Plasmids
The plasmid encoded ubiquitin was described previously [122]. The plasmids encoded HA-Elongin B, T7-Elongin C and HA-ROC2 were purchased from Addgene.
Elongin B and ROC2 were then cloned into pRK5-HA and pRK5-V5 vector respectively. Other plasmids used for the transient transfection were established in our lab previously by inserting Cul5, BIK, and ASB11 genes into pRK5 vectors with indicated tags.
The pLAS5w.Pneo-p53 and pLAS5w.Pneo-ASB11 plasmids were generated in our lab and were used to stable overexposes indicated genes in cultured cell lines by the lentiviruses system. The plasmid encoded p53 was a kindly gift from Dr. Shieh, Sheau-Yann and then the p53 gene was subcloned into the pLAS5w.Pneo vector. The pLAS5w.Pneo vector and shRNA-expressing constructs were obtained from National RNAi Core Facility, Taiwan. The Clone ID of shRNA-expressing construct are:
shASB11 : TRCN0000164096 shXBP1#2 : TRCN0000277990 shXBP1#3 : TRCN0000278051
Cell culture and transient transfection
293T, 293FT, and H1299 cells were cultured in Dulbecco’s modified Eagle Medium (DMEM) containing 10% fetal bovine serine (FBS) and 1% penicillin/
streptomycin (PS), whereas HCT116 cells were cultured in RPMI1640 Medium
containing 25mM HEPES, 10% fetal bovine serine (FBS) and 1% penicillin/
streptomycin (PS). All the cells were maintained in the 5% CO2, 37℃ humidified condition. 293T and 293FT were transfected by the calcium-phosphate method, whereas the transfection of HCT116 was performed by lipofectamine 3000 reagent that purchased from Thermo Fisher Scientific.
Lentivirus and infection
Lentiviruses were generated by transient transfection 293FT cells with packing plasmid (pCMVΔ8.91), envelope VSV-G plasmid (pMD.G) and shRNA clones or overexpression vectors. For a 10 cm2 dish, 14 µg pCMVΔ8.91 plasmid, 2 µg pMD.G plasmid, and 14 µg shRNA clones or overexpression vectors were used. 8 hours after transfection, the medium was refreshed with 6 ml culture medium. For 42~48 hours harvest, supernatants were filtered by 0.45 µm pore-size syringe filter. The virus-containing mediums were added into cells with 8 µg/ml polybrene. One day after infection, the mediums were refreshed with culture mediums. The selection of infected cells were applied 2 day after infection, by specific antibiotics.
Antibodies and reagents
Mouse anti-Flag (M2; Sigma), mouse anti-His (Santa Cruz), mouse anti-Tubulin (Millipore), mouse anti-Myc (invitrogen), mouse anti-HA (Sigma), goat anti-BIK (N-19; Santa Cruz), mouse anti-V5 (Millipore) and mouse anti-p53 (Santa Cruz) antibodies were purchased from commercial sources. The ASB11 antibodies was p r o v i d e s b y LT K B i o L a b o r a t o r i e s , a n d t h e s y n t h e t i c p e p t i d e (CTDYGANLKRRNAQGKSAL) was used as the antigen to generated antibodies.
The MG132 (Calbiochem), cycloheximide (Sigma), thapsigargin (Cayman Chemical), tunicamycin (Cayman Chemical), doxorubicin (Tocris Bioscience), cisplatin (Sigma), 5-fu (Sigma), etoposide (Sigma) were also purchased from commercial sources.
Cell lysates preparation
Cells were lysed by 1X RIPA buffer (150 mM NaCl, 20 mM Tris-HCl [pH 7.5], 0.1% SDS, 1% sodium deoxycholate and 1% NP40) with protease inhibitors (10 mg/ml aprotinin, 1 mM PMSF and 10 mg/ml leupeptin). Cell lysates were sonicated and centrifuged, the supernatants were subject to protein quantification by Bradford reagent (Bio-Rad, Hercules, CA).
Western blotting
Sample were prepared by mixed cell lysates with the sample buffer (10%
glycerol, 50 mM Tris-HCl [pH 6.8], 2% SDS, 0.01% bromophenol blue and 8% β-mercaptoethanol) and incubated at 95℃ for 5 min. Protein samples were resolved by SDS-PAGE according to standard protocol and transferred onto PVDF membranes. The membranes were blocked in the blocking buffer (Tris buffered Saline with 0.1%
Tween-20 and 3% skin milk) at room temperature for at least 30 min and then incubated overnight in the blocking solution with diluted primary antibodies, at 4℃. Next, the PVDF membranes were washed in 0.1% TBST (Tris buffered Saline with 0.1%
Tween-20) three times for 10 min each. PVDF were then incubated in the blocking solution with indicated HRP-conjugated-secondary antibodies for 1 hour at room
temperature. Finally, the membranes were washed in 0.1% TBST three times for 20 min each before the ECL (Amersham) detection.
Immunoprecipitation
The 293T cells was transfected with pRK5-Flag-ASB11 plasmid 2 day before harvesting. 18 hours after transfection, the medium was refreshed with 7 ml culture medium, and then the cell was treated with MG132 (1 µM/ml) 24 hours after transfection. Cell lysates were incubated with anti-ASB11 agarose beads (Sigma) in 1X RIPA buffer at 4℃ for 1.5 hr. The precipitates were washed with 1X RIPA for 4 times, then incubated in the sample buffer at 95 ℃ for 5 min. Finally, the precipitated proteins were detected by western blotting.
In vitro binding assay
Myc-ASB11 and 3XFlag-BIK proteins were generated by respectively transient transfecting 293T cells with the pRK5-Myc-ASB11 and pRK5-3XFlag-BIK plasmids 2 day before harvesting. 18 hours after transfection, the medium was refreshed with 7 ml culture medium, and then the cells were treated with MG132 (1 µM/ml) 24 hours after transfection. Myc-ASB11 proteins was immobilized by incubating cell lysates with anti-Myc agarose beads (Sigma) in 1X RIPA buffer at 4℃ for 1.5 hr. The M2 beads were washed with 1X RIPA for 7 times. 3XFlag-BIK proteins was purified by incubating cell lysates with anti-Flag agarose beads (Sigma) in 1X RIPA buffer at 4℃ for 1.5 hr. The Myc beads were washed with 1X RIPA for 7 times. The 3XFlag-BIK proteins were then eluted by incubated the beads in the elution buffer [50 mM Tris-HCl, pH 7.4, with 150 mM NaCl and 100 mg/ml 3XFLAG peptide (Sigma)] at 4℃ for 2 hr.
The immobilized Myc-ASB11 proteins were incubated in the 1X RIPA buffer with or without 3XFlag-BIK proteins at 4℃ for 1.5 hr, and then was washed with 1X RIPA for 7 times. Finally, the immobilized proteins were incubated in the sample buffer at 95 ℃ for 5 min and were detected by western blotting.
In vitro ubiquitination assay
The reconstituted ElonginBC-Cul5-ROC2-ASB11 E3 complex were generated by co-transfecting 293T cells with the plasmids encoded each subunit 2 day before harvesting. 18 hours after transfection, the medium was refreshed with 7 ml culture medium, and then the cells were treated with MG132 (1 µM/ml) 24 hours after transfection. The complex was isolated by incubating cell lysates with anti-Flag agarose beads (Sigma) in 1X RIPA buffer at 4℃ for 1.5 hr. The immobilized Myc-ASB11 protein was washed with 1X RIPA for 5 times. The 3XFlag-BIK proteins were generated by the same method as the in vitro binding assay. The assay was then be operated by incubated the reaction buffer (described previously [123]) with or without E1, E2, His-ubiquitin, reconstituted complex and 3XFlag-BIK proteins at 37℃ for 2 hr 45 min. The E1, E2, His-ubiquitin and other related reagents used in this in vitro ubiquitination assay were purchased from R&D Systems.
In vivo ubiquitination assay
The plasmids encode His-ubiquitin and BIK were co-transfected into the HCT116 cells 2 day before harvesting. 6 hours after transfection, the medium was refreshed with 7 ml culture medium, and then the cell was treated with MG132 (1 µM/
ml) 24 hours after transfection. Cell lysates were incubated with Ni-NTA sepharose beads (GE Healthcare Life Sciences) in 1X RIPA buffer at 4℃ for 1.5 hr. The
precipitates were washed with 1X RIPA for 4 times, then incubated in the sample buffer at 95 ℃ for 5 min. Finally, the precipitated proteins were detected by western blotting.
RNA extraction, reverse transcription, and real-time PCR
Total RNA of indicated cells were extracted by TRIZOL reagent (Invitrogene) through the standard protocol. The iScriptTM cDNA Synthesis Kit (Bio-Rad) was used to reverse transcript the total RNA into cDNA. The cDNA were then quantified by real-time PCR, using the Roche LightCycler 480 system. The primers used for real-real-time PCR are:
GAPDH: Forward : 5’ TGTTGCCATCAATGACCCCTT 3’
Reversed : 5’ CTCCACGACGTACTCAGCG 3’
ASB11: Forward : 5’ CCTGCTAACCGACTATGGAGC 3’
Reversed : 5’ TAGGAGGAATCGTTCGAGTGG 3’
XBP1 : Forward : 5’ CCCTCCAGAACATCTCCCCAT 3’
Reversed : 5’ ACATGACTGGGTCCAAGTTGT 3’
PI staining and flow cytometry
Harvested cells were fixed by methanol and incubated at 4℃ for at least one day. Fixed cells were washed with 1X PBS, and were stained by the propidium iodide.
Flow cytometry experiments were operated on the BD FACSCalibur, and the CellQuest Pro software were used for analysis.