So far, there is only one report to suggest the role of MrkF in stabilizing the structure of type 3 fimbriae (34). While analysis of MrkF sequence, a typical signal peptide may found and the sequence alignment with MrkA showed a conserved pilin domain (Fig. 2), implying that MrkF is also a component of type 3 fimbriae. As shown in Fig. 8, co-immunoprecipitation assay demonstrated an
interaction of MrkA and MrkF which supports further the association of MrkF with MrkA on the fimbriae. Moreover, TEM of immuno-gold labeled fimbriae showed that the labeled MrkF appeared to be inserted to the fimbrial shaft at regular intervals. During the assembly of a pilus, the order of subunit on fimbriae is decided by the affinity between subunit-chaperone complexes and usher (75).
As shown in the Fig. 9, many MrkA proteins on the fimbriae appeared to be interrupted by a few MrkF suggesting that MrkA-chaperone complexes have higher affinity to usher than the MrkF-chaperone complexes.
3. Functional role of MrkF
The TEM analysis indicated that all the recombinant E. coli were fimbriated except HB101[pmrkABC]. The fact that adhedsin is an initiator for the assembly of fimbriae has been reported (46, 69). Interestingly, the bacteria HB101[pmrkABCF], lacking the MrkD adhesin as an initiator, appeared to be fimbriated (Fig. 10) suggesting a role of MrkF in initiating the fimbriation.
Whatsoever, the bacteria HB101[pmrkABCDF] exhibiting more fimbriae on the surface than HB101[pmrkABCD] supported the role of MrkF in controlling the stability of fimbriae.
In order to colonize surfaces, most bacteria grow as organized biofilm communities (70). Adherence to non-biological surfaces constitutes the first step in biofilm development (13). The type 3 fimbrial major subunit MrkA has been reported to facilitate biofilm formation on abiotic surface (13). The bacteria JM109[pmrkABCDF] having higher biofilm formation activity than JM109[pmrkABCD] could be contributed to the increasing amount of type 3 fimbriae presented on the bacteria surface. On the other hand, the lacking of MrkF in JM109[pmrkABCD] could result in lower level of fimbriation thereby less
MrkA was available to help for biofilm formation.
The attachment of bacteria to a surface often results in the proliferation into complex microcolony structure. A number of factors including antigen 43 (Ag43) (73), curli (74) and type 1 fimbriae (60) have been implicated in microcolony formation and autoaggregation in E. coli. In particularly, type 1 fimbriae have been shown to confer bacterial autoaggregation and enhance biofilm formation on abiotic surfaces. In K. pneumoniae, similar to type 1 fimbiae, type 3 fimbriae appeared to mediate the biofilm formation (13). Aggregation and microcolony formation often prelude to biofilm formation and hence the apparent autoaggregation of the recombinant E. coli JM109[pmrkABCDF] led to a high level of biofilm formation activity. As shown in Fig. 13, the recombinant E. coli JM109[ABCDF], but not JM109[mrkABCD], appeared to autoaggregate in GCAA medium. Moreover, the autoaggregative phenomenon of the recombinant E. coli could be induced by transforming the bacteria with the plasmid carrying a mrkF gene, suggesting a role of MrkF in autoaggregative phenotype. It is likely that lacking of MrkF alters the structure of the 3 fimbriae and hence the decreasing activity of autoaggregation. Overall, this study indicated that MrkF is a component of type 3 fimbriae and a role of MrkF in initiating the fimbriation was also suggested.
References
1. Chen, K.Y., Hsueh, P.R., Liaw, Y.S., Yang, P.C. and Luh, K.T., 2000. A 10-year experience with bacteriology of acute thoracic empyema: emphasis on Klebsiella pneumoniae in patients with diabetes mellitus. Chest. 117, 1685-1689.
2. Williams, P., and Tomas, J.M., 1990. The pathogenicity of Klebsiella pneumoniae. Rev. Med. Microbiol. 1, 196-204.
3. Mayhall, C.G., Lamb, V.A., Bitar, C.M., Miller, K.B., Furse, E.Y., Kirkpatrick, B.V., Markowitz, S.M., Veazey, J.M.Jr. and Marcrina, F.L., 1980. Nosocomial Klebsiella infection in a neonatal unit: identification of risk factors for gastrointestinal colonization. Infect. Control. 1, 239-246.
4. Lee, P.Y., Chang, W.N., Lu, C.H., Lin, M.W., Cheng, B.C., Chien, C.C., Chang, C.J. and Chang, H.W., 2003. Clinical features and in vitro antimicrobial susceptibilities of community-acquired Klebsiella pneumoniae meningitis in Taiwan. J. Antimicrob. Chemother. 51, 957-962.
5. Tarkkanen, A.M., Allen, B.L., Williams, P.H., Kauppi, M., Haahtela, K., Siitonen, A., Orskov, I., Orskov, F., Clegg, S. and Korhonen, T.K., 1992.
Fimbriation, capsulation, and iron-scavenging systems of Klebsiella strains associated with human urinary tract infection. Infect. Immun. 60, 1187-1192.
6. Sauer, F.G., Barnhart, M., Choudhury, D., Knight, S.D., Waksman, G. and Hultgren, S.J., 2000. Chaperon-assisted pilus assembly and bacterial attachment. Curr. Opin. Struct. Biol. 10, 548-556.
7. Tarkkanen, A.M., Virkola, R., Clegg, S. and Korhonen, T.K., 1997. Binding of the type 3 fimbriae of Klebsiella pneumoniae to human endothelial and urinary bladder cells. Infect. Immun. 65, 1546–1549.
8. Di Martino, P., Livrelli, V., Sirot, D., Joly, B. and Darfeuille-Michaud, A., 1996.
A new fimbrial antigen harbored by CAZ-5/SHV-4-producing Klebsiella pneumoniae strains involved in nosocomial infections. Infect. Immun. 64, 2266-2273.
9. Darfeuille-Michaud, A., Jallat, C., Aubel, D., Sirot, D., Rich, C., Sirot, J. and Joly, B., 1992. R-plasmid-encoded adhesive factor in Klebsiella pneumoniae strains responsible for human nosocomial infections. Infect. Immun. 60:44-55.
10. Zhou, G., Mo, W.J., Sebbel, P., Min, G., Neubert, T.A., Glockshuber, R., Wu, X.R., Sun, T.T. and Kong, X.P., 2001. Uroplakin Ia is the urothelial receptor for uropathogenic Escherichia coli: evidence from in vitro FimH binding. J.
Cell Sci. 114, 4095-4103.
11. Sharon, N., 1987. Bacterial lectins, cell–cell recognition and infectious disease.
FEBS Lett. 217, 145-157.
12. Snyder, J.A., Haugen, B.J., Lockatell, C.V., Maroncle, N., Haga,n E.C., Johnson, D.E., Welch, R.A. and Mobley, H.L., 2005. Coordinate expression of fimbriae in uropathogenic Escherichia coli. Infect Immun. 73, 7588-7596.
13. Di-Martino, P., Cafferini, N., Joly, B. and Darfeuille-Michaud, A., 2003.
Klebsiella pneumoniae type 3 pili facilitate adherence and biofilm formation on abiotic surfaces. Res. Microbiol. 154, 9-16.
14. Klemm, P. and Krogfelt, K.A., 1994. Type 1 fimbriae of Escherichia coli, pp.
9–26. In Fimbriae, Adhesion, Genetics, Biogenesis and Vaccines. Klemm, P.
(ed.). Boca Raton, FL: CRC Press.
15. Buchanan, K., Falkow, S., Hull, R.A. and Hull, S.I., 1985. Frequency among Enterobacteriaceae of the DNA sequences encoding type 1 pili. J. Bacteriol.
162, 799-803.
16. Firon, N., Ashkenazi, S., Mirelman, D., Ofek, I. and Sharon, N., 1987.
Aromatic alpha-glycosides of mannose are powerful inhibitors of the adherence of type 1 fimbriated Escherichia coli to yeast and intestinal epithelial cells. Infect. Immun. 55, 472-476.
17. Martinez, J.J., Mulvey, M.A., Schilling, J.D., Pinkner, J.S. and Hultgren, S.J., 2000. Type 1 pilus-mediated bacterial invasion of bladder epithelial cells.
EMBO J. 19, 2803-2812.
18. Malaviya, R., Ross, E., Jakschik, B.A. and Abraham, S.N., 1994. Mast cell degranulation induced by type 1 fimbriated Escherichia coli in mice. J. Clin.
Invest. 93, 1645-1653.
19. Hahn, E., Wild, P., Hermanns, U., Sebbel, P., Glockshuber, R., Haner, M., Taschner, N., Burkhard, P., Aebi, U. and Muller, S.A., 2002. Exploring the 3D molecular architecture of Escherichia coli type 1 pili. J. Mol. Biol. 323, 845-857.
20. Sokurenko, E.V., Courtney, H.S., Ohman, D.E., Klemm, P. and Hasty, D.L., 1994. FimH family of type 1 fimbrial adhesins: functional heterogeneity due to minor sequence variations among fimH genes. J. Bacteriol. 176, 748-755.
21. Sokurenko, E.V., Courtney, H.S., Ohman, D.E., Klemm, P. and Hasty, D.L., 1994. FimH family of type 1 fimbrial adhesins: functional heterogeneity due to minor sequence variations among fimH genes. J. Bacteriol. 176, 748-755.
22. Baorto, D.M., Gao, Z., Malaviya, R., Dustin, M.L., Van-der-Merwe, A., Lublin, D.M., Abraham, S.N., 1997. Survival of FimH-expressing enterobacteria in macrophages relies on glycolipid traffic. Nature 389, 636–639.
23. Shin, J.S., Gao, Z. and Abraham, S.N., 2000. Involvement of cellular caveolae
in bacterial entry into mast cells. Science 289:785–788.
24. Klemm, P., 1992. FimC, a chaperone-like periplasmic protein of Escherichia coli involved in biogenesis of type 1 fimbriae. Res. Microbiol. 143, 831–838.
25. Klemm, P. and Christiansen, G., 1990. The fimD gene required for cell surface localization of Escherichia coli type 1 fimbriae. Mol. Gen. Genet. 220, 334–338.
26. Hultgren, S.J. and Normark, S., 1991. Chaparone-assisted assembly and molecular architecture of adhesive pili. Annu. Rev. Microbiol. 45, 383–415.
27. Hornick, D.B., Thommandru, J., Smits, W. and Clegg, S., 1995. Adherence properties of an mrkD-negative mutant of Klebsiella pneumoniae. Infect.
Immun. 63, 2026-2032.
28. Old, D.C. and Adegbola, R.A., 1985. Antigenic relationships among type 3 fimbriae of the enterobacteriaceae revealed by immunoelectron microscopy. J.
Med. Microbiol. 20, 113-121.
29. Clegg, S., Korhonen, K.T., Hornick, B.D. and Tarkkanen, A.M., 1994. Type 3 fimbriae of the Enterobacteriaceae, pp. 97–104. In K. P. Klemm (ed.), Fimbriae: adhesion, genetics, biogenesis, and vaccines. CRC Press, Boca Raton, Fla.
30. Duguid, J.P. and Old, D.C., 1980. Adhesive properties of Enterobacteriaceae, pp.185-217. In E. H. Beachey (ed.), Bacterial adherence. Chapman and Hall, London.
31. Kunin, C.M., 1987. Detection, prevention, and management of urinary tract infections. Lea & Febiger, Philadelphia, Pa.
32. Hultgren, S.J., Lindberg, F., Magnusson, G., Kihlberg, J., Tennent, J.M. and Normark, S., 1989. The PapG adhesin of uropathogenic Escherichia coli contains separate regions for receptor binding and for the incorporation into the pilus. Proc. Natl. Acad. Sci. U.S.A. 86, 4357-4361.
33. Girardeau, J.P. and Bertin, Y., 1995. Pilins of fimbrial adhesins of different member species of Enterobacteriaceae are structurally similar to the Cterminal half of adhesin proteins. FEBS Lett. 357, 103–108.
34. Allen, B.L., Gerlach, G.F. and Clegg, S., 1991. Nucleotide sequence and functions of mrk determinants necessary for expression of type 3 fimbriae in Klebsiella pneumoniae. J. Bacteriol. 173, 916-920.
35. Langstraat, J., Bohse, M. and Clegg, S., 2001. The type 3 fimbrial shaft (MrkA) of Klebsiella pneumoniae, but not the fimbrial adhesin (MrkD), facilitates biofilm formation. Infect Immun 69, 5805-5812.
36. Jagnow, J. and Clegg, S., 2003. Klebsiella pneumoniae MrkD-mediated biofilm formation on extracellular matrix- and collagen-coated surfaces.
Microbiology. 149, 2397-2405.
37. Jagnow, J. and Clegg, S., 2003. Klebsiella pneumoniae MrkD-mediated biofilm formation on extracellular matrix- and collagen-coated surfaces.
Microbiology. 149, 2397-2405.
38. Hornick, D.B., Allen, B.L., Horn, M.A., Clegg, S., 1992. Adherence to respiratory epithelia by recombinant Escherichia coli expressing Klebsiella pneumoniae type 3 fimbrial gene products. Infect Immun. 60:1577-88.
39. Sebghati, T.A., Korhonen, T.K., Hornick, D.B. and Clegg, S., 1998.
Characterization of the type 3 fimbrial adhesins of Klebsiella strains. Infect.
Immun. 66, 2887-2894.
40. Sebghati, T.A., Korhonen, T.K., Hornick, D.B. and Clegg, S., 1998.
Characterization of the type 3 fimbrial adhesins of Klebsiella strains. Infect Immun. 66, 2887-2894.
41. Johnson, J.R., Johnson, C.E. and Maslow, J.N., 1999. Clinical and bacteriologic correlates of the papG alleles among Escherichia coli strains from children with acute cystitis. Pediatr. Infect. Dis. J. 18, 446-451.
42. Sauer, F.G., Pinkner, J.S., Waksman, G. and Hultgren, S.J., 2002. Chaperone priming of pilus subunits facilitates a topological transition that drives fiber formation. Cel. 111, 543-551.
43. Pellecchia, M., Guntert, P., Glockshuber, R. and Wuthrich, K., 1998. NMR solution structure of the periplasmic chaperone FimC. Nat. Struct. Biol. 5, 885-890.
44. Holmgren, A.and Branden, C.I., 1989. Crystal-structure of chaperone protein PapD reveals an immunoglobulin fold. Nature. 342, 248-251.
45. Soto, G.E., Dodson, K.W., Ogg, D., Liu, C., Heuser, J., Knight, S., Kihlberg, J., Jones, C.H. and Hultgren, S.J., 1998 Periplasmic chaperone recognition motif of subunits mediates quaternary interactions in the pilus. EMBO J. 17, 6155-6167
46. Dodson, K.W., Jacob-Dubuisson, F., Striker, R.T. and Hultgren, S.J., 1993 Outer membrane PapC molecular usher discriminately recognizes periplamic chaperone]pilus subunit complexes. Proc. Natl. Acad. Sci. USA 90, 3670-3674.
47. Thanassi, D.G., Saulino, E.T., Lombardo, M.J., Roth, R., Heuser, J. and Hultgren, S.J., 1998 The PapC usher forms an oligomeric channel:
implications for pilus biogenesis across the outer membrane. Proc. Natl. Acad.
Sci. USA. 95, 3146-3151.
48. Saulino, E.T., Thanassi, D.G., Pinkner, J.S. and Hultgren, S.J., 1998.
Ramification of kinetic partitioning on usher-mediated pilus biogenesis.
EMBO J. 17, 2177-2185.
49. Hultgren, S.J., Abraham, S., Caparon, M., Falk, P., Stgeme, J. W. and Normark, S., 1993. Pilus and nonpilus bacterial adhesins - Assembly and function in cell recognition. Cell. 73, 887- 901.
50. Stephens, C. and Shapiro, L., 1997. Bacterial protein secretion - a target for new antibiotics. Chem. Biol. 4, 637-641.
51. Larsson, A., Barnhart, M., Stenstro¨m, T., Pinkner, J.S., Hultgren, S.J., Almqvist, F., Kihlberg, J., Manuscript in preparation.
52. Stromberg, N. and Karlsson, K.A., 1990. Characterization of the binding of propionibacterium granulosum to glycosphingolipids adsorbed on surfaces. An apparent recognition of lactose which is dependent on the ceramide structure. J.
Biol. Chem. 265, 11244-11250.
53. Stromberg, N., Nyholm, P.G.., Pascher, I. and Normark, S., 1991. Saccharide orientation at the cell surface affects glycolipid receptor function. Proc. Natl.
Acad. Sci. USA. 88, 9340-9344.
54. Sebghati, T.A., Korhonen, T.K., Hornick, D.B. and Clegg, S., 1998.
Characterization of the type 3 fimbrial adhesins of Klebsiella strains. Infect Immun. 66, 2887-2894.
55. Schurtz, T.A., Hornick, D.B., Korhonen, T.K. and Clegg, S., 1994. The type 3 fimbrial adhesin gene (mrkD) is not conserved among all fimbriate strains.
Infect. Immun. 62, 4186-4191.
56. Gerlach, G.F., Clegg, S. and Allen, B.L., 1989. Identification and characterization of the genes encoding the type 3 and type 1 fimbrial adhesins of Klebsiella pneumoniae. J. Bacteriol. 171, 1262-1270.
57. Barnhart, M.M., Sauer, F.G., Pinkner, J.S. and Hultgren, S.J., 2003.
Chaperone-subunit-usher interactions required for donor strand exchange during bacterial pilus assembly. J. Bacteriol. 185, 2723-2730.
58. Sakellaris, H., Balding, D.P. and Scott, J.R., 1996. Assembly proteins of CS1 pili of enterotoxigenic Escherichia coli. Mol. Microbiol. 21, 529-541.
59. Jakubowski, S.J., Krishnamoorthy, V. and Christie, P.J., 2003. Agrobacterium tumefaciens VirB6 Protein Participates in Formation of VirB7 and VirB9 Complexes Required for Type IV Secretion. J. Bacteriol. 185, 2867-2878.
60. Schembri, M.A. and Klemm, P., 2001. Biofilm formation in a hydrodynamic environment by novel fimh variants and ramifications for virulence. Infect Immun. 69, 1322-1328.
61. Schembri, M.A., Christiansen, G. and Klemm, P., 2001. FimH-mediated autoaggregation of Escherichia coli. Mol. Microbiol. 41, 1419-1430.
62. Tarkkanen, A.M., Allen, B.L., Westerlund, B., Holthofer, H., Kuusela, P.,
Risteli, L., Clegg, S. and Korhonen, T.K., 1990. Type V collagen as the target for type-3 fimbriae, enterobacterial adherence organelles. Mol. Microbiol. 4, 1353-1361.
63. Baddour, L.M., Christensen, G.D., Simpson, W.A. and Beachey, E.H., 1989. In Principles and Practice of Infectious Disease, eds. Mandell, G. L., Danglers, R.G. and Bennet, J.E. (Churchill Livingstone, New York), 2, 9-25.
64. Hasman, H., Chakraborty, T. and Klemm, P., 1999. Antigen-43-mediated autoaggregation of Escherichia coli is blocked by fimbriation. J. Bacteriol. 181, 4834-4841.
65. Kjaergaard, K., Schembri, M.A., Hasman, H. and Klemm, P., 2000. Antigen 43 from Escherichia coli induces inter- and intraspecies cell aggregation and changes in colony morphology of Pseudomonas fluorescens. J. Bacteriol. 182, 4789-4796.
66. Haussler, S., Ziegler, I., Lottel, A., von-Gotz, F., Rohde, M., Wehmhohner, D., Saravanamuthu, S., Tummler, B. and Steinmetz, I., 2003. Highly adherent small-colony variants of Pseudomonas aeruginosa in cystic fibrosis lung infection. J. Med. Microbiol. 52, 295-301.
67. Collinson, S.K., Doig, P.C., Doran, J.L., Clouthier, S., Trust, T.J. and Kay, W.W., 1993. Thin, aggregative fimbriae mediate binding of Salmonella enteritidis to fibronectin. J. Bacteriol. 175, 12-18.
68. Davis, G.D., Elisee, C., Newham, D.M. and Harrison, R.G.., 1999. New fusion protein systems designed to give soluble expression in Escherichia coli.
Biotechnol. Bioeng. 65, 382-388.
69. Saulino, E.T., Thanassi, D.G., Pinkner, J. and Hultgren, S.J., 1998.
Ramifications of kinetic partitioning on usher-mediated pilus biogenesis.
EMBO J. 17, 2177–2185.
70. Stickler D., 1999. Biofilms, Curr. Opin. Microbiol. 2, 270–275.
71. Ma, L.C., Fang, C.T., Lee, C.Z., Shun, C.T. and Wang, J.T., 2005. Genomic heterogeneity in Klebsiella pneumoniae strains is associated with primary pyogenic liver abscess and metastatic infection. J. Infect. Dis. 192, 117-128.
72. Chen, M.C., 2003. Characterization of the Type 3 Fimbrial Adhesins of Klebsiella pneumoniae. Master thesis, Chiao Tung University Press.
73. Hasman, H., Schembri, M.A. and Klemm, P., 2000. Antigen 43 and type 1 fimbriae determine colony morphology of Escherichia coli K-12. J. Bacteriol.
182, 1089-1095.
74. Prigent-Combaret, C., Brombacher, E., Vidal, O., Ambert, A., Lejeune, P., Landini, P. and Dorel, C., 2001. Complex regulatory network controls initial adhesion and biofilm formation in Escherichia coli via regulation of the csgD
gene. J. Bacteriol. 183, 7213–7223.
75. Thanassi, D.G., Stathopoulos, C., Dodson, K., Geiger, D. and Hultgren, S.J., 2002. Bacterial outer membrane ushers contain distinct targeting and assembly domains for pilus biogenesis. J. Bacteriol. 184, 6260-6269.
76. Nishiyama, M., Vetsch M., Puorger C., Jelesarov I. and Glockshuber R., 2003.
Identification and characterization of the chaperone-subunit complex-binding domain from the type 1 pilus assembly platform FimD. J Mol Biol. 330, 513-525.
77. Sauer, F.G., Knight S.D., Waksman, G.J. and Hultgren S.J., 2000. PapD-like chaperones and pilus biogenesis. Semin Cell Dev Biol. 11, 27-34.
78. Derman, A.I., Prinz, W.A., Belin, D. and Beckwith, J., 1993. Mutations that allow disulfide bond formation in the cytoplasm of Escherichia coli. Science.
262, 1744-1747.
Table 1. Bacteria strains used in this study
strains Genotypes or relevant properties Reference or source Escherichia coli
NovaBlue(DE3) endA1 hsdR17(rk12-mk12+) supE44 thi-1 recA1 gyrA96 relA1 lac[F’ pro AB lacqZ△M15::Tn10](DE3);Tetr
Novagen
BL21(DE3) F-ompT hsdSB (rb mb )gal dcm (DE3) B - - Laboratory stock JM109 RecA1 supE44 endA1 hsdR17 gyrA96
RelA1 thi△（lac-proAB）
Laboratory stock
HB101 F– thi-1 hsdS20 (rb– mb–) supE44 recA13 ara-14 leuB6 proA2 lacY1 galK2, rpsL20 (strr) xyl-5 mtl-1
Laboratory stock
Klebsiella pneumoniae
k. p NTUH k-2044 Clinical isolate 71
VHm5 Clinical isolate Veteran General
Hospital Pseudomonas aeruginosa
PAO1 Laboratory stock
Table 2. Plasmids used and constructed in this study
Plasmids Relevant characteristic Reference or source
pGEMT Cloning vector；Ap r Promega
yT&A Cloning vector；Ap r Yeastern Biotech
pET30a-c Expression vector；Kan r Novagen
pACYCDuet-1 Expression vector；Cm r Novagen
pMrkDv3 1 kb fragment amplified using VHm5 chromosome as template and primer pairs, MZ007 and MZ008, and cloned into pET30a by HindIII and XhoI site, Kan r
72
pdMrkDv3-YT 950 bp fragment amplified using pMrkDv3 as template and primer pairs, phw19 and phw12, and cloned into YT&A, Ap r
This study
pdMrkDv3 dmrkDv3 fragment digested from pdMrkDv3-YT and cloned into pET30a by SacI and XhoI site, Kan r
This study
pdMrkDv3-1-pAC dmrkDv3 fragment digested from pdMrkDv3-YT using SalI and HindIII site and cloned into pACYCDuet-1 expression vector, Cm r
This study
pMrkDv3NL 549 bp fragment amplified using pMrkDv3 as template and primer pairs, MZ007 and phw12, and cloned into pET30a by HindIII and XhoI site, Kan r
This study
pdMrkDv3NL 500 bp fragment amplified using pMrkDv3 as template and primer pairs, phw19 and phw12, and cloned into pET30a by SacI and XhoI site, Kan r
This study
pMrkDv3N 477 bp fragment amplified using pMrkDv3 as template and primer pairs, MZ007 and phw07, and cloned into pET30a by HindIII and XhoI site, Kan r
This study
pdMrkDv3N 427 bp fragment amplified using pMrkDv3 as template and primer pairs, phw19 and phw07, and cloned into pET30a by SacI and XhoI site, Kan r
This study
pMrkDV3NS 360 bp fragment amplified using pMrkDv3 as template and primer pairs, MZ007 and phw13, and cloned into pET30a by HindIII and XhoI site, Kan r
This study
pdMrkDV3NS 310 bp fragment amplified using pMrkDv3 as template and primer pairs, phw19 and phw13, and cloned into pET30a by SacI and XhoI site, Kan r
This study
pdMrkB-1-pET 659 bp fragment amplified using k. p NTUH k2044 as template and primer pairs, phw22 and phw23, and
This study
cloned into pET30a by NdeI and NotI site, Kan r pMrkF-YT 0.7 kb fragment amplified using primer pairs, phw15
and phw16, and cloned into yT&A cloning vector, Ap r
This study
pMrkF-pET mrkF fragment digested from pMrkF-YT using NcoI and HindIII site and cloned into pET30a expression vector, Kanr
This study
pMrkABC mrkABC gene cluster cloned into pGEMT vector, Ap r
72
pMrkABCD 1 kb fragment amplified using primer pairs, phw03 and MZ006, and cloned into pMrkABC by AscI and ApaI site, Ap r
This study
pMrkABCF 0.7 kb fragment amplified using primer pairs, F-N and F-C, and cloned into pMrkABC by ApaI site, Ap r
This study
pMrkABCDF 0.7 kb fragment amplified using primer pairs, F-N and F-C, and cloned into pMrkABCD by ApaI site, Ap r
This study
Table 3. Primers used in this study
Primer Sequence 5＇→3＇ Enzyme site Tm
phw03 CACCCTGTGGCGGCAAAAAA DraIII site 60.3 ℃
phw05 GCTATTTTGCGGCCGCCTCG NotI site 63.3 ℃
phw06 CGAGGCGGCCGCAAA ATAGC NotI site 63.3 ℃
phw07 GGTGTATTTTCCCGC CTCGAGG XhoI site 58.7 ℃
phw12 GGAGCTCGAGACCAC GGTGAT XhoI site 57.7 ℃
phw13 CTCGAGACGAATAGA CGTCGGGA XhoI site 59.2 ℃
phw14 GAGCTCGAGTCGCATATGATCTT SacI site 54.4 ℃
phw15 AGGGGCCATGGAGGGATT NcoI site 55.2 ℃
phw16 ATTATAAACTAGTTCCCACGTCGC No 52.9 ℃
phw19 GTCCTGGGAGCTCTGTACGCGC SacI site 61.9 ℃
phw22 AGTTTTGCGGCCCATATGAA NdeI site 54.6 ℃
phw23 GCGGCCGCTTTCACTGC NotI site 57.5 ℃
F-N ATACGGGCCCGGGAATGAAGG ApaI site 62.5 ℃
F-C TGAACAACTGGGCCCCGATGAT ApaI site 62.0 ℃
MZ006 GGGCCCTTAATCGTACGTCAGGTT ApaI site 60.3 ℃
MZ007 CAAGCTTTTATGAAAAAACTGACGCTTT HindIII site 58.7 ℃
MZ008 CTCGAGATCGTACGTCAGGTTAAA XhoI site 54.4 ℃
Fig. 1. Amino acid sequence alignment of the MrkD variants. Positions at which the amino acid sequence of the MrkDv3 differs from that of other types of MrkD are indicated by asterisks. The numbers on each section indicate the residues number of MrkDv1.
Fig. 2. Amino acid sequence alignment of MrkA and MrkF. Alignment of MrkF amino acid sequence with MrkA showed MrkF has a conserved pilin domain as MrkA.
The numbers on each section indicate the residues number of MrkF.
Fig. 3. Physical map of the recombinant proteins prepared in this study. The N-terminal receptor binding domain of MrkDv3 is responsible for binding activity and C-terminal pilin domain is responsible for assembly. The folding of each domain is stabilized by conserved cysteine residues. A linker is located between these two domains.
The first twenty-two residues are signal peptides predicted by Clegg (34).The recombinant proteins, MrkDv3, MrkDv3NL, MrkDv3N and MrkDv3NS, are indicated by lines under the physical map. The rectangle marked on MrkDv3N indicates the position of the variable region, Gly120 to Gln140, on MrkDv3.
A B
C D
Fig. 4. SDS-PAGE analysis of the recombinant proteins. The arrows indicate the predicted recombinant proteins. The sample in each lane was prepared from the cells carrying each of the following plasmid: (A) pMrkDv3, (B) pMrkDv3NL, (C) pMrkDv3N, and (D) pMrkDv3NS. The culture condition is marked under pictures. Before loading, bacteria solution was sonicated twice for 30 seconds and centrifuged (13200 rpm, 10 min).
T: total cell lysate; S: supernatant; P: pellet.
Fig. 5. Competition assay. dMrkDv3N was used as a competitor against E. coli carrying type 3 fimbriae with MrkDv3 in collagen IV binding assay. As increasing of the amount of dMrkDv3, the recovered bacteria decreased.
A. B.
Fig. 6. Western blotting analysis of the recombinant E. coli displaying type 3 fimbriae. MrkF was expressed in E. coli and detected with anti MrkF antiserum. (A) SDS-PAGE separated recombinant E. coli lysates stained with Coomassie brilliant blue. (B) Western blotting analysis using anti MrkF antiserum.
A. B. C.
Fig. 7. Western blotting analysis of the purified type 3 fimbriae. MrkF protein was co-purified with, and strongly associated with type 3 fimbriae. (A) SDS-PAGE separated type 3 fimbriae stained with Coomassie brilliant blue. (B) Western blotting analysis using anti MrkA antiserum. (C) Western blotting analysis using anti MrkF antiserum.
Fig. 8. Co-immunoprecipitation. Co-immunoprecipitation studies with anti-MrkA and anti-MrkF antisera. The purified fimbriae of E. coli JM109[pmrkABCDF] (lane 1, 2), JM109[pmrkABCD] (lane 3, 4) and JM109[pmrkABCF] (lane 5, 6) were precipitated with anti MrkF antibody (odd lane) and anti MrkA antibody (even lane).
The purified fimbriae of E. coli JM109[pmrkABCDF] not added antibody as negative control (lane 7). The blots were then probed with antiserum to the MrkA (A) and MrkF (B) proteins listed at the right.
Fig. 9. Electron micrographs of the anti-MrkF immuno-gold labeled pili.
Fig. 9. Electron micrographs of the anti-MrkF immuno-gold labeled pili.