03 CCGCTCTGCTTGTTGAATTT Sequencing 37 Pp3c8Hsp101-seq-F04 TCCAATGTGGGGTCACAATA Sequencing 38 Pp3c8Hsp101-seq-R04 TATTCCTTGCAGCCTCCATC Sequencing 39 Pp3c24Hsp101-seq-F01 CTTGCGAGATCACCAGCTCT Sequencing 40 Pp3c24Hsp101-seq-R01 AGGGGTACCACGCGCTTC Sequencing 41 Pp3c24Hsp101-seq-F02 ACTGAAATGGCAAGACAGGG Sequencing 42 Pp3c24Hsp101-seq-R02 TGGGTTGTTCTTTGTTCTACGA Sequencing 43 Pp3c24Hsp101-seq-F03 AACGACACAGACAAAGCGTC Sequencing 44 Pp3c24Hsp101-seq-R03 TTCTCGTGTTCCCACTGATCT Sequencing 45 Pp3c24Hsp101-seq-F04 ATGGACGCGTGACGGATT Sequencing 46 Pp3c24Hsp101-seq-R04 GCGCTGTTGAGAACGTAATG Sequencing 47 OsHsp101-seq-F01 GCTAATCTCCGACTGCCTCA Sequencing 48 OsHsp101-seq-R01 GACGCGGACTCCACCTTG Sequencing 49 OsHsp101-seq-F02 CTCTCGGCGAGGTACATCAT Sequencing 50 OsHsp101-seq-R02 AGCTGCACCCTCACGTTC Sequencing

52 OsHsp101-seq-R03 GACGTAGCCAGGTGGTGC Sequencing 53 OsHsp101-seq-F04 AGTCGGACATCCTCATCCAG Sequencing 54 OsHsp101-seq-R04 CGTCCTCCATGATCCTCATC Sequencing

55 PpPSL-Sac1-R02 GGGGGGGAGCTCTCACGCAAA

GTGGATGCTTCGGGTTCCAGG Construct

56 Hsa32-F-ABI GGAAGAGTTTCGAGGAGAACG

A qPCR

57 Hsa32-R-ABI GACCTCGCATCTCCGTAACAC qPCR

58 Hsp101-F-ABI TGCATTTAGCTGGTGCTTTGAT qPCR

59 Hsp101-R-ABI CCACCGGCACTAGAGATTGC qPCR

60 Act2-Q-1F GGCAAGTCATCACGATTGG qPCR

61 Act2-Q-1R CAGCTTCCATTCCCACAAAC qPCR

Appendix Table 7. Accession numbers of HSA32 homologs in the phylogenetic tree (Fig. 1D).

Species Accession number

Archaea

Haladaptatus paucihalophilus DX253 EFW93546.1

Haloprofundus marisrubri KTG10119.1

Halococcus morrhuae DSM 1307 EMA48360.1

Haloferax mediterranei ATCC 33500 AHZ24137.1

Halogeometricum borinquense DSM 11551 ELY29416.1

Halopiger xanaduensis SH-6 AEH39301.1

Haloterrigena turkmenica DSM 5511 ADB60886.1

Halovivax ruber XH-70 AGB17607.1

Methanocaldococcus jannaschii Q57703.1

Methanopyrus kandleri WP_011018764.1

Methanothermococcus thermolithotrophicus WP_018154075.1

Methanotorris igneus Kol 5 AEF96400.1

Salinarchaeum sp. Harcht-Bsk1 AGN01615.1

Prokaryotes

Adhaeribacter aquaticus WP_026463315.1

Aequorivita capsosiphonis WP_026450201.1

Aerococcus viridans AMC00313.1

Alicyclobacillus sendaiensis WP_062309535.1

Belliella baltica DSM 15883 AFL83557.1

Betaproteobacteria bacterium SG8_41 KPK13489.1

Conexibacter woesei DSM 14684 ADB48524.1

Corynebacterium glutamicum NP_601739.1

Coxiella burnetii NP_820929.1

Crocinitomix catalasitica WP_035844310.1

Cryomorphaceae bacterium BACL11 MAG-121015-bin20 KRO63626.1

Cyclobacterium amurskyense AKP50798.1

Cytophagales bacterium MC1A KUG06407.1

Deltaproteobacteria bacterium CSP1-8 KRT74844.1

Desulfomonile tiedjei DSM 6799 AFM27415.1

Devosia riboflavina KFL32813.1

Dyadobacter crusticola WP_031528655.1

Echinicola pacifica WP_018472465.1

Enterococcus sp. RIT-PI-f KPG70647.1

Flammeovirga sp. MY04 ANQ50585.1

Flammeovirgaceae bacterium 311 AHM60940.1

Flavihumibacter solisilvae KIC92988.1

Flavobacteriales bacterium BRH_c54 KJS04510.1

Flectobacillus major WP_026997940.1

Flexibacter elegans WP_035726308.1

Flexithrix dorotheae WP_020528507.1

Fluviicola taffensis DSM 16823 AEA45629.1

Frankia sp. R43 KPM56601.1

Fulvivirga imtechensis AK7 ELR71788.1

Gaiella sp. SCGC AG-212-M14 OAI55342.1

Glaciibacter superstes WP_022883389.1

Gracilimonas tropica WP_020404197.1

Hymenobacter norwichensis WP_022822038.1

Indibacter alkaliphilus LW1 EOZ96668.1

Kerstersia gyiorum KKO71521.1

Kyrpidia tusciae DSM 2912 ADG06483.1

Lactobacillus oligofermentans DSM 15707 = LMG 22743 CUS26817.1

Legionella jordanis KTD17300.1

Microbacterium sp. No. 7 ALJ19796.1

Microscilla marina ATCC 23134 EAY28874.1

Mucilaginibacter gotjawali BAU52289.1

Peptococcaceae bacterium BRH_c4a KJR96147.1

Pontibacter actiniarum WP_025609000.1

Pseudoclavibacter faecalis WP_019619817.1 Pseudonocardia dioxanivorans CB1190 AEA28388.1

Rhodanobacter denitrificans AGG89629.1

Rhodobacterales bacterium HTCC2150 EBA02574.1 Rhodonellum psychrophilum GCM71 = DSM 17998 ERM83440.1

Rhodothermaceae bacterium RA KUR69503.1

Rhodothermus marinus WP_041806347.1

Ruania albidiflava WP_022919061.1

Rubrobacter xylanophilus WP_049761508.1

Runella slithyformis DSM 19594 AEI49442.1

Sediminibacterium salmoneum WP_026763928.1

Segniliparus rotundus DSM 44985 ADG98867.1

Solirubrobacter sp. URHD0082 WP_028060945.1

Sphingobacteriales bacterium BACL12 MAG-120813-bin55 KRP13542.1

Sphingopyxis macrogoltabida AMU92011.1

Beta vulgaris subsp. vulgaris XP_010668147.1

Brachypodium distachyon XP_003563432.1

Brassica napus CDX94031.1

Cajanus cajan KYP43185.1

Cynara cardunculus var. scolymus KVH74766.1

Daucus carota subsp. sativus XP_017220608.1

Dorcoceras hygrometricum KZV55188.1

Elaeis guineensis XP_010908355.1

Erythranthe guttata EYU27847.1

Eucalyptus grandis XP_010052461.1

Eutrema salsugineum XP_006413796.1

Fragaria vesca subsp. vesca XP_004309661.2

Genlisea aurea EPS63508.1

Glycine max XP_003530999.1

Gossypium hirsutum XP_016711476.1

Hordeum vulgare subsp. vulgare BAJ97644.1

Jatropha curcas XP_012091430.1

Manihot esculenta OAY26037.1

Marchantia polymorpha subsp. polymorpha OAE27081.1

Medicago truncatula XP_013457153.1

Morus notabilis XP_010088091.1

Musa acuminata subsp. malaccensis XP_009384204.1

Nelumbo nucifera XP_010241028.1

Nicotiana tabacum XP_016442523.1

Oryza sativa Japonica Group NP_001058384.1

Phaseolus vulgaris XP_007159208.1

Prunus persica XP_007211765.1

Agaricus bisporus var. burnettii JB137-S8 EKM75489.1

Amanita muscaria Koide BX008 KIL58019.1

Arthroderma benhamiae CBS 112371 DAA77666.1

Aspergillus niger GAQ43512.1

Blastomyces gilchristii SLH14081 OAT09378.1

Byssochlamys spectabilis No. 5 GAD92717.1

Capronia semi-immersa KIW71996.1

Chaetomium thermophilum var. thermophilum DSM 1495 EGS20077.1 Cladophialophora bantiana CBS 173.52 KIW94656.1

Coccidioides posadasii RMSCC 3488 KMM64318.1

Colletotrichum incanum KZL69612.1

Coniosporium apollinis CBS 100218 EON62092.1

Cyphellophora europaea CBS 101466 ETN39521.1

Dacryopinax primogenitus EJU04254.1

Daedalea quercina L-15889 KZT64361.1

Diaporthe ampelina KKY33183.1

Diplodia seriata KKY26111.1

Emmonsia parva UAMH 139 KLJ08726.1

Eutypa lata UCREL1 EMR72923.1

Exophiala dermatitidis NIHUT8656 EHY51966.1

Fibroporia radiculosa CCM00837.1

Fibulorhizoctonia sp. CBS 109695 KZP07281.1

Fomitiporia mediterranea MF322 EJD00876.1

Fonsecaea pedrosoi CBS 271.37 KIW83051.1

Fusarium oxysporum f. sp. pisi HDV247 EXA38328.1

Gelatoporia subvermispora B EMD32140.1

Gloeophyllum trabeum ATCC 11539 EPQ51380.1

Jaapia argillacea MUCL 33604 KDQ59301.1

Laetiporus sulphureus 93-53 KZT04648.1

Macrophomina phaseolina MS6 EKG18638.1

Madurella mycetomatis KXX78206.1

Metarhizium anisopliae KFG86162.1

Microsporum gypseum CBS 118893 EFR02092.1

Neolentinus lepideus HHB14362 ss-1 KZT19424.1

Oidiodendron maius Zn KIM95118.1

Penicillium chrysogenum KZN86802.1

Phaeoacremonium minimum UCRPA7 EOO01221.1

Phaeomoniella chlamydospora KKY17488.1

Phanerochaete carnosa HHB-10118-sp EKM57807.1 Phlebiopsis gigantea 11061_1 CR5-6 KIP11083.1

Pisolithus tinctorius Marx 270 KIO13979.1

Plicaturopsis crispa FD-325 SS-3 KII86362.1

Pochonia chlamydosporia 170 OAQ71085.1

Pseudogymnoascus destructans 20631-21 XP_012738811.1

Purpureocillium lilacinum OAQ82505.1

Rasamsonia emersonii CBS 393.64 KKA17623.1

Rhinocladiella mackenziei CBS 650.93 KIX06965.1

Scedosporium apiospermum KEZ39554.1

Schizophyllum commune H4-8 EFI99474.1

Schizopora paradoxa KLO15680.1

Scleroderma citrinum Foug A KIM63891.1

Sordaria macrospora k-hell CCC14421.1

Sphaerobolus stellatus SS14 KIJ46310.1

Spizellomyces punctatus DAOM BR117 KNC99381.1

Stachybotrys chartarum IBT 40288 KFA77099.1

Stereum hirsutum FP-91666 SS1 EIM83466.1 Talaromyces stipitatus ATCC 10500 EED16092.1

Thielavia terrestris NRRL 8126 AEO64687.1

Trametes cinnabarina CDO72782.1

Trichophyton rubrum XP_003237269.1

Uncinocarpus reesii 1704 EEP76676.1

Valsa mali var. pyri KUI57343.1

Verticillium dahliae VdLs.17 EGY20889.1

*: Sequence of Pinus pinaster HSA32 is copied from Liu et al. (2006a).

Appendix Table 8. Separating condition for UPLC system

Time (min) Flow rate (mL/min) %B

0 0.4 95

2.0 0.4 50

4.0 0.4 40

5.0 0.4 40

5.1 0.4 95

10.0 0.4 95

Appendix Figure 1. Binary vector map of pCAMBIA1390-3HA-AtHsa32,

SlHsa32, OsHsa32,

pCAMBIA1390-3HA-MpHsa32, pCAMBIA1390-3HA-BsPSL, and pCAMBIA1390-3HA-CgPSL.

References

Al-Whaibi, M.H. (2011). Plant heat-shock proteins: A mini review. Journal of King Saud University - Science 23, 139-150.

Bäurle, I. (2016). Plant Heat Adaptation: priming in response to heat stress.

F1000Research 5, F1000 Faculty Rev-1694.

Baek, D., Pathange, P., Chung, J.-S., Jiang, J., Gao, L., Oikawa, A., Hirai, M.Y., Saito, K., Pare, P.W., and Shi, H. (2010). A stress-inducible sulphotransferase sulphonates salicylic acid and confers pathogen resistance in Arabidopsis. Plant, Cell Environ. 33, 1383-1392.

Bonsen, P.P., Spudich, J.A., Nelson, D.L., and Kornberg, A. (1969). Biochemical studies of bacterial sporulation and germination XII. A sulfonic acid as a major sulfur compound of Bacillus subtilis spores. J. Bacteriol. 98, 62-68.

Burggraf, S., Fricke, H., Neuner, A., Kristjansson, J., Rouvier, P., Mandelco, L., Woese, C.R., and Stetter, K.O. (1990). Methanococcus igneus sp. nov., a Novel Hyperthermophilic Methanogen from a Shallow Submarine Hydrothermal System. Syst. Appl. Microbiol. 13, 263-269.

Chang, C.-Y., Lin, W.-D., and Tu, S.-L. (2014). Genome-Wide Analysis of Heat-Sensitive Alternative Splicing in Physcomitrella patens. Plant Physiol. 165, 826-840.

Charng, Y.-y., Liu, H.-c., Liu, N.-y., Hsu, F.-c., and Ko, S.-s. (2006). Arabidopsis Hsa32, a Novel Heat Shock Protein, Is Essential for Acquired Thermotolerance during Long Recovery after Acclimation. Plant Physiol. 140, 1297-1305.

Charng, Y.-y., Liu, H.-c., Liu, N.-y., Chi, W.-t., Wang, C.-n., Chang, S.-h., and Wang, T.-t. (2007). A Heat-Inducible Transcription Factor, HsfA2, Is Required for Extension of Acquired Thermotolerance in Arabidopsis. Plant Physiol. 143, 251-262.

Chi, W.-T., Fung, R.W.M., Liu, H.-C., Hsu, C.-C., and Charng, Y.-Y. (2009).

Temperature-induced lipocalin is required for basal and acquired thermotolerance in Arabidopsis. Plant, Cell Environ. 32, 917-927.

Chow, I.T., Barnett, M.E., Zolkiewski, M., and Baneyx, F. (2005). The N-terminal domain of Escherichia coli ClpB enhances chaperone function. FEBS Lett. 579, 4242-4248.

Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for

Agrobacterium-mediated transformation of Arabidopsis thaliana. The Plant Journal 16, 735-743.

DasSarma, P., and DasSarma, S. (2008). On the origin of prokaryotic "species": the taxonomy of halophilic Archaea. Saline Systems 4, 5.

Terrestrialization in Light of Plastid Evolution. Trends Plant Sci. 21, 467-476.

Fournier, G. (2009). Horizontal Gene Transfer and the Evolution of Methanogenic Pathways. In Horizontal Gene Transfer: Genomes in Flux, M.B. Gogarten, J.P.

Gogarten, and L.C. Olendzenski, eds (Totowa, NJ: Humana Press), pp. 163-179.

Gidda, S.K., and Varin, L. (2006). Biochemical and molecular characterization of flavonoid 7-sulfotransferase from Arabidopsis thaliana. Plant Physiol.

Biochem. 44, 628-636.

Gidda, S.K., Miersch, O., Levitin, A., Schmidt, J., Wasternack, C., and Varin, L.

(2003). Biochemical and Molecular Characterization of a Hydroxyjasmonate Sulfotransferase from Arabidopsis thaliana. J. Biol. Chem. 278, 17895-17900.

Godat, E., Madalinski, G., Muller, L., Heilier, J.-F., Labarre, J., and Junot, C.

(2010). Chapter 2 - Mass Spectrometry-Based Methods for the Determination of Sulfur and Related Metabolite Concentrations in Cell Extracts. In Methods in Enzymology, C. Enrique and P. Lester, eds (Academic Press), pp. 41-76.

Graham, D.E., Graupner, M., Xu, H., and White, R.H. (2002). Identification of coenzyme M biosynthetic phosphosulfolactate phosphatase. Eur. J. Biochem.

268, 5176-5188.

Guček, M., Makuc, S., Mlakar, A., Beričnik-Vrbovšek, J., and Marsel, J. (2002).

Determination of glutathione in spruce needles by liquid

chromatography/tandem mass spectrometry. Rapid Communications in Mass Spectrometry 16, 1186-1191.

Gurley, W.B. (2000). HSP101: A Key Component for the Acquisition of Thermotolerance in Plants. The Plant Cell 12, 457-460.

Hall, T.A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. In Nucleic acids symposium series ([London]: Information Retrieval Ltd., c1979-c2000.), pp. 95-98.

Hammermeister, D.E., Serrano, J., Schmieder, P., and Kuehl, D.W. (2000).

Characterization of dansylated glutathione, glutathione disulfide, cysteine and cystine by narrow bore liquid chromatography/electrospray ionization mass spectrometry. Rapid Communications in Mass Spectrometry 14, 503-508.

Hanson, A., and Gage, D. (1991). Identification and Determination by Fast Atom Bombardment Mass Spectrometry of the Compatible Solute Choline-O-sulfate in <I>Limonium</I> Species and Other Halophytes. Funct. Plant Biol. 18, 317-327.

Hanson, A.D., Rathinasabapathi, B., Rivoal, J., Burnet, M., Dillon, M.O., and Gage, D.A. (1994). Osmoprotective compounds in the Plumbaginaceae: a natural experiment in metabolic engineering of stress tolerance. Proceedings of

Harrison, S.J., Mott, E.K., Parsley, K., Aspinall, S., Gray, J.C., and Cottage, A.

(2006). A rapid and robust method of identifying transformed Arabidopsis thaliana seedlings following floral dip transformation. Plant Methods 2, 19.

Hashiguchi, T., Sakakibara, Y., Hara, Y., Shimohira, T., Kurogi, K., Akashi, R., Liu, M.-C., and Suiko, M. (2013). Identification and characterization of a novel kaempferol sulfotransferase from Arabidopsis thaliana. Biochem. Biophys. Res.

Commun. 434, 829-835.

Hashiguchi, T., Sakakibara, Y., Shimohira, T., Kurogi, K., Yamasaki, M.,

Nishiyama, K., Akashi, R., Liu, M.-C., and Suiko, M. (2014). Identification of a novel flavonoid glycoside sulfotransferase in Arabidopsis thaliana. The Journal of Biochemistry 155, 91-97.

Horton, R.M., Ho, S.N., Pullen, J.K., Hunt, H.D., Cai, Z., and Pease, L.R. (1993).

Gene splicing by overlap extension. In Methods in Enzymology (Academic Press), pp. 270-279.

Huber, H., Thomm, M., König, H., Thies, G., and Stetter, K.O. (1982).

Methanococcus thermolithotrophicus, a novel thermophilic lithotrophic methanogen. Arch. Microbiol. 132, 47-50.

Huijser, P., and Schmid, M. (2011). The control of developmental phase transitions in plants. Development 138, 4117-4129.

Hung, M.-J. (2015). Functional Analysis of the Arabidopsis Mitochondrial Chaperones mtHSC70 and MGE. In Department of Biochemical Science and Technology (National Taiwan University), pp. 1-44.

Jeanthon, C., apos, Haridon, S., Reysenbach, A.L., Vernet, M., Messner, P., Sleytr, U.B., and Prieur, D. (1998). Methanococcus infernus sp. nov., a novel

hyperthermophilic lithotrophic methanogen isolated from a deep-sea

hyperthermophilic lithotrophic methanogen isolated from a deep-sea

相關文件