• 沒有找到結果。

2.1. Cells and the animal

The experimental animal, Aiptasia pulchella, was maintained in laboratory aquaria on a 14/10-h light/dark cycle at irradiance levels of 80–100 photons m-2 s-1. The animals were fed with frozen brine shrimp twice per week. Aquarium water temperature was maintained at around 26–28 ℃, and one half of aquarium water was replaced with fresh filtered seawater (1-µm Millipore) one day after each feeding. Cultured mammalian cells (HeLa cells) were maintained in minimum essential medium (MEM) supplemented with 10% fetal bovine serum (FBS), penicillin (100 U/ml), and streptomycin sulfate (100 µg/ml) at 37 ℃, in a humid incubator with 5% CO2.

2.2. Cloning of full-length ApRab4 and ApRab14 cDNA and sequence analysis

To clone the full-length cDNA for A. pulchella Rab4 and Rab14 proteins, degenerate polymerase chain reaction (PCR) was first conducted to generate short cDNA fragments coding for conserved Rab protein regions(Thompson et al., 1994; Rose et al., 1998). According to the degenerate PCR database previously established in our laboratory, we find partial Rab4 sequence and short-form Rab14 full-length sequence from Aiptasia pullchellae cDNA library. And through Rapid amplification cDNA end (RACE) technique

(Frohman et al., 1988), we acquired Aiptaisa Rab4 and Rab14 (ApRab4 and short- and long-form ApRab14) full-length cDNA sequences. The primers used for ApRab4 3’ RACE are ApRab4-F1: 5’- CCAGGAGTTACT ACAGAGGACAG -3’ and ApRab4-F2: 5’- TAAAACAGATCTTGATGCC GACAG -3’, and 5’ RACE are ApRab4-R1: 5’- GAACTTCTCTGTCGGCA TCAA -3’, ApRab4-R2: 5’- TCCAGCTGCTCCTCTGTAGTAAC -3’.

2.3. Construction, expression, and purification of recombinant ApRab4 and ApRab14-L proteins

To produce recombinant ApRab4 and ApRab14-L proteins, the coding region of ApRab4 and ApRab14 were PCR-amplified, restriction-digested, and subsequently ligated with identically restriction-digested pET28a vector (Novagen) to generate pHis-ApRab4 and pHis-ApRab14-L. The PCR primers used for the construction of histidine-tagged recombinant ApRab4 and ApRab14 proteins are: ApRab4-pET28a-f: 5’- CGGAATTCATGTCAGAGT CTTAC GACTTCCTCT -3’ (the start codon of ApRab4 is in bold letter, and

EcoRI site is underlined), ApRab4-pET28a-r: 5’- CCCTCGAGGCTACTTG

CTACAGTTAGCTGGGCA-3’ (the stop codon of ApRab4 is in boldface, and

XhoI site is underlined) and ApRab14(L)-pET28a-f:5’-CGCGGATCCATGG

CAGCGACAGGGCCGTACAA -3’ (the start codon of ApRab14-L is in bold letter, and BamHI site is underlined), ApRab14(L)-pET28a-r: 5’- CGGAATTCTTAACAATTACACCTGTCTTGGTTCG -3’ (the stop codon

of ApRab14-L is in boldface, and EcoRI site is underlined). Templates used in the PCRs were the plasmid containing full-length ApRab4 and ApRab14-L cDNA sequence. All PCR-amplified sequences of ApRab4 and ApRab14-L were sequenced at both strands to confirm the amplification of the desired sequences and the absence of any secondary mutations. The in-frame fusion between the histidine tag and ApRab4 and ApRab14-L were also verified by nucleotide sequencing. The bacterial transformation of pHis-ApRab4 and pHis-ApRab14-L, generation of recombinant ApRab4 and ApRab14-L proteins, and their purification were conducted according to the manufacturer’s instruction (Novagen). The recombinant ApRab4 and ApRab14-L proteins were affinity-purified by nickel column as instructed by the manufacturer (Novagen).

2.4. Prepared of polyclonal antibodies

Rats were injected in the abdominal cavity with 350µl emulsion containing 100 µg recombinants ApRab4 and ApRab14-L proteins as antigens in Freund’s complete adjuvant (Sigma) mixed at 1:1. Two weeks later, injection of the animals with the same amount of antigen emulsified with Freund’s incomplete adjuvant (Sigma). After six boosts, whole blood of the animal was collected, and incubated first for 60 min at 37℃ and then at 4℃ overnight. The serum was separated from blood cells by centrifugation at 10,000 g for 10 min at 4℃. The anti-ApRab4 and -ApRab14 IgGs were

purified from the serum by using AffinityPakTM Protein A Columns (PIERCE).

2.5. Western blot analysis

Cell lysates of A. pulchella were prepared by directly homogenizing the animal in 2–3 volumes of cold homogenization buffer (250 µM sucrose, 10 mM Hepes, pH 7.4, and 0.1 mM EDTA) containing a cocktail of protease inhibitors (Roche) followed by a clarification spin (2000g, 10 min, 3 times) to remove unbroken cells, intact nuclei, and zooxanthellae. Protein concentrations were determined by the Bradford method (Bio-Rad Protein Assay Dye Reagent Concentrate). Protein samples (20 µg) were resolved by SDS–PAGE in a 15% polyacrylamide gel and then blotted onto PVDF filters using a semi-dry blotting device (Bio-Rad). The membranes were first incubated with either the rat anti-ApRab4 or ApRab14-L polyclonal antiserum (1:500 dilution) followed by HRP-conjugated goat anti-rat IgG (1:10,000 dilution, Zymed Laboratories). Both antibodies were diluted in 5%

milk powder, and 0.05% Tween 20 in PBS. Enhanced chemiluminescence (Western blot chemi- luminescent reagent plus, NEN) was used for the visualization of specific protein bands on X-ray film (BioMax Light, Kodak) or digitization fluorescence LAS-3000 (Fujifilm).

2.6. Transfection of mammalian cells

The expression construct encoding either EGFP-ApRab4 or EGFP-ApRab14-L fusion protein (EGFP tagged at the N terminus of ApRab4 or ApRab14-L) were constructed in two steps. First, the coding sequence of ApRab4 and ApRan14-L were PCR-amplified from pApRab4 and pApRab14-L (ApRab4 and ApRab14-L cDNA in YEA yT&A vector) using the sense primer, ApRab4-pEGFPc1-f: 5’-CGGAATTCCATGTCAGAGTCT TACGACTTCCTCT-3’,ApRab14(L)-pEGFPc1-f: 5’-GCGGAATTCTATGG CAGCGACAGGGCCGTACAA-3’ (EcoRI site is underlined, the start codons of ApRab4 and ApRab14 are bolded) and the antisense primer, ApRab4-pEGFPc1-r: 5’-CGGGATCCCTACTTGCTACAGTTAGCTGGGC A-3’, ApRab14(L)-pEGFPc1-r:5’-GCGGGATCCTTAACAATTACACCTGT CTTGGTTCG-3’ (BamHI site is underlined, the stop codons of ApRab4 and ApRab14-L are bolded). Then, after restriction digestion with EcoRI and

BamHI, the PCR product was ligated with identically pre-digested pEGFPc1

vector (Clontech) to create pEGFP-ApRab4 and pEGFP-ApRab14-L plasmid.

To construct the plasmid encoding EGFP-tagged mutant ApRab4 and ApRab14-L proteins where S22 or S26 were mutated to N (pEGFP-ApRab4-S22N, pEGFP-ApRab14-L-S26N) and Q67 or Q71 were mutated to L (pEGFP-ApRab4-Q67L, pEGFP-ApRab14-L-Q71L), eight partially overlapping mutagenic primers, ApRab4-S22N-f: 5’-CACGGGAAA AAACTGCATCCTGCATCAGTTTAT-3’, ApRab4-S22N-r: 5’-GCAGGAT

GCAGTTTTTTCCCGTGCCAGCACTTC-3’, Rab4-Q67L-f: 5’-CACTGCT GGCCTAGAACGTTTCAGGT CAGTAAC-3’, ApRab4-Q67L-r: 5’-TGAA ACGTTCTAGGCCAGCAGTGTCCCATATCT-3’ and ApRab14(L)-S26N-f:

5’-TGTTGGTAAGAACTGTCTCCTTCACCAATTCAC-3’, ApRab14(L) -S26N-r: 5’-GAAGGAGACAGTTCTTACCAACACCCATATCAC-3’, ApRab14(L)-Q71L-f:5’-TACGGCAGGACTAGAACGATTCAGGGCTGT AAC-3’, ApRab14(L)-Q71L-r: 5’-TGAATCGTTCTAGTCCTGCCG TATCCCATATCT-3’ (mutagenic bases were boxed, overlapping regions were underlined), were synthesized and paired with pEGFPc1-f and pEGFPc1-r in two separate PCRs using pEGFP-ApRab4 and pEGFP-ApRab14-L as template to generate two overlapping cDNA fragments. Then a second round of PCR using the purified cDNA fragments generated above as the templates and pEGFPc1-f and pEGFPc1-r as the primers was conducted to generate complete ApRab4 and ApRan14-L coding sequence containing the desired single amino acid mutation. This cDNA was ligated with pEGFPc1 vector (Clontech) pre-digested with EcoRI and BamHI to create pEGFP-ApRab4-S22N, pEGFP-ApRab4-Q67L, pEGFP-ApRab14-L-S26N and pEGFP-ApRab14-L-Q71L plasmid.

Sequencing was performed to verify the intended amplification and the absence of any secondary mutations in the coding sequence of ApRab4 and ApRan14-L. For cell transfection, both newly confluent HeLa cells were seeded at 2 x 105 cells to each well of a six-well culture plate one day before

transfection was conducted. Two µg of either pEGFP or pEGFP-ApRab4 or ApRan14-L was introduced into these cells using FuGENE 6 transfection reagent (Roche). Fluorescence images of living cells were immediately taken without prior fixation using a Nikon ECLIPSE E400 microscope equipped with appropriate filter sets and a digital imaging device (Evolution VF COOLED COLOR, Media Cybernatics).

2.7. Cell image

To determine the identity of pEGFP-ApRab4 and pEGFP-ApRab14-L positive structures, sub-confluent HeLa cells were first transfected using FuGENE 6 transfection reagent (Roche) with the plasmid encoding the fusion protein. At 16-h post-transfection, cells were incubated either with 1 µM transferrin-Texas Red (Sheff, 2002; Widera et al., 2003) for 30 min at 37 ℃ to label all recycling endosomes, or with 5 mg/ml dextran-TRICT (70 kDa) for 10 min and 30 min at 37 ℃ to label early and late endocytic compartments, respectively, or with 75 nM LysoTracker-red for 15 min to label acidic compartments, or TR-C5-ceramide (Invitrogen) for 30 min to label sphingolipids (the Golgi apparatus). Fluorescence images of living cells were immediately taken without prior fixation using a Nikon ECLIPSE E400 microscope equipped with appropriate filter sets and a digital imaging device (Evolution VF COOLED COLOR, Media Cybernetics). To investigate the subcellular localization of endogenous ApRab4 and ApRab14-L, endodermic

tissues of symbiotic A. pulchella were fixed by acidic solution (acetic acid : glycerol : filtered seawater = 1:1:13 ) 10 min and dissociated into single cells by pipetting as described (David, 1973). The generated cell suspension was transferred onto poly-lysine coated glass slides and allowed to adhere to the slides for 30 min at room temperature. DCMU (3-(3, 4-dichlorophenyl) -1, 1-dimethylurea)-treated animals were processed in the same way. These cells were brought through standard immunostaining procedures with the rat anti-ApRab4 and ApRab14-L polyclonal IgGs used at 1:30 (ApRab4) or 1:60 (ApRab14-L) dilution and the Cy3- conjugated goat anti-rat IgG (Zymed Laboratories) at 1:1000 dilution. Both antibodies were diluted in 1x PBS containing 0.1% Triton X-100. The cells were imaged with a Nikon ECLIPSE E400 microscope equipped with a TRICT filter set and a digital imaging device (Evolution VF COOLED COLOR, Media Cybernatics).

2.8. Phagocytosis assay

Animals were starved at least for 3 days before being challenged with either 2 μm latex beads (Sigma), live zooxanthellae freshly isolated from symbiotic A. pulchella, or zooxanthellae immediately heat-killed after isolation. All particles diluted in frozen Brine shrimp solution were injected into the gut of the animal in a volume of 20 μl through a standard white micropipette tip. All injections and incubations were conducted at room temperature under ambient illumination. For each phagocytosis assay,

approximately 1x105 particles were injected. After fixed time intervals, three animals from each challenging experiment were processed for immunofluorescence.

相關文件