PROTEIN SEQUENCE ALIGNMENT
By using mouse LPA receptor 4 and 5 protein sequence as bait, we search for zebrafish LPA receptor 4 and 5 with TBLASTN analysis in the zebrafish nucleotide collection database. Zebrafish LPA4 is found as XP_001334713.1, and zLPA5 is found as NP_955900.1. The latter one have low similarity of about 30% with both mouse LPA5 and LPA6, but after aligning with all known the LPA, S1P receptors and P2RY receptors of different species, the sequence has highest similarity to the LPA5 family. Also, zebrafish LPA6 is identified by another group with morpholino attenuation experiment (105).
PHYLOGENETIC TREE AND PERCENTAGE SIMILARITY ANALYSIS
All the known LPA, S1P receptors and P2RY receptors are aligned with ClustalX2, and tree was drew by bootstrapping analysis with one thousand random trial. Confident reference are sited beside each branch as number of percentage. Each receptors of different species was clustered into separated group of each receptor family. The analysis is done in both protein and nucleotide sequences, and reveals similar structure that the two identified sequences belonged to LPA4 and LPA5
family. Percentage similarity of LPA4, LPA5 and LPA6 between human, mouse and zebrafish are collected and presented into chart.
EXPRESSION CONSTRUCT OF ZLPA4 AND ZLPA5
Zebrafish LPA4 is amplified from 3 dpf zebrafish WT cDNA with Phusion DNA polymerase (New England Biolab) by using forward primer: ATGGCCAGTCTTGTTCTTAA and reverse primer: TCAGAACTGAGTCTCACCAA. And zLPA5 is amplified with forward primer:
ATGACTTCAAACAACACTAC and reverse primer: TTATTGTCCAGTCCAACTCG. Both CDS
21
were ligated into pGEM T easy vector with additional adenosine to each end of the blunt end PCR product. Construct were selected and sequenced to obtain full-length CDS without mutation.
STAGE AND TISSUE DEPENDENT RNA EXPRESSION
At the night before mating morning, each pair of female and male zebrafish were transferred to a single tank with mesh bottom to allow egg passing through and keeps fishes away from eating the eggs. Females and males are separated from each other by a transparent acrylic plate which avoids fighting and helps fishes getting acquainted with each other. At the morning of mating, acrylic plate is removed as long as the lights turned on, and eggs are collected after the observation of tail chasing activity. Eggs are cultivated under 28.5°C in fish water, malformed and dead embryo are removed daily so as to keep the water clean. At the time of each developmental stage, embryo are observed under binomial microscope before picking 30 embryos for RNA extraction. Each 30 embryos are transferred into a 1.5 ml vial and left with 100 μl fish water, added 1 ml of TRIzol® (Invitrogen) and homogenized with 1 ml syringe with needles of different tip size, from 23G, 27G to 30G needles. The homogenized embryo were collected in TRIzol® and stored in -80°C till the time of RNA extraction.
Upon RNA extraction, each vial of 1ml TRIzol® is added with 100 μl chloroform and vortex for 30 seconds before standing on ice for 5 minutes, then undergo phase separation with 15 minutes of 12000 rpm centrifugation at 4°C. The upper aquarius phase is then transferred to a new vial and added with 2× volume of 100% Ethanol and stand for 15 minutes at -20°C followed by 15 minutes 12000 rpm centrifugation to precipitate RNA. Then carefully discarded the aquarius ethanol, and wash the RNA pallet with 70% ethanol, centrifugated 3000 rpm for 5 minutes. Again, discard the upper aquarius phase and air dry the RNA pallet in a laminar flow for 15 minutes at room temperature, and resuspended with 50 μl DEPC water. The resuspended RNA were heated on a hotplate at 55°C for 10 minutes before density observed with NanoDrop (Thermo Scientific). Two micro grams of embryo RNA were reverse-transcribed into cDNA with ReverTra Ace (TOYOBO), and the resulting 20 μl
22
cDNA were diluted 2× with DEPC water. Two micro liter of embryo cDNA were used as template to undergo real-time PCR by using ABsolute™ QPCR SYBR® Green Mixes (Thermo Scientific) and iCycler Thermal Cycler (BioRad). Gene specific primer for zLPA4, zLPA5, z beta Actin and zEF1α were designed by using pDraw32. And primer sequences as follows: zLPA4 intF' ATTGCTTCTTTGACCCGGTG, zLPA4 R' TCAGAACTGAGTCTCACCAA, zLPA5 F' ATGACTTCAAACAACACTAC, zLPA5 intR' CCATGTAGATCACTGGAACA, zbActin RT F'
CCAGCTGTCTTCCCATCCA, zbActin_RT_R' TCACCAACGTAGCTGTCTTTCTG,
zEF1α_RT_F' CTGGAGGCCAGCTCAAACAT, zEF1α_RT_R'
ATCAAGAAGAGTAGTACCGCTAGCATTAC. Acquired fluorescent reading were analyzed with iQ5 (BioRad), and CT values of reference genes were used to generalize deviation between samples.
ZLPA4 and zLPA5 RNA expression level were presented as relative fold to the average amount of zbActin and zEF1α.
Zebrafish RNA of different organs were collected in a similar procedure. In order to preserve as much RNA as possible, fish were sacrificed by laying on ice for 5 minutes and dissected under binomial microscope as long as fish's gill stop moving. Separated organs were homogenized in 1 ml TRIzol® with syringe with different tip opening as soon as possible. Collected organ RNA were then extracted with chloroform and precipitated by 100% ethanol, washed with 70% ethanol, air dried and resuspended in 50 μl DEPC treated water, followed by density determination. And revers transcribed into cDNA then used as template for real-time PCR, with zbActin and zEF1α as internal control.
WHOLE MOUNT IN SITU HYBRIDIZATION
The in situ hybridization experiment were carried out as in (106). In brief, probe were synthesized by using zLPA4 pGEM T and zLPA5 pGEM T vectors as template and undergo PCR
23
amplification by using VAS Taq Blue DNA polymerase (BIONOVAS) with primers containing 5' T7 promoter sequence: TAATACGACTCACTATAGGG. Each gene were amplified in two sets of primers in order to obtain sense and antisense template with 5' or 3' T7 promoter sequence. Primer sequences as follows, Sense: zLPR4 T7F' TAATACGACTCACTATAGGGgtggcattgacgactccttc,
zLPA4 R' TCAGAACTGAGTCTCACCAA, zLPA5 T7F'
TAATACGACTCACTATAGGGatgacttcaaacaacactac, zLPA5 R' TTATTGTCCAGTCCAACTCG,
Antisense: zLPA4 F' ATGGCCAGTCTTGTTCTTAA, zLPA4 T7R'
TAATACGACTCACTATAGGGtcagaactgagtctcaccaa, zLPA5 F' ATGACTTCAAACAACACTAC, zLPA5 T7R' TAATACGACTCACTATAGGGttattgtccagtccaactcg. (Capitalized letters represent the T7 promoter sequence.) The amplified template with opposite T7 promoter orientation are subjected to T7 RNA polymerase (Promega) with DIG RNA labeling mix (UTP) (Promega) so as to produce each sense and antisense strand RNA probe of each gene.
Embryo are collected at different developmental stages with 4% freshly prepared paraformaldehyde 4°C overnight, and then switch into 100% methanol and stored in -20°C till needed.
Before hybridization, the embryos are hybridized in PBS, permeabilized by proteinase K, washed in PBT and prehybridized in Hybridization Mix (HM) 70°C for 5 hours. For each 200 μl of HM, 40 ng of DIG-labeled RNA probe were added, and hybridized overnight at 70°C. After probe hybridization, embryos were washed through serial concentration of 2×SSC, 0.2×SSC, and then PBT. After 4 hours or blocking, sheep anti-digoxigenin-AP Fab fragments (Roche Diagnostics)(alkaline phosphatase conjugated) were added into blocking buffer at 1/10,000 dilution overnight at 4°C. For staining, the embryos were washed with PBT, changed into alkaline Tris buffer, and stained with NBT and BCIP in dark. The staining reaction were terminated by stop solution and mounted in 100% glycerol.
24
LPA INDUCED CA++ MOBILIZATION
The zLPA4 and zLPA5 over-expression construct were made by transferring each gene from pGEM T vecters into pIRES2 EGFP vectors through EcoRI site, the constructs were sequenced to confirm preferred orientation. Rat neuroblastoma cell line B103 were known to express very low level of intrinsic LPA receptors, which were transfected with zLPA4 pIRES, zLPA5 pIRES, or pIRES2 EGFP vector only by Lipofectamine™ 2000 (Invitrogene) for 24 hours with 500ng DNA/1.5μl Lipofectamine ratio per 90,000 cells in 96 wells plate. Fluorescence were observed 24 hours after transfection in order to confirm gene expression. About 48 hours after transfection, cells were stained with 4 uM Fluor 3-AM 37°C for 40 minutes, washed with PBS. The calcium mobilization were measured by Flexstation® 3 (Molecular Devices) by comparing time-laps fluorescent readings with different stimulations, such as 5μM LPA, 5μM S1P, vector controls or 1%
Triton X-100.
BONE AND CARTILAGE DIFFERENTIAL STAINING
Embryos were anaesthetized in 0.08% Tricaine® , and fixed in 4% paraformaldehyde/ PBS for 24 hours. Then washed in PBS and stained for cartilage in 0.1mg/ml Alcian Blue (Sigma) in ethanol/acetic acid (4:1), then rehydrated through ethanol series from 90%, 50% to 30%. The rehydrated embryos were digested overnight in 50mg/ml trypsin in 30% sodium tetraborate in water, and stained for bone with 0.4 ml of Alizarin Red S (Sigma) solution in 10 ml 0.5% KOH. At desired staining stage, embryos were destained in 1% KOH/glycerol series and stored in glycerol.
25
R ESULTS
HIERARCHICAL TREE OF ALL KNOWN LPA,S1P,P2RY RECEPTORS
In order to discover the zebrafish LPA receptor 4 and 5, we used the known mouse receptor protein sequences as bait and searched in zebrafish nucleotide sequence database. At the first glance, zebrafish LPA4 analogue XP_001334713.1 was found to has relatively high similarity to it's mammal parallel receptor. Whether the other sequence NP_955900.1 has an equally low similarity to both mouse LPA5 and LPA6, along with another zebrafish gene NP_001073524.1. Since both S1P/LPA are lysophospholipids, and LPA receptors can be divided into two families, that LPA1-3 are in the EDG family and LPA4-6 are in the P2RY family, we aligned all the known LPA, S1P and P2RY receptors protein sequences between species, and drew a hierarchical tree with random bootstrapping (Fig. 1). In the resulting figure, each receptor of different species were clustered into it's own family, with confidence reference sited at the branch. In accordance with our knowledge, S1PR1-5 are closely related to LPA1-3 for they all belong to EDG family, and LPA4/5 are similar to most other P2RY receptors. But each of the LPA receptors gathered in their own clusters, that XP_001334713.1 stays with other species' LPA4, and NP_955900.1 stays with other species' LPA5, but NP_001073524.1 were found to cluster with LPA6. The sequence NP_001073524.1 was further confirmed as zLPA6 by another group (105), and was found to be important for zebrafish embryo vessel development in a morpholino knock-down experiment. In this figure, we further verified the identity of zebrafish LPA receptor 4 and 5.
PROTEIN SEQUENCE ALIGNMENT OF HUMAN, MOUSE AND ZEBRAFISH LPA4 AND LPA5
All of the LPA receptors are GPCRs, thus as in Fig. 2a, we aligned the human, mouse and zebrafish protein sequences of LPA4 and LPA5, both alignment show conserved GPCR's seven transmembrane domains. But in zebrafish receptors, C terminus sequences are highly variated from
26
their mammalian relatives, in which cytosolic domains were known to be responsible for the binding of down stream signaling proteins such as the trimeric G protein complex (4) and PDZ scaffold proteins (42) such as NHERF2. These results suggest that the zebrafish LPA receptors 4 and 5 might have different cytosolic binding affinities compared to mammal's. In addition to cytosolic domain, the N terminus of zLPA4 is also 20 amino acids shorter than mammalian receptors, which their physiological function were not yet known. These finding reveals the conserved and variated domains of zLPA4 and zLPA5, which sheds light on the evolutionary research of LPA signalling.
PERCENTAGE SIMILARITY OF LPA4 AND LPA5 BETWEEN SPECIES
In the alignment of LPA receptors between different species, we collected the identical percentage of the same receptor, and arranged into this chart (Fig.2b). Compared to zebrafish LPA receptor 1 (104), LPA4 and LPA5 are much less conserved from fish to mammal, despite most of the LPA receptors are conserved between mouse and human. Especially in zLPA5, in contrast with the 60% similarity of zLPA4 and zLPA6, the zebrafish analogue has a low similarity to it's mammalian relatives for about 30%. In comparison with Fig. 2a, the LPA5 family is diverted from other R2RY LPA receptors such as LPA4 and LPA6, which indicates LPA5 might plays quite different roles in fishes and mammals, and it's physiological function may also differs from LPA4 due to it's broad ligand affinity (107).
LPA INDUCED CALCIUM MOBILIZATION IN B103 CELLS THROUGH ZLPA4 AND ZLPA5
All mammalian LPA receptors were known to trigger cytosolic calcium mobilization upon LPA stimulation (4). Therefore we over-expressed zLPA4 and zLPA5 in rat neuroblastoma cell line B103 along with a downstream IRES sequence and EGFP marker gene to monitor exogenous gene expression. The cells were subjected to calcium fluorophore staining, and observed for LPA stimulated calcium mobilization. But unfortunately, we are not able to observe any LPA specific
27
calcium deposition in this assay, by taking vector only transfection and vehicle treatment as negative control, which may due to the C terminus differences of zLPA4 and zLPA5 between fish and mammal.
DEVELOPMENTAL STAGE DEPENDENT ZLPA4 AND ZLPA5RNA EXPRESSION
In order to dissect the developmental roles of zLPA4 and zLPA5, first, we analyzed the expression timing and amount of these two genes. With the technique of real-time PCR, we used two reference genes zβActin and zEF1α as internal control, but we were surprised by the variation of reference gene expression along with fish development. Both genes transcription level increased with time, but zEF1α RNA peaks at 6 somites stage, however zβActin RNA level increases in a slower rate, which peak at 96 hpf stage. Taking these variations into account, the increased RNA of zLPA4 and zLPA5 before gastrulation can be seen as maternal RNA deposition. Thus, embryonic zLPA4 RNA is expressed at 5th day of development, and zLPA5 RNA is expressed since 24 somites stage. Both gene's RNA expression significantly increased after 5 dpf (data no shown).
WHOLE MOUNT IN SITU HYBRIDIZATION OF ZLPA4 AND ZLPA5
With the knowledge of the expression timing of these two genes, we further analyzed the spatial pattern of RNA expression at different developmental stages. With zHSP70 antisense probe as positive control, which zHSP70 is known to be highly expressed in 2 dpf embryo eyes, we are not able to observe any specific pattern between the comparison of antisense and sense probes of zLPA4 and zLPA5. Which suggest these two may not be specifically expressed in certain organ that can be observed under binomial microscope, however, we cannot exclude the possibility that these two LPA receptors may expressed at a smaller scale such as microvascular system or skin.
28
D ISCUSSION
Lysophophatidic acid is readily known to play important roles in several physiological, developmental and phathophysiological processes (4). However, the recent expansion of P2Y family LPA receptors further pinpoint the magnitude of LPA signaling, which it requires this large number of receptors to confer harmonious control of LPA activity. In the present study, we seek to identify the physiological and developmental role of zLPA4 and zLPA5. With evolutionary consistent sequence resemblance, zLPA4 and zLPA5 were identified and analyzed for their mRNA expression in different developmental stages and adult tissues. Zebrafish LPA4 and LPA5 mRNA were expressed at 4 dpf and 18 somites respectively. Functional analysis of LPA-dependent response were assayed for calcium mobilization, but no ligand-specific activity were observed. However, vascular structure significantly defected in the zLPA4 MO microinjected morphant.
On an evolutionary aspect, as the nucleotide sequence mutate with time, most of the information on DNA will wither except those functionally needed. Speaking from fish to human, it took nearly 250 million years to expand from the first vertebrate to mammals, and another 250 million years for Homo sapiens to come. As a signaling mechanism to evolve, in the case of LPA receptors, only the
functionally essential characters can be conserved, such as the protein conformation, ligand binding sites, signaling protein binding domains and the hydrophobic transmembrane domains. Through protein sequence TBLASTN analysis, we identified zebrafish cognate entry of LPA4 and LPA5, on the basis that function reserved in amino acid sequences. However, mounting results of zebrafish genomic analysis have indicated that the fish genome duplicated after they split from tetrapod lineage (four-footed) (108). The excessive genetic material may have facilitated the vast radiation of teleosts (bony fish) (108). Nevertheless, only a subset of the duplicates have been retained in modern teleost genomes, that similar amount of duplicated genes were reported in zebrafish and Tetraodon
29
(pufferfish) (108), despite the location of reserved duplicates differed. In the percentage similarity of LPA receptors, zLPA4 and zLPA6 showed a reasonable identity with their mammal analogues, whereas zLPA5 has low sequence relationships. The low conservation of LPA5 sequence may due to the elevated variation after genome duplication, or the differentiated need of LPA5 signaling. Taking LPA6 as an example, being a gene partially essential for zebrafish vessel development, the mutant gene of LPAR6 in human was shown to wilt only hair follicle rather than cardiovascular system, not to mention that sequence conservation is much higher in zLPA6 than in zLPA5. However, the zLPA5
morphant were generally normal, without significant malformation, suggesting that the physiological function of zLPA5 may lies in a more delicate or developmentally matured aspect.
G protein-coupled receptors (GPCRs) constitiute one of the largest and most extensively studied gene family of mammalian genomes (109). All GPCRs share a common functional conformation of seven α-helical transmembrane regions but many with various function domains, especially in their highly diverse N-terminus. The main role of GPCRs is to recognize a diversity of extracellular ligands such as hormones, proteins and lipids and to transduce their signals into the cell (110).
Virtually all types of cells express certain number of GPCRs, whereas the types of GPCRs expressed are usually tissue specific, a character that makes it an important target for pharmacological study.
The family of GPCRs can be divided into seven subfamilies, base on their distinct nature of ligand binding, from Glutamate, Rhodopsin, Adhesion, Frizzled, Taste type2, Secretin to Olfactory receptors. All of the known LPA receptors belong to the rhodopsin family, in which some of the receptors take photon sensing molecules as their ligand. However, each of the EDG and P2Y family LPA receptors belongs to different group of rhodopsin family, α and γ group respectively (109).
As presented in the hierarchical tree of LPA receptors, the zLPA4 and zLPA5 clustered with their own cognate groups. Which separated away from the EDG family receptors, despite they all belong
30
to the rhodopsin family. On how that two sequential distant family can each evolved their own receptors that recognize the same ligand remains to be the most intriguing question in the research of LPA receptors. In 2009, Zhang et al. have presented an in-depth comparison of ground-state and activated-state LPA4 crystal structure and found the plausible ligand binding loci of LPA4. Based on their analysis, LPA was predicted to bind LPA4 in an orientation similar to that reported for LPA1-3, but through a different network of hydrogen bonds (107). On the other hand, as the protein sequence of zLPA5 verified in the evolutionary test, the receptor was found to be relatively more distant from its mammal analogues than other LPA receptors. Several causes may lead to the diversification of zLPA5, either it play different signaling roles in zebrafish and mammals as in the case of LPA6, or the function of zLPA5 have been changed to meet the variated need of fish physiology after the splitting of tetrapods. But currently we do not have enough proof to support any of the theories.
After the name of G protein-coupled receptor, GPCRs signaling are majorly transduced through the binding of trimeric-heteromer G proteins, such as Gαi/o, Gαq/11,Gα12/13, and in the case of LPA4, Gαs. The trimeric G protein complex bind to the C terminus of GPCRs and dissociate upon ligand stimulation, thus the signaling property is largely depending on the C terminal sequence diversity of GPCRs (4). As previously presented (4), LPA4 is the only LPA receptor that acitvates Gαs and thus
After the name of G protein-coupled receptor, GPCRs signaling are majorly transduced through the binding of trimeric-heteromer G proteins, such as Gαi/o, Gαq/11,Gα12/13, and in the case of LPA4, Gαs. The trimeric G protein complex bind to the C terminus of GPCRs and dissociate upon ligand stimulation, thus the signaling property is largely depending on the C terminal sequence diversity of GPCRs (4). As previously presented (4), LPA4 is the only LPA receptor that acitvates Gαs and thus