Animals
Four weeks old male C57BL/6 mice were purchased from BioLASCO Taiwan Co., Ltd. Mice were housed in the animal facility of the National Taiwan Normal University. The diurnal cycle began from 8:00 and ended at 20:00. Animals were allowed the access to water and food ad libitum at all times. All behavioral procedures were performed in the afternoon (from 13:00 to 17:00). All experimental procedures adopted were approved by the Laboratory Animal Management Committee of National Taiwan Normal University and compliance with the Guide for the Care and Use of Laboratory Animals of the Council of Agriculture, Republic of China.
Juvenile immobilization treatment (J_IMO)
The mice were given a two-hour for once to immobilization stress treatment (IMO) at the postnatal day 35 and 36 (PND). The IMO procedure adopted in this study is similar to that was reported by Lin (2019, dissertation). Juvenile mice were placed into a triangular restraint bag with a few seams to ensure that the animals breathe smoothly. To prevent them escape from the restraint bag, a cone-shape cream nozzle was attached to the head of the mice. All these procedures were only be performed in the afternoon, and room temperature were maintained at 25 °C. Animals were subjected to two consecutive days IMO, depending on the purpose of the experiment.
Inhibitory avoidance test (IA)
The inhibitory avoidance test is widely used to study the hippocampal dependent learning and memory. During experimental training, mice are placed in a behavior box. The behavioral chamber consists of a light compartment and a dark compartment separated by a sliding door in the middle. A single training was given, animals were then returned to the housing cage and subjected to the testing twenty-four hours later. The time (latency) of the mice from the light compartment move into the dark compartment was served an index of avoidance learning (Figure 5).
The general behavioral procedure of IA is composed of four different phases (acclimation, training, testing, and extinction). The details are summarized below:
1. Acclimation
It is aimed to reduce the animal's context fear to the behavioral apparatus and working procedure. During the acclimation, animals were placed in the light room for 40 seconds, and subsequently the sliding door is opened. Once the animal passes from the light room to the dark room, the door were closed, and the animals were returned to the breeding box after 2 minutes.
2. Training
Twenty-four hours after the “acclimation”, the animals were subjected to test training. Again, animals were placed in the light room for 40 seconds, and the separating door is opened. After entering the dark room, the door
is immediately closed and animals were given a footshock (0.8 mA, 2s) two seconds later. Record the incubation period of animals from the bright room into the dark room.
3. Testing
Twenty-four hours after the “training” the animals were returned to light room. They were placed in the light room for 180 seconds before the door opening. The escape latency was recorded as an index of avoidance learning. In addition, the recording was stopped if the animal stays in the light compartment for more than 10 mins.
4. Extinction
Twenty-four hours after the “testing”, animals were returned to light compartment of the behavioral chamber. The procedure is similar to the training except that no foot shock was given.
Open field test (OFT)
The mice were placed in the middle of a test chamber with diameters of 40 x 40 x 30 cm (length x width x height). The floor of the chamber was divided into sixteen equal sized square zones. The middle four-square zones were defined as a center area, and the rest twelve square zones, surrounding the center area, were defined as a peripheral area (Figure 6).
The animal’s horizontal moving activity, the number of crossing and percentage of time spent between the center and peripheral areas were
repetitively monitored by a digital camera for a total of 10 minutes.
Rodents generally tend to move around. If the frequency and time in the central part of the venue increase, it means that the degree of anxiety is reduced, and the degree of anxiety in experimental animals is evaluated.
The data were analyzed by a commercial tracking software SMART VIDEO TRACKING (manufactured by Panlab Harvard Apparatus, Spain).
The illumination of the behavior room was held on 30 Lux. After each test, the chamber was thoroughly washed with 70% ethanol. The OFT procedure was performed similar to the previous study by Lin (2019, dissertation).
Elevated plus-maze (EPM)
The maze was conducted experiment under glimmer (elevated 30 lux).
The maze itself were constructed of two open (30 × 5 cm) and two closed arms (30 × 5 cm) by a 14 cm height walls. Closed arms possessed black walls 40 cm in height, and all arms were connected by a central 5 cm by 5 cm square section (Figure 7). Through the rodent's aversion to open arms that are hanging high and empty. If the animal enters the open arm for a longer time and more frequently, it means that the degree of anxiety decreases.
The observer was situated in a neighboring room, and each session of the test was recorded by video (Smart 3.0) for subsequent analysis. Mice were individually placed in the center of the maze facing a closed arm and
allowed 5 minutes of free roaming. Metrics will include number of entries into an open arm, number of entries into a closed arm, total time spent in open arms, and total time spent in closed arms. The EPM procedure we used to be a modified one derived from our previous study (Lin, 2019, Master Dissertation).
Brain slice extracellular recording
Coronal slices of mice brain (300 μm thick) were prepared with a double-edge blade. The slices were placed in oxygenated artificial cerebrospinal fluid (ACSF) for at least 1 h in room temperature before recording. Each slice was then transferred to a recording chamber, where it was held on between two nylon nets and maintained at 32 ± l ℃. The chamber consisted of a circular well with a volume of 1~1.5 ml and was perfused with ACSF constantly at the rate of 3-4 ml/min. A bipolar stimulating electrode (SNE-2OOX, Kopf Instrument, USA) was used in this study. Field excitatory postsynaptic potential (fEPSP) was recorded extracellularly by using a glass microelectrode filled with 3M of NaCl (3-8 MΩ). The stimulus electrode was placed in the CA3 region of hippocampus and the recoding electrode was set to the CA1 region of the hippocampus, respectively. The evoked fEPSP signals were then recorded by an Axoclamp-2B amplifier (Axon Instruments, USA). The responses were elicited by low square-wave pulses delivered at a 20 s interval, filtered at 1 kHz and digitized at 5 kHz (Digidata 1322A; Axon Instruments,
USA). The stimulation voltage was adjusted individually for each trial to produce fEPSP, by which 30-40% of the maximal response could be evoked. The strength of synaptic transmission was quantified by measuring the initial slope of the fEPSP, and the results were analyzed by pCLAMP software (Version 10.2; Axon Instruments, USA). High frequency stimulation (HFS) were initiated as LTP by test pulse intensity (1-second pulse of 100-Hz stimuli separated by an interval of 20 seconds).
The input-output (I/O) curve and paired-pulse facilitation (PPF) experiment were performed with separate brain slices. I/O relationship and PPF were assessed to indicate the basal synaptic transmission functions and presynaptic plasticity. The I/O curve was recorded and calculated with incremental stimulation intensities of 65, 70, 75, 80, 85 mV. The PPF test delivered with interpulse intervals of 20, 50, 100, 150 and 200 milliseconds.
Administration of bumetanide and furosemide
For extracellular recording, bumetanide and furosemide were first dissolved in 100% DMSO to make a 10 mM and 50 mM stock solutions, respectively. The stock bumetanide was diluted to 5 μM and 10 μM by artificial cerebrospinal fluid (aCSF), and the shock furosemide was diluted to 50 μM by aCSF. The bumetanide dosage used were based on previous studies (Ko et al., 2014; Ko et al., 2018). The final concentration of DMSO was approximately 0.05 ~ 0.10%.
During the experiment, the hippocampal slices were first perfused with
pure aCSF, and then perfused with aCSF containing bumetanide and furosemide. The baseline signal was recorded for 20 minutes (only recorded aCSF in the first 10 minutes, suprafused bumetanide and furosemide in the last 10 mins). After the LTP induction, slices were suprafused with bumetanide or furosemide for 10 minutes. Then followed with a 50 mins recording with the continues suprafusion of aCSF.
Real-time polymerase chain reaction
The mice were sacrificed at PSD42 and their brains were frozen at -70℃. The dorsal hippocampus (dHip) (bregma -1.34~ -2.06 mm, X: 2.5 ~ 2.5 mm, Y: 1.5~2.5 mm) regions of the brain were punched out using a 1 mm diameter Integra Miltex Disposable Biopsy Punches (skin biopsy punch). The collected tissues were stored at −70°C for qPCR analysis.
From these tissues, total RNA was extracted by using a LabDrepTM RNA Plus mini kit (cat. No. LPRS100, TW) by using the provided protocol. A Nanodrop 1000 spectrophotometer were used to measure the concentration of the obtained RNA. Then configure the same ng of RNA (total 13 µL), mix 1 µL 10 µM oligo dT. Incubate for 10 minutes at 70 °C, and immediately treat it at low temperature (incubated on ice). To this solution, 4 µL of 5x RT buffer (250 mM TrisHCl, pH 8.3, 375 mM KCl, 15 mM MgCl2, 50 mM DTT), 1 µL of 10 mM dNTP, 1 µL EasyScriptTM III RTase (200 units, Bioman, Taiwan) were added, and the reverse transcription was performed at 60 ℃ for 2 hours.
The obtained cDANs were then subjected to quantitative PCR by using PowerUp SYBR Green Master Mix (Cat. A25742, ThermoFisher, USA) and quantified by StepOnePlus Real-Time PCR Systems (ThermoFisher, USA). Specific primers for PCR were designed and used in the expression analysis of Fkbp5, Gabra1, Grin2a, Slc12a2, Slc12a5 and Gapdh (reference gene). The relative level of each gene expression was normalized with the expression levels of Gapdh. Graphics data were represented by fold change obtained by the 2-△△Ct method. These experiments were collaborated with Mr. Lin, Wei-Hsing.
Appendix primer sequences for qPCR
Gapdh
Product size 129 Reference Sequence NM_008084.3
Forward GTGGACCTCATGGCCTACAT
Reverse TGTGAGGGAGATGCTCAGTG
Fkbp5
Product size 163 Reference Sequence NM_010220.4
Forward GGAGCCGACTGTGTGTGTAA
Reverse CAGTCTCCTTGGCCCACAAT
Gabra1 (GABAA1 receptor gene)
Product size 138 Reference Sequence NM_001359035.1
Forward GAACAGTTCCTGCTGACTCC
Reverse CTCTGGAAAGCGAGACATGC
Grin2a (NR2A receptor gene)
Product size 207 Reference Sequence NM_008170.4
Forward CTGCCTTGTGGTCCTCAATC
Reverse GCCCTCAATCACTCTGACAC
Slc12a2 (NKCC1 gene)
Product size 134 Reference Sequence NM_009194.3
Forward CACAGTGAATCTCGATGCAC
Reverse CTTGAGACTGTTTGACCAGG
Slc12a5 (KCC2 gene)
Product size 146 Reference Sequence NM_020333.2
Forward CAGTGGTTTTGCCTTTTGGG
Reverse GTGGGCTGTTTTCATCAACG
Gapdh: Glyceraldehyde 3-phosphate dehydrogenase FkbpP5: FK506 binding protein 5
Gabra1: Gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 Grin2a: Glutamate receptor, ionotropic, N-methyl-D-aspartate epsilon 1 (NMDA2A)
Slc12a2: Na-K-Cl cotransporter 1 (solute carrier family 12, member 2) Slc12a5: K-Cl transporter member 5 (solute carrier family 12, member 5)
Western blot
The mice were sacrificed at PSD-42 and their brains were frozen at
−70℃. The dorsal hippocampus (dHip) (bregma -1.34~ -2.06 mm, X: 2.5
~ 2.5 mm, Y: 1.5~2.5 mm) regions of the brain were punched out using a 1 mm diameter Integra Miltex Disposable Biopsy Punches (skin biopsy punch). The obtained tissues were then subjected to western blot analysis.
We used the T-PER Tissue Protein Extraction Reagent (Thermo scientific, USA) with the HaltTM Protease & Phosphatase Single-Use Inhibitor Cocktail (Thermo scientific, USA), to homogenize tissues by ultrasonic homogenization. Samples were centrifuged at full speed (16,000g) for 10 minutes at 4°C and the precipitate was discarded. Total protein concentration was determined by using a Bio-Rad Bradford protein Assay Kit (Bio-Rad, Hercules, USA). Protein from each sample (30 μg each) were electrophoresed on SDS PAGE, and the resolved protein were
electrically transferred to a 0.45 µm PVDF membrane (Merck Millipore, Germany) with 70V for 2 hours. The membrane was blocked in TBST (0.1% Tween-20) containing 5% nonfat milk for 1 hour at room temperature. Primary antibodies used were specifically against NKCC1 (1:2000 in 5% nonfat milk, 14581s, Cell Signaling Technology, USA) and beta actin (1:5000 in 5% BSA, Ab8227, Abcam, UK). The PVDF membranes were shake in a primary antibody solution overnight at 4°C.
Next day, pour out the antibody solution and store at 4°C. The PVDF membrane was washed with TBST for five min, a total of three times. Then add the HRP-conjugated secondary antibody (anti-rabbit IgG, HRP-linked antibody, 1:3000 in 5% nonfat milk, 7074s, Cell Signaling Technology, USA) and shake for 1 hour at room temperature. After pour out the secondary antibody, the PVDF membrane was washed with TBST for five minutes, a total of three times. The detection reagent was used by Ex-CL Western Chemiluminescent Kit (Cat# W-3408-0, Goal Bio, Taiwan) and were detected by LAS 4000 (GE Healthcare, USA). Evidence of protein presence were analyzed by image studio lite (ver 5.2) analysis software.
These experiments were collaborated with Mr. Lin, Wei-Hsing.
Statistics
All the calculated data were presented as mean ± S.E.M. The data of inhibitory avoidance testing results were analyzed by ANOVA two-way analysis, Multiple comparisons, and Sidak’s multiple comparisons test of
variance. Whereas, that of behavior testing (open field test and elevated plus-maze) results were analysis by using a one-way ANOVA. A two-way ANOVA was used when there was more than one independent variable.
The statistical analysis on LTP, I/O and PPF experiments were performed by using the two-way ANOVA and t-test. Real-time PCR data were analyzed using Mann-Whitney test. Protein level data in western blot were analyzed with an unpaired Mann-Whitney test. Probability levels of less than 0.05 (p <0.05) were considered to be significant. All data were analyzed with GraphPad Prism software.
RESULTS
Experiment-1: Examine the juvenile immobilization treatment effects on the inhibitory avoidance learning.
Rationale:
Previous animal studies have shown that adverse early life experiences would lead to long-term effects on brain function, cognition, emotional development, learning memory, and increase anxiety-like behavior (Kosten et al., 2012; Teicher & Samson, 2016; Loi et al., 2017). These all potentially might increase the risk of developing stress-related psychopathology in later life (Kendler et al., 2000). Therefore, we first decided to evaluated the effect of immobilization treatment (IMO) by the inhibitory avoidance learning response of male juvenile mice.
Procedure:
Only C57BL/6 male mice were chosen for avoiding the possible confounded effects of estrus cycle on the emotional behavior. Briefly, juvenile mice (five weeks old) were assigned to two groups, control group and two days immobilization treatment group (J_IMO group). Animals received the J_IMO treatment were at the age of PND-35 &36. Along with control group, they were then subjected to the inhibitory avoidance test (IA) at the age of PND-42. The detailed testing procedures were described in the materials and methods session. The latency of the animals entering the dark compartment after opening of the sliding door were recorded as the
escape latency and served as an index of avoidance learning.
Results:
Our results showed that there was a significant increase of the escape latency found between the training and testing session of both control and J_IMO groups (two-way ANOVA F (1, 25) = 12.83 and p = 0.0014). These suggested that both groups had been successful trained and exhibited the avoidance response to the footshock. The learned avoidance response was successfully declined in the control group after two times of extinction training (Ext-1 & Ext-2) (two-way ANOVA, Sidak's multiple comparisons test: p < 0.0001 in Ext-1 by control vs. J_IMO; p = 0.0171 in Ext-2 by control vs. J_IMO). In contrast, a significant blockage of extinction learning was observed in the J_IMO group. After additional two times of extinction training (Ext-3 & re-test), the J_IMO animals showed a decline in the learnt avoidance response and did not reach a significant level (p = 0.2102 in Ext-3 by control vs. J_IMO; p = 0.4348 in re-test by control vs.
J_IMO). These results suggested an extinction learning defect occurred to the J_IMO treated animals (Figure 8A). Compare the components separately in Figure 8B. In the control group, p = 0.0053 by test compared with the corresponding train; p = 0.0172 by Ext-2 compared with the corresponding test; p = 0.009 by Ext-3 compared with the corresponding test; p = 0.0105 by re-test compared with the corresponding test (two-way ANOVA, Sidak's multiple comparisons test). In the J_IMO group, p <
0.0001 by test compared with the corresponding train; p < 0.0001 by Ext-1 compared with the corresponding train; p = 0.006Ext-1 by Ext-2 compared with the corresponding train; p = 0.0014 by Ext-3 compared with test; p = 0.0003 by re-test compared with the corresponding test (two-way ANOVA, Sidak's multiple comparisons test).
Experiment-2: Evaluation of the juvenile immobilization treatment induced anxiety-like behavior in the male mice by open field test and elevated plus-maze test.
Rationale:
In our previous studies, we have demonstrated that IMO treatment could induce anxiety-like behavior in the adult male mice (Tu et al., 2019).
In this study, we would also like to determine whether the J_IMO could also elicit a similar effect. This would reparent a fundamental step to the subsequent experiments.
Procedure:
Additional control group and J_IMO animals were prepared and subjected to the open field test (OFT) and elevated plus-maze test (EPM) one week after the J_IMO treatment. In OFT, the number of times mouse entries to the center zone, the time spent in the center zone, and the total moving distance were recorded and analyzed. The same animals were then subjected to the EPM 24 hours later. The number of entries in each zone, the percent time spent in each zone, and the total moving distance were recorded and analyzed. For details, please refer to the materials and methods session.
Results:
There was no significant difference in the total moving distance of OFT and EPM among groups (Figure 9C, F). In the OFT test, the number of entries into the center zone and the time spent in the center zone were significantly decreased in the J_IMO treated mice group (Mann-Whitney test, the number of entries into the center zone: p = 0.0238 compared with the corresponding control group; the time spent in the center zone: p = 0.
0052 compared with the corresponding control group) (Figure 9A, B).
These results suggested an increase of anxiety-like behavior existed in the J_IMO treated animals. In the EPM test, no significant difference was found on the number of entries and time spent in open arms among the control group and the J_IMO group (Figure 9D, E). In summary, we found that anxiety-like behavior is elevated in the J_IMO groups which could be detected by OFT but not by EPM.
Experiment-3: Determine the hippocampal long-term potentiation of the IMO animals using brain slice extracellular recording.
Rationale:
Our data showed learnt avoidance response was enhanced and extinction was impaired in the J_IMO treated mice. We speculated that the neurotransmission of hippocampus might also be modified. Therefore, we examined this possibility here by in vitro extracellular recording.
Procedure:
Additional control and J_IMO animals were prepared and sacrificed at the age of 6-week-old for the in vitro extracellular recording of the high-frequency (HFS) induced hippocampal long-term potentiation (LTP). The stimulation electrode and recording electrode were placed in CA3 and CA1 of hippocampus, respectively. The detailed experimental procedure is described in the materials and methods.
Results:
The HFS-induced hippocampal LTP was significantly enhanced in the J_IMO group animals as compared with the corresponding control group, as the measurement was made 60 min after a tetanic stimulus (two-way ANOVA F (1, 12) = 6.455, p = 0.0259) (Figure 10A). The average magnitude of potentiation in the J_IMO group measured 10 min before
HFS was 98.7 ± 2.36 % and the control group was 103 ± 4 %. No significant differences were found (Mann-Whitney test, p = 0.4557). The average magnitude of potentiation in the J_IMO group, measured 40 min after HFS, was 316 ± 37.5 % and the control group was 103 ± 4 %. It was increased in J_IMO mice significantly (Mann-Whitney test, p = 0.0006) (Figure 10B). These results proved that IMO might provoke a long-lasting effect on the neurotransmission of hippocampus.
Experiment-4: Determine the input-output curve and paired-pulse facilitation of the brain slices of J_IMO treated animals.
Rationale:
Our data showed J_IMO treated mice actually exhibited a long-lasting effect on the neurotransmission of the hippocampus. Thus, we would like to focus our interest in determining whether a pre-synaptic or post-synaptic mechanism is involved in such process.
Procedure:
Animals subjected to J_IMO or control without treatment, were used to undergo in vitro extracellular recording at the age of six weeks. For the electrophysiological recording, a biphasic stimulation was used in all the experiments. The input-output (I/O) curve and paired-pulse facilitation (PPF) experiment were performed in separate brain slices. The stimulation electrode and recording electrode were placed in CA3 and CA1 of
Animals subjected to J_IMO or control without treatment, were used to undergo in vitro extracellular recording at the age of six weeks. For the electrophysiological recording, a biphasic stimulation was used in all the experiments. The input-output (I/O) curve and paired-pulse facilitation (PPF) experiment were performed in separate brain slices. The stimulation electrode and recording electrode were placed in CA3 and CA1 of