1. Clinical specimen acquisition and clinicopathological staging
Formalin-fixed, paraffin-embedded OSCC tissue blocks were retrieved (79 men
and 14 women, mean age 53.9 years, range 25-82 years) from the archive of the
Department of Oral Pathology from 2000 to 2003, in accordance with ethical and
institutional guidelines and with the approval of the Institutional Review Board of
National Taiwan University Hospital (NTUH IRB, No 201111048RIC). Diagnosis of
squamous cell carcinoma was based on histological examination of hematoxylin and
eosin-stained (H&E) tissue sections by two qualified oral pathologists (YP Wang and
CP Chiang). The pathological stage of each case at the time of surgery was
determined according to the 7th edition of staging criteria from the American Joint
Committee on Cancer. Also, specimens of oral mucosa from healthy volunteer donors
with informed consent (30 cases) were collected as controls during the extractions of
their impacted wisdom teeth. Tissue sections, which included both tumor and adjacent
non-tumor parts for comparison purposes, were cut to 4 m in thickness.
2. Immunohistochemical staining
Sections were deparaffinized and rehydrated, and antigen retrieval was
performed concomitantly in the Trilogy buffer system (Cell Marque, Rocklin, CA,
USA) in accordance with the manufacturer’s instructions. Endogenous peroxidase
activity was then blocked by immersing the sections with 3% H2O2 in methanol for 30
minutes (min). After washing in phosphate-buffered saline (PBS), sections were
incubated with 1% bovine serum albumin (BSA) for 30 min to block non-specific
binding. Sections were then incubated with the monoclonal antibody Lyric 4-7 [74] at
a concentration of 1 μg/ml for one hour (hr) at room temperature (RT). For staining of
phosphorylated p65 and MMP1, anti-phosphorylated p65 polyclonal antibody
(sc-101753, Santa Cruz biotechnology, Dallas, TX, USA) and anti-human MMP1
antibody (clone 36665, R&D system, Minneapolis, MN, USA) were used at a dilution
of 1:50 and 15 μg/ml, respectively. After being washed in PBS containing 0.1%
Tween 20 (PBST0.1), sections were treated with the polymer-based Super Sensitive
IHC detection system (Biogenex, San Ramon, CA, USA). In brief, sections were
incubated with Super Enhancer reagent for 20 min at RT and were then thoroughly
rinsed three times with PBST0.1 for 5 min each. Sections were subsequently treated
with Poly-HRP reagent for 30 min at RT. Diaminobenzidine hydrochloride (DAB)
(0.02%) containing 0.03% H2O2 was used as a chromogen to visualize peroxidase
activity. The preparations were lightly counterstained with hematoxylin, mounted with
Permount (Fisher Scientific, Pittsburgh, PA, USA), and examined by light microscopy.
The population index (PI) was defined as: less than 10% positive tumor cells, 0;
10-49% positive tumor cells, 1; more than 50% positive tumor cells, 2. The intensity
index (II) of the signal was designated as: none, 0; weak, 1; strong, 2. The labeling
score (LS) was the product of PI and II for each case. Samples were futher
categorized as: LS = 0, nil-expressing group; LS = 1 or 2, low-expressing group; and
LS = 4, high-expressing group. Tissue sections incubated with normal mouse IgG
(NMIgG) instead of primary antibody were used as negative controls. All
histopathological images were taken with an Olympus BX51 microscope and
DP2-BSW image acquisition software.
3. Cell lines
OSCC cells lines HSC-3, SAS, and Ca9-22 were purchased from Japanese
Collection of Research Bioresources Cell Bank and cell lines Cal 27 (OSCC) and
FaDu (pharyngeal squamous cell carcinoma) were purchased from American Type
Culture Collection. All cell lines were cultured in recommended media and were used
in less than 6 months after resucscitation. The authenticity of SAS and FaDu cell lines
was confirmed by STR profiling at Bioresource Collection and Research Center
(BCRC) (Hsinchu, Taiwan). Stable AEG-1 knock-down clones of SAS and FaDu cells
(SA to SE cells and FA to FE cells, respectively) were established through transfection
with lentiviral vectors carrying various AEG-1-specific shRNA sequences from the
National RNAi Core Facility of Academia Sinica. As controls, stable clones
transfected with scrambled shRNA were generated for each cell line (SCt cells and
FCt cells, respectively). Stable clones were selected by treatment of the cells with 2
μg/ml puromycin for 14 days. Knockdown efficiency was determined by measuring
mRNA and protein by real-time quantitative polymerase chain reaction (RT-QPCR)
and Western blot, respectively (Figure 3).
4. WST-1 assays
Cells were seeded in 96 well-plates at a concentration of 3 103 cells/well with
matched media. One day later,
4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate
(WST-1, Roche, Indianapolis, IN, USA) was added to every well at a concentration of
0.5 mg/ml, and the cells were incubated for 3 hr at 37°C. After incubation, the
absorbance of the reaction products at a wavelength of 440 nm was measured, and
considered as the absorbance for Day 0. The procedure was repeated each day for the
next four days (Day 1 to Day 4).
5. Colony formation assays
Cells were inoculated in 6 cm dishes (1 103 cells/dish) and kept at 37°C for 10
days. The colonies that formed were fixed with 4% paraformaldehyde for 5 min, and
then stained with 1% crystal violet for 20 min. Colonies larger than 1 mm in diameter
were counted and the total number recorded.
6. Migration assays and transwell Matrigel invasion assays
For the migration assay, SCt, SB, FCt and FB cells were added to each well with
culture-inserts (Ibidi, Martinsried, Germany) (1 104 cells/well) and incubated at
37°C with 5% CO2. Confluence was achieved 36 hr later. The inserts were then
removed, and the initial gaps were 500 μm wide. Serial photographs were taken at 4
hr intervals. For the invasion assay, Matrigel basement membrane matrix (BD
Biosciences, San Jose, CA, USA) was coated to the upper side of hanging cell culture
inserts (Millipore, Billerica, MA, USA) at a concentration of 2 mg/ml. Cells were
seeded into the coated hanging inserts (2 105 cells/insert) and incubated with the
corresponding culture media. The lower chamber of the invasion system was filled
with serum-free culture media. The cells and Matrigel on the upper side of the inserts
were removed after 24 hr. The migrated cells on the lower surface of the inserts were
fixed with methanol and counted after visualization with 10 fold diluted Giemsa stain.
In MMP inhibitor transwell assays, MMP inhibitor I (MMPInhI, Merck, Whitehouse
Station, NJ, USA) was incorporated into corresponding culture media at a
concentration of 2 μM in the hanging inserts and the diluted Matrigel. As for NF-κB
inhibition assay, 5 μM MG132 was supplemented within the corresponding culture
media in the hanging inserts and the diluted Matrigel for 24 hr.
7. Western blot analysis
Western blots were performed using standard protocols, as previously described
[74]. Total cell protein lysates of the indicated cell lines were loaded onto
polyacrylamide gels supplemented with SDS (40 μg/lane). The following primary
antibodies were used at the indicated concentrations: Lyric 4-7, 0.5 μg/ml; α-tubulin
(Sigma-Aldrich Corporation, St. Louis, MO, USA), 5000-fold dilution; and MMP1
(clone 36665, R&D system, Minneapolis, MN, USA), 1 μg/ml. Antibodies against the
following proteins were purchased from Cell Signaling Technology (Danvers, MA,
USA) and were used at a 1000-fold dilution: NF-κB (E498), phospho-NF-κB p65
(Ser536) (93H1), c-Jun (60A8), phospho-c-Jun (Ser63) (54B3), phospho-c-Jun (Ser73)
(#9164), pan-Akt (C67E7), phospho-Akt (Ser473) (D9E), phospho-Akt (Thr308)
(C31E5), phospho-GSK-3β (5B3), phospho-c-Raf, IκBα (L35A5), phospho-IκBα
(serine32) (14D4), and phospho-NF-κB p65 (Ser468) (#3039)
8. In vivo xenograft tumor assays
SCt, SB, FCt and FB cells were subcutaneously inoculated in pairs into the
flanks of 6-week-old NOD SCID mice (1 106 cells/mouse, n = 6 per group).
Laboratory animal husbandry and in vivo experiments were performed as per the
guidelines of the National Laboratory Animal Center. The diameter of the resulting
tumors were measured twice per week, and tumor volume was calculated as follows:
large diameter × (small diameter)2 × 0.52. Xenograft tumors were harvested at the end
point of the experiment and were sent for routine tissue processing.
9. In vivo pulmonary metastasis assay
SCt, SB, FCt and FB cells were intravenously injected into six-week-old NOD
SCID mice (2 105 cells/mouse, n = 10 per group) through the tail vein. All lung
lobes were harvested twelve weeks later. Routine tissue processing was subsequently
performed, and pulmonary metastatic foci were counted in sections stained with
H&E.
10. Microarray analysis
Total RNAs from SCt and SB cells were extracted with 1 ml TRI reagent
(Invitrogen, Carlsbad, CA, USA) and incubated for 5 min at RT. Two hundred
microliters of chloroform were added to the RNA, and the mixture was shaken
vigorously for 15 seconds before being incubated for 5-15 min at RT. The mixtures
were then subjected to centrifugation at 12,000 g for 10-15 min at 4°C. The aqueous
phase was transferred to a fresh tube and incubated with 500 μl isopropanol for 5-10
min at RT. After centrifugation at 12,000 g for 10 min at 4°C, the supernatants were
discarded and the RNA pellets washed with 1 ml 75% ethanol. The ethanol was then
removed and the RNA pellets dissolved in 20 μl H2O. RNA extracts from SCt and SB
cells were sent to the Microarray Core Facility of the Institute of Molecular Biology,
Academia Sinica. Reverse transcription with aa-dUTP labeling was performed, and
the associated RNA was subsequently degraded and removed. The resulting DNA
probes were coupled with Alexa/CyDye, washed and hybridized with an Agilent
human V2 GX array (44Kx4). The fluorescence of the array was scanned and
analyzed, and the raw data were uploaded into the GEO data base as GSE 44766.
Genes with a greater than 2.5 fold change (FC) in expression were then recorded.
11. Real-time quantitative polymerase chain reaction
Total RNA was extracted from SCt, SB, FCt and FB cells as described above.
Reverse transcription was performed using 4 μg aliquots of total RNA with
Super-Script III RNase H-reverse transcriptase (Invitrogen, Carlsbad, CA, USA) and
oligo (dT) primers (Fermentas, Glen Burnie, MD, USA), as per the manufacturer’s
instructions. RT-QPCR was performed using SYBR Green and the LightCycler480 II
System (Roche Applied Science, Indianapolis, IN, USA). The primers used were as
follows: AEG-1, GAAGAAGCAAGGTGAAGATAACT (forward) and
TTGGACGGGTTTTAGAGGTATT (reverse); MMP1,
CTGGAAGGGCAAGGACTCTA (forward) and CTTCCCAGCCTCTTGCTG
(reverse); E-Cadherin, GGAACTATGAAAAGTGGGCTTG (forward) and
AAATTGCCAGGCTCAATGAC (reverse); Snail, CTTCGGCTCCAGGAGAGTC
(forward) and TTCCCACTGTCCTCATCTGAC (reverse); Slug,
TGGTTGCTTCAAGGACACAT (forward) and GTTGCAGTGAGGGCAAGAA
(reverse); Twist, AAGGCATCACTATGGACTTTCTCT (forward) and
GCCAGTTTGATCCCAGTATTTT (reverse). The expression levels of each gene
were normalized to that of GAPDH in the same sample. Each reaction was performed
in triplicate.
12. Immunogold labeling and transmission electron microscopy
SAS cells were harvested (1 107 cells) and sent to the Electron Microscope
Core Facility of the Institute of Cellular and Organismic Biology, Academia Sinica,
for sample preparation and ultrathin sectioning. The sections were then washed with
Tris-buffered saline (TBS) for 15 min, and blocked with 1% BSA for 15 min. Primary
antibodies against AEG-1 (or NMIgG for negative controls) was applied at a
concentration of 0.5 μg/ml for 1 hour at RT. Sections were then washed four times
with TBS (5 min/wash), before being incubated with secondary anti-mouse IgG
conjugated to 18 nm gold particles for 1 hour at RT. After incubation, the sections
were thoroughly washed four times with TBS (5 min/wash) and five times with
ddH2O (5 min/wash). Next, the sections were treated with 5% uranyl acetate in H2O
for 10 min, and then with 0.5% lead citrate for 4 min before being completely air
dried. The sections were examined with a transmission electron microscope (Hitachi
H-7000).
13. Flow cytometry
SCt, SB, FCt, and FB cells were detached with 2 mM EDTA and washed with
PBS. The cells (1 × 105) were incubated with following antibodies: Lyric 4-7 or 4G2
at concentration of 0.37 μg/ml for 1 hr at 4°C. They were then probed with
PE-conjugated anti-mouse IgG (Jackson ImmunoResearch) for 30 min at 4°C. After
the final wash, the cells were re-suspended with 1% FBS in PBS and analyzed by
flow cytometry (BD, San Jose, CA).
14. Luciferase assay of the MMP1 promoter region
The full length promoter region of the MMP1 gene [75] was cloned from of SAS
cell genomic DNA using KAPA HiFi DNA polymerase with the following primers:
CCCCTCGAGAGATGTAAGAGCTGGGAAAGGACGG (forward) and
CCCAAGCTTTCAGTGCAAGGTAAGTGATGGCTTC (reverse). To generate a
truncated fragment without the NF-κB binding site, the following primers were used:
CCCCTCGAGCGATCTTCCATGAATACCTAACTGG (forward) and
CCCAAGCTTTCAGTGCAAGGTAAGTGATGGCTTC (reverse). The cloned full
length or truncated MMP1 promoters (nucleotides -2471 to +52) and luciferase
reporter vector pGL4 (Promega, Madison, WI, USA) were digested with Xho I and
HindIII. The full length or truncated promoter sequence was then ligated into pGL4
with T4 ligase at 16°C overnight. The resulting reporter vectors were designated as P1
(-4372 to +52) and P2 (-2471 to +52). Reporter vectors P3 (containing nucleotides
-2269 to +52) and P4 (containing nucleotides -521 to +52) were generated by
digesting the truncated MMP1 promoter either with SacI and HindIII or KpnI and
HindIII, respectively, before ligating it into pGL4. Cells (SCt, SB, FCt and FB) were
seeded onto 24-well plates (1 105 cells/well) and were incubated at 37°C for 24 hr.
The culture media was refreshed, and transfection with a reporter vector (one of P1 to
P4) together with pGL4 (400 ng) and control Renilla vector (100 ng) was performed
30 min later, using Genejet (SignaGen laboratories, Rockville, MD) as per the
manufacturer’s protocol. Firefly luciferase and Renilla readouts were acquired 18
hours post-transfection using the Dual-Glo Luciferase Assay System (Promega,
Madison, WI, USA) according to the manufacturer’s recommendations.
15. Chromatin immunoprecipitation (ChIP) assay
ChIP assay was performed with the Magna ChIP™ G kit (Millipore, Billerica,
MA, USA) in accordance with the manufacturer’s protocol. In brief, 1 107 cells
were fixed with 1% paraformaldehyde and were lysed with cell lysis buffer and
nuclear lysis buffer supplemented with protease cocktail inhibitors. Lysates were
sonicated to shear the crosslinked DNA to a size of 200-1000 base pairs. Equal
amounts of sheared cross-linked DNA were incubated at 4°C overnight on a shaker,
with protein G magnetic beads coupled to either Lyric 4-7, anti-p65 antibody (L8F6,
Cell Signaling, Danvers, MA, USA), anti-CREB binding protein (CBP) antibody
(D9B6, Cell Signaling, Danvers, MA, USA) or NMIgG (as a negative control). The
captured DNA-protein complexes were dissociated with elution buffer and proteinase
K at 62°C for 2 hours with shaking. The free DNA fragments were then purified and
quantified by RT-QPCR using primers (50 μM) flanking the p65 binding site (forward,
GAGTTACAAAATTAAAACGGCTGA and reverse, CTGGCTGCTCTGTGAAAG).
SYBR fluorescence was measured with a Lightcycler 480 II (Roche Applied Science,
Indianapolis, IN, USA).
16. Statistical analysis
The associations between clinicopathological parameters and the expression
status of AEG-1, phosphorylated p65, and MMP1 within clinical specimens were
analyzed by Fisher’s exact test. Disease-specific survival was compared between
groups by Kaplan-Meier culmulative survival analysis with log-rank tests. All in vitro
comparisons between HNSCC cells transfected with control shRNA and their
experimental counterparts were performed with 3 technical replicates and 3
independent biological replicates (n = 3). Data analyses of in vitro experiments were
performed by t-test. A p-value of less than 0.05 was considered statistically significant
for all tests.