Animals and ethics statement
This study was approved by the Institutional Animal Care and Use Committee (IACUC)
of Academia Sinica and was compliant with the Taiwan Ministry of Science and
Technology guidelines for ethical treatment of animals. Mice were housed and handled
under the guidelines of IACUC.
Embryonic mouse tissues isolation and RT-PCR
Rbm4a and Rbm4b knockout mice have been described (32). Embryonic mouse brain,
heart, muscle and pancreas were isolated at embryonic day (E) 13.5, 15.5 and 18.5. The
brain of Rbm4 knockout or wild-type embryos was isolated at embryonic day 13.5. Total
RNA was extracted by using TRIzol reagent (Thermo Fisher Scientific) following the
instructions. For reverse-transcription (RT), 2 μg of extracted RNA was treated with RQ1
DNase (Promega) and followed by using SuperScript III kit (Life Technologies). PCR
primer sets were listed in Supplemental Table S1.
Cell culture, neuronal differentiation and hypoxic induction
Human primary mesenchymal stem cells (MSCs) and derived line 3A6 cells have been
previously described (77). 3A6 cells immortalized by HPV16 E6E7 ectopically express
human telomerase reverse transcriptase to gain stem cell-like properties. Primary human
MSCs and 3A6 cells were maintained the Minimum Essential Media alpha ( MEM,
Gibco) and low-glucose Dulbecco’s Modified Eagle’s Medium (LG-DMEM, Gibco),
respectively. C2C12 myoblast, HeLa cells and HEK293T cells were cultured in DMEM
(Gibco) with the same supplement. All above mediums were supplemented with 10% fetal bovine serum (Gibco), 100 U/ml penicillin and 100 μg/ml streptomycin (Life
Technologies). All cells were cultured in 37°C humidified incubators with 5% CO2. For
neuronal differentiation, primary MSCs or 3A6 cells were seeded at a density of 4,000
cells/cm2 and induced by neuronal induction medium (NIM) containing DMEM without serum and supplement with 0.1 µM dexamethasone (Sigma), 50 μg/mL ascorbic acid-2
phosphate (Sigma), 50 μM indomethacin (Sigma), and 10 μg/mL insulin (Sigma) in the
next day (77). The medium was changed every three days. For hypoxic induction, 3A6
cells were incubated in 1% O2incubator or treated with 200 μM CoCl2 up to 24 hrs.
Immunoblotting and indirect immunofluorescence
Immunoblotting was performed using enhanced chemiluminescence system (Millipore) as
described (26). Primary antibodies used included polyclonal antibodies against RBM4
(31), a-Tubulin (NeoMarkers), FLAG tag (Sigma-Aldrich), Tuj1 (Biolegend), PTB
(Abcam) and HIF-1a (Proteintech). For indirect immunofluorescence, transfected cells
were induced in NIM for 0, 5 or 24 hrs and sequentially treated with 3% formaldehyde
(Merck) and 0.5% Triton X-100 (Sigma). The fluorescence staining was performed as
described (26). The image was observed by using Laser Scanning Microscope (LSM 700,
Zeiss).
Plasmid construction
The expression vectors of FLAG-tagged RBM4 and PTB were described previously (31).
To generate the expression vectors of FLAG-tagged PKM1, PKM2, I performed RT-PCR
using 3A6 cell total RNA with specific primers and cloned each cDNA into the pcDNA3.1
vector. To construct the mouse PKM minigene reporter, three genomic DNA fragments,
including one from exon 8 to the 5’ part of intron 8, one from 3’ part of intron 8 to 5’ part
of intron 10 and one from 3’ part of intron 10 to exon 11, were amplified and ligated and
the resulting DNA was cloned into pCH110 (GE Healthcare). The mutant PKM reporter
was generated by PCR-based mutagenesis. To construct the human PTB minigene, two
genomic DNA fragments, one from exon 8 to the 5’ part of intron 9 and the other from the
3’ part of intron 9 to exon 10, were amplified and ligated and the resulting DNA was
subcloned into pCH110. To construct the FLAG-PTB-1 and PTB-4 expression vectors,
RT-PCR was performed using 3A6 cell cDNA as template and one set of primers
(Supplemental Table S1). The corresponding cDNAs were each subcloned into a
FLAG-containing pCDNA3.1. The expression vector of HA-tagged HIF-1a was from Y.-S. Huang
(Academia Sinica, Taipei).
Transfection, in vivo splicing assay and cycloheximide treatment
C2C12 myoblast, HeLa cells and HEK293T cells were grown to 80% confluency in each 6
well plate and transfected by using Lipofectamine 2000 (Life Technologies). For 3A6
cells, 2×105 cells were seeded in 6 well plates and transfected using GenJet in vitro DNA transfection reagent (Version II) (SignaGen). In general, 0.5 μg of the reporter was
co-transfected with indicated amounts of the splicing effectors into HEK293 cells for 30 h.
Total RNA was isolated for RT-PCR analysis using specific primers (Supplemental Table
S1). To enhance the PCR signals, Southern blotting was performed using specific primers
(Supplemental Table S1, [31]). For cycloheximide (CHX) treatment, cells were
transfected with the RBM4 expression vector or empty vector for 30 hrs. The cells were
treated with or without CHX for 2 hrs before harvest. For knockdown specific gene
expression, 20 pmol of siRNA (Stealth siRNA, Invitrogen) were used to target luciferase
(siLuc) or RBM4 (siRBM4) (sense GCGUACGCCUUACACCAUGAGUUAU and
antisense AUAACUCAUGGUGUAAGGCGUACGC).
Cell metabolism assay
3A6 cells were transfected with a FLAG-protein (RBM4, PKM1 or PKM2) expression
vector or an empty vector for 30 h. For oxygen consumption rate (OCR) analysis, I
exploited the Seahorse system (Agilent Technologies). In brief, 1×104 transfected cells
were seeded in Seahorse XF 98 plates for 24 hrs and the medium was changed 1 hr before
analysis. Analysis was performed according to the manufacturer’s instruction. To gain a
complete mitochondrial profile, I used the Mito Stress Test kit (Agilent Technologies) and followed the instruction sequentially adding oligomycin (1 μM), FCCP (1 μM) and
Rotenone/Antimycin (0.5 μM).
RT-PCR and RT-qPCR assay
Reverse transcription-PCR was performed essentially as described previously (31).
Primers used are listed in Supplemental Table S1. To search for potential RBM4 targets
during neuronal differentiation of MSCs, I used Neurogenesis qPCR Array (PAHS-404Z,
QIAGEN). 3A6 cells were transfected with the FLAG-RBM4 or empty vector for 30 hrs.
Cells were re-seeded at a density of 4,000 cells/cm2 and cultured in NIM for 1 day. Total
RNA was extracted for analysis according to the manufacturer’s instruction.
RNP immunoprecipitation
The FLAG-RBM4 vector was transfected into 3A6 cells for 30 hrs. Cell lysates were
prepared and incubated with anti-FLAG M2 beads (Sigma) in the NET-2 buffer (50 mM
Tris-HCl, pH 7.4, 150 mM NaCl and 0.1% NP-40) at 4°C for 2 h. After extensive washing
with NET-2, RNA was extracted by using the TRIzol reagent. RT-PCR was performed
using primers in Supplementary Table S1.
Electrophoretic mobility shift assay (EMSA)
The CU-rich RNA probe contained a 61-nt fragment derived from the 3’ end of mouse
PKM intron 8 (i.e. 7 to 67 nt upstream of the 3’ splice site). The control contained a 45-nt
CU-poor sequence, 393 to 437 nt upstream of the 3’ splice site. The probe cDNAs were
each subcloned into pGEMT vector (Promega). The RNA probes were in vitro transcribed
from NotI-linearized plasmids by using T7 RNA polymerase (Promega). EMSA was
performed essentially as described (31). Recombinant maltose binding protein (MBP) and
MBP-RBM4 proteins were previously described (31). For RNA-protein interaction, 2.8 μg
(~55 pmol) of recombinant MBP-RBM4 was incubated with 5×104 cpm of 32P-labeled
probe (75 fmol for the CU-rich probe) at 30°C for 30 min. The reactions were analyzed by
electrophoresis on a 6% nondenaturing polyacrylamide gel as described (31).
Statistical analysis
The Student’s t-test was performed to evaluate significant difference between
experimental groups. Error bars in all graphs indicated standard errors of the mean. The
p-values <0.05 was considered statistically significant.
Reference
1. Dredge, B. K., Polydorides, A. D., and Damell, R. B. (2001) The splice of life:
alternative splicing and neurological disease. Nat Rev Neurosci 2, 43-50.
2. Matlin, A. J., Clark, F., and Smith, C. W. (2005) Understanding alternative splicing: towards a cellular code. Nat Rev Mol Cell Biol 6, 386-398.
3. Will, C. L., and Lührmann, R. (2011) Spliceosome structure and function.
Cold Spring Harb Perspect Biol 3, a003707.
4. Matera, A.G., and Wang, Z. (2014) A day in the life of the spliceosome. Nat.
Rev. Mol Cell Biol 15, 108-121.
5. Fu, X. D., and Ares, M. (2014) Context-dependent control of alternative splicing by RNA-binding proteins. Nat Rev Genet 15, 689-701.
6. Lee, Y., and Rio, D. C. (2015) Mechanisms and regulation of alternative pre-mRNA splicing. Annu Rev Biochem 84, 291-323.
7. Salomonis, N., Schlieve, C. R., Pereira, L., Wahlquist, C., Colas, A., Zambon, A. C., Vranizan, K., Spindler, M. J., Picoo, A. R., Cline, M. S., Clark, T. A., Williams, A., Blume, J. E., Samal, E., Mercola, M., Merrill, B. J., and Conklin, B. R. (2010) Alternative splicing regulates mouse embryonic stem cell
pluripotency and differentiation. Proc Natl Acad Sci U S A 107, 10514-10519.
8. Pritsker, M., Doniger, T. T., Kramer, L. C., Westcot, S. E., and Lemischka, I.
R. (2005) Diversification of stem cell molecular repertoire by alternative splicing.
Proc Natl Acad Sci U S A 102, 14290-14295.
9. Atlasi, Y., Mowla, S. J., Ziaee, S. A., Gokhale, P. J., and Andrews, P. W.
(2008) OCT4 spliced variants are differentially expressed in human pluripotent and nonpluripotent cells. Stem Cells 26, 3068-3074.
10. Yeo, G. W., Xu, X., Liang, T. Y., Muotri, A. R., Carson, C. T., Coufal, N. G., and Gage, F. H. (2007) Alternative splicing events identified in human embryonic stem cells and neural progenitors. PLoS Comput. Biol. 3, 1951-1967.
11. Chen, X., Xu, H., Yuan, P., Fang, F., Huss, M., Vega, V. B., Wong, E., Orlov, Y. L., Zhang, W., Jiang, J., Loh, Y. H., Yeo, H. C., Yeo, Z. X., Narang, V., Govindarajan, K. R., Leong, B., Shahab, A., Ruan, Y., Bourque, G., Sung, W.
K., Charke, N. D., Wei, C. L., and Ng, H. H. (2008) Integration of external signaling pathways with the core transcriptional network in embryonic stem cells.
Cell 133, 1106-1117.
12. Kim, J., Chu, J., Shen, X., Wang, J., and Orkin, S. H. (2008) An extended
transcriptional network for pluripotency of embryonic stem cells. Cell 132, 1049-1061.
13. Wang, B., Weidenfeld, J., Lu, M.M., Maika, S., Kuziel, W.A., Morrisey, E.E., and Tucker, P.W. (2004) Foxp1 regulates cardiac outflow tract, endocardial cushion morphogenesis and myocyte proliferation and maturation. Development 131, 4477-4487.
14. Gabut, M., Samavarchi-Teheani, P., Wang, X., Slobodeniuc, V., O’Hanlon, D., Sung, H. K., Alvarez, M., Talukder, S., Pan, Q., Mazzoni, E. O., Nedelec, S., Wichterie, H., Woltjen, K., Hughes, T. R., Zandstra, P. W., Nagy, A., Wrana, J.
L., and Blencowe, B. J. (2011) An alternative splicing switch regulates embryonic stem cell pluripotency and reprogramming. Cell 147, 132-146.
15. Revil T, Gaffney D, Dias C, Majewski J, and Jerome-Majewska, L. A. (2010) Alternative splicing is frequent during early embryonic development in mouse.
BMC Genomics 11, 399.
16. Barbosa-Morais, N. L., Irimia, M., Pan, Q., Xiong, H.Y., Gueroussov, S., Lee, L. J., Slobodeniuc, V., Kutter, C., Watt, S., Çolak, R., Kim, T.,
MisquittapAli, C. M., Wilson, M. D., Kim, P. M., Odom, D. T., Frey, B. J., and Blencowe, B. J. (2012) The evolu- tionary landscape of alternative splicing in vertebrate species. Science 338, 1587–1593.
17. Merkin, J., Russell, C., Chen, P., and Burge, C.B. (2012) Evolutionary dynamics of gene and isoform regulation in Mammalian tissues. Science 338, 1593–1599.
18. Rai, B., and Blencowe, B. J. (2015) Alternative Splicing in the Mammalian Nervous System: Recent Insights into Mechanisms and Functional Roles.
Neuron 87, 14-27.
19. Vuong, C. K., Black, D. L, and Zheng, S. (2016) The neurogenetics of alternative splicing. Nat Rev 17, 265-281.
20. Boutz, P. L., Stoilov, P., Li, Q., Lin, C. H., Chawla, G., Ostrow, K., Shiue, L., Ares, M. Jr., and Black, D. L. (2007) A post-transcriptional regulatory switch in polypyrimidine tract-binding proteins reprograms alternative splicing in
developing neurons. Genes Dev 21, 1636-1652.
21. Rai, B., O’Hanlon, D., Vessey, J. P., Pan, Q., Ray, D., Buckley, N. J., Miller, F. D. and Blencowe, B. J. (2011) Cross-regulation between an alternative splicing activator and a transcription repressor control neurogenesis. Mol Cell 43, 843-850.
Ares, M. Jr., Mody, I., and Black, D. L. (2011) The splicing regulator Rbfox1 (A2BP1) control neuronal excitation in the mammalian brain. Nat Genet 43, 706-711.
23. Gehman, L. T., Meera, P., Stoilov, P., Shiue, L., O’Brien, J. E., Meisier, M.
H., Ares, M. Jr., Otis, T. S., and Black, D. L. (2012) The splicing regulator Rbfox2 is required for both celebellar development and mature motor function.
Genes Dev 26, 445-460.
24. Jensen, K. B., Dredge, B. K., Stefani, G., Zhong, R., Buckanovich, R. J., Okano, H. J., Yang, Y. Y., and Darnell, R. B. (2000) Nova-1 regulates neuron-specific alternative splicing and is essential for neuronal viability. Neuron 25, 359-371.
25. Yano, M., Hayakawa-Yano, Y., Mele, A., and Darnell, R. B. (2010) Nova2 regulates neuronal migration through an RNA switch in disabled-1 signaling.
Neuron 66, 848-858.
26. Lai, M. C., Kuo, H. W., Chang, W. C., and Tarn, W. Y. (2003) A novel splicing regulator shares a nuclear import pathway with SR proteins. EMBO J 22, 1359-1369.
27. McNeil, G. P., Zhang, X., Genova, G., and Jackson, F. R. (1998) A molecular rhythm mediating circadian clock output in Drosophila. Neuron. 20, 297-303.
28. Lin, J. C., and Tarn, W. Y. (2005) Exon selection in alpha-tropomyosin mRNA is regulated by the antagonistic action of RBM4 and PTB. Mol Cell Biol 25, 10111-10121.
an intronic element and stimulates tau exon 10 inclusion. J Biol Chen 281, 24479-24488.
30. Markus, M. A., and Morris, B. J. (2009) RBM4: A multifunctional RNA-binding protein. Int J Biochem Cell Biol 41, 740-743.
31. Lin, J. C., and Tarn, W. Y. (2011) RBM4 down-regulates PTB and antagonizes its activity in muscle cell-specific alternative splicing. J Cell Biol 193, 509-520.
32. Lin, J. C., Yan, Y. T., Hsieh, W. K., Peng, P. J., Su, C. H., and Tarn, W. Y.
(2013) RBM4 promotes pancreas cell differentiation and insulin expression. Mol Cell Biol 33, 319-327.
33. Lin, J. C., Lu, Y. H., Liu, Y. R., and Lin, Y. J. (2016) RBM4a-regulated splicing cascade modulates the differentiation and metabolic activities of brown adipocytes.
Sci Rep doi:10.1038/srep20665.
34. Tarn, W. Y., Kuo, H. C., Yu, H. I., Liu, S. W., Tseng, C. T., Dhananjaya, D., Hung, K. Y., Tu, C. C., Chang, S. H., Huang, G. J., and Chiu, I. M. (2016) RBM4 promotes neuronal differentiation and neurite outgrowth via Numb isoform expression. Mol Biol Cell 27, 1676-1683.
35. Wang, Y., Chen, D., Qian, H., Tsai, Y. S., Shao, S., Liu, Q., Dominguez, D., and Wang, Z. (2014) The splicing factor RBM4 controls apoptosis, proliferation, and migration to suppress tumor progression. Cancer Cell 26, 374-389.
36. Jurica, M. S., Mesecar, A., Heath, P. J., Shi, W., Nowak, T., and Stoddard, B. L. (1998) The allosteric regulation of pyruvate kinase by fructose-1,6-bisphosphate. Structure 6, 195-210.
L- and R- type isoenzymes of rat pyruvate kinase are produced from a single gene by use of different promoters. J Biol Chem 143, 431-438.
38. Noguchi, T., Inoue, H., and Tanaka, T. (1986) The M1 and M2- type isoenzymes of rat pyruvate kinase are produced from the smae gene by alternative RNA splicing. J Biol Chem 261, 13807-13812.
39. El-Maghrabi, M. R., Claus, T. H., McGrane, M. M., and Pilkis, S. J. (1982) Influence of phosphorylation on the interaction of effectors with rat liver pyruvate kinase. J Biol Chem 257, 233-237.
40. Ashizawa, K., Willingham, M. C., Liang, C. M., and Cheng, S. Y. (1991) In vivo regulation of monomer-tetramer conversion of pyruvate kinase subtype M2 by glucose is mediated via fructose 1,6-bisphosphate. J Biol Chem 266, 16842-16846.
41. Christofk, H. R., Vander Heiden, M. G., Wu, N., Asara, J. M., and Cantley, L. C. (2008) Pyruvate kinase M2 is a phosphotyrosine-binding protein. 452, 181-186.
42. Christofk, H. R., Vander Heiden, M. G., Harris, M. H., Ramanathan, A., Gerszten, R. E., Wei, R., Fleming, M. D., Schreiber, S. L., and Cantley, L. C.
(2008) The M2 splice isoform of pyruvate kinase is important for cancer metabolism and tumour growth. Nature 452, 230-233.
43. Taniguchi, K., Ito, Y., Sugito, N., Kumazaki, M., Shinohara, H., Yamada, N., Nakagawa, Y., Sugiyama, T., Futamura, M., Otsuki, Y., Yoshida, K.,
Uchiyama, K., and Akao, Y. (2015) Organ-specific PTB1-asociated microRNAs
44. Clower, C. V., Chatterjee, D., Wang, Z., Cantley, L. C., Vander Heiden, M.
G., Krainer, A. R. (2010) The alternative splicing repressors hnRNP A1/A2 and PTB influence pyruvate kinase isoform expression and cell metabolism. Proc Natl Acad Sci USA 107, 1894-1899.
45. Alves-Filho, J. C., and Påisson-McDermott, E. M. (2016) Pyruvate Kinase M2: A Potential Target for Regulating Inflammation. Front Immunol
doi:10.3389/immu.2016.00145.
46. David, C. J., Chen, M., Assanah, M., Canoll, P., Manley, J. L. (2010) HnRNP proteins controlled by c-Myc deregulate pyruvate kinase mRNA splicing in cancer.
Nature 463, 364-368.
47. Rossi, D. J., Jamieson, C. H. M., and Weissman, I. L. (2008) Stems cells and the pathways to aging and cancer. Cell 132, 681-696.
48. Folmes, C. D. L., Dzeja, P. P., Nelson, T. J., and Terzic, A. (2012) Metabolic Plasticity in Stem Cell Homeostasis and Differentiation. Cell Stem Cell 11, 596-606.
49. Shyh-Chang, N., Daley, G. Q., and Cantley, L. C. (2013) Stem cell metabolism in tissue development and aging. Development 140, 2535-2547.
50. Hanna, J. H., Saha, K., and Jaenisch, R. (2010) Pluripotency and cellular reprogramming: Facts, hypotheses, unresolved issues. Cell 143, 508-525.
51. Zhang, J., Nuebel, E., Daley G. Q., Koehler, C. M., and Teitell, M. A. (2012) Metabolic regulation in pluripotent stem cells during reprogramming and self-renewal. Cell Stem Cell 11, 589-595.
metabolites in signle preimplantation embryos; a new means to study metabolic control in early embryos. J Embryo Exp Morphol 43, 29-46.
53. Brinster, R. L., and Troike, D. E. (1979) Requirements for blastocyst development in vitro. J Anim Sci 49, 26-34.
54. Johnson, M. T., Mahmood, S., Patel, M. S. (2003) Intermediary metabolism and energetics during murine early embryogenesis. J Biol Chem 278, 31457-31460.
55. Facucho-Oliveira, J. M., Alderson, J., Spikings, E. C., Egginton, S., and St John, J. C. (2007) Mitochondrial DNA replication during differentiation of murine embryonic stem cells. J Cell Sci 120, 4025-4034.
56. Chen, C. T., Shih, Y. R., Kuo, T. K., Lee, O. K., and Wei, Y. H. (2008)
Coordinated changes of mitochondrial biogenesis and antioxidant enzymes during osteogenic differentiation of human mesenchymal stem cells. Stem Cells 26, 960-968.
57. Takubo, K., Nagamatsu, G., Kobayashi, C. I., Nakamura-Ishizu, A., Kobayashi, H., Ikeda, E., Goda, N., Rahimi, Y., Johnson, R. S., Soga, T., Hirao, A., Suematsu, M., and Suda, T. (2013) Regulation of glycolysis by Pdk functions as a metabolic checkpoint for cell cycle quiescence in hematopoietic stem cells. Cell Stem Cell 12, 49-61.
58. Folmes, C. D., Nelson, T. J., Martinez-Fernandez, A., Arrell, D. K., Lindor, J.
Z., Dzeja, P. P., Ikeda, Y., Perez-Terzic, C., and Terzic, A. (2011) Somatic oxidative bioenergetics transitions into pluripotency-dependent glycolysis to
59. Mathieu, J., Zhou, W., Xing, Y., Sperber, H., Ferreccio, A., Agoston, Z., Kuppusamy, K. T., Moon, R. T., and Ruohola-Baker, H. (2014) Hypoxia-inducible factors have distinct and stage-specific roles during reprogramming of human cells to pluripotency. Cell Stem Cell 14, 592-605.
60. Hanover, J. A., Krause, M. W., and Love, D. C. (2012) Bittersweet memories:
linking metabolism to epigenetics through O-GlcNAcylation. Nat Rev Mol Cell Biol 13, 312-321.
61. Jang, H., Kim, T. W., Yoon, S., Choi, S. Y., Kang, T. W., Kim, S. Y., Kwon, Y.
W., Cho, E. J., and Youn, H. D. (2012) O-GlcNAc regulates pluirpotency and reprogramming by directly acting on core components of the pluripotency network. Cell Stem Cell 11, 62-74.
62. Shyh-Chang, N., Locasale, J. W., Lyssiotis, C. A., Zheng, Y., Teo, R. Y., Ratanasirintrawoot, S., Zhang, J., Onder, T., Unternaehrer, J. J., Zhu, H., Asara, J. M., Daley, G. Q., and Cantley, L. C. (2013) Influence of threonine metabolism on S-adenosylmethionine and histone methylation. Science 339, 222-226.
63. Homem, C. C.F., Steinmann, V., Burkard, T.R., Jais, A., Esterbauer, H., and Knoblich, A. (2014) Ecdysone and Mediator change energy metabolism to terminate proliferation in Drosophila neural stem cells. Cell 158, 874-888.
64. Lange, C., Garcia, M. T., Decimo, I., Bifari, F., Eelen, G., Quaegebeur, A., Boon, R., Zhao, H., Boeckx, B., Chang, J., Wu, C., Le Nobel, F., Lambrechts, D., Dewerhin, M., Kuo, C. J., Huttner, W. B., and Carmeliet, P. (2016) Relief of
hypoxia by angiogenesis promotes neural stem cell differetiation by targeting glycolysis. EMBO J 35, 924-941.
65. Bartesaghi, S., Graziano, V., Galavotti, S., Henriquez, N. V., Betts, J., Saxena, J., Deli, A., Karlsson, A., Martins, L. M., Capasso, M., Nicotera, P., Brandner, S., De Laurenzi, V., and Salomoni, P. (2015) Inhibition of
oxidative metabolism leads to p53 genetic inactivation and transformation in neural stem cells. PNAS 112, 1059-1064.
66. Kim, H., Jang, H., Kim, T. W., Kang, B. H., Lee, S. E., Jeon, Y. K., Chung, D.
H., Choi, J., Shin, J., Cho, E. J., and Youn, H. D. (2015) Core pluripotency factors directly regulate metabolism in embryonic stem cell to maintain pluripotency. Stem Cells 33, 2699-2711.
67. Bélanger, M., Allaman, I., and Magistretti, P.J. (2011) Brain energy metabolism: focus on astrocyte-neuron metabolic cooperation. Cell Metab 14, 724-738.
68. Friedenstein, A. J., Chailakhyan, R.K., Latsinik, N. V., Panasyuk, A. F., and Keiliss-Borok, I. V. (1974) Stromal cells responsible for transferring the
microenvironment of the hemopoietic tissues. Cloning in vitro and retransplantation in vivo. Transplantation 17, 331-340.
69. Caplan, A. I. (1991) Mesenchymal stem cells. J Orthop Res 9, 641-650.
70. Uccelli, A., Moretta, L., and Pistoia, V. (2008) Mesenchymal stem cells in health and disease. Nat Rev Immunol 8, 726-736.
71. Pittenger, M. F., Mackay, A. M., Beck, S. C., Jaiswai, R. K., Douglas, R.,
R. (1999) Multilineage potential of adult human mesenchymal stem cells.
Science 284, 143-147.
72. Kopen, G. G., Prockop, D. J., and Phinney, D. G. (1999) Marrow stromal cells migrate throughtout forebrain and cerebellum, and they differentiate into astrocytes after injection into neonatal mouse brains. Proc Natl Acad Sci USA 96, 10711-10716.
73. Joyce, N., Annett, G., Wirthlin, L., Olson, S., Bauer, G., and Nolta, J. A. (2010) Mesenchymal stem cells for the treatment of neurodegenerative disease. Regen Med 5, 933-946.
74. Wellen, K. E., Hatzivassiliou, G., Sachdeva, U.M., Bui, T.V., Cross, J. R., Thompson, C. B. (2009) ATP-citrate lyase links cellular metabolism to histone acetylation. Science 324, 1076-1080.
75. Pattappa, G., Heywood, H. K., deBruijn, J. D., Lee, D. A. (2011) The metabolism of human mesenchymal stem cells during proliferation and differentiation. J Cell Physiol 226, 2562-2570.
76. Chen, M., David, C. J., and Manley, J.L. (2012) Concentration-dependent control of pyruvate kinase M mutually exclusive splicing by hnRNP proteins. Nat Struct Mol Biol 19, 346-354.
77. Tsai, C. C., Chen, C. L., Liu, H. C., Lee, Y. T., Wang, H. W., Hou, L. T., and Hung, S.C. (2010) Overexpression of hTERT increases stem-like properties and decreases spontaneous differentiation in human mesenchymeal stem cell lines. J Biomed Sci doi:10.1186/1423-0127-17-64.
78. Agostini, M., Romeo, F., Inoue, S., Niklisin-Chirou, M. V., Elia, A. J., Dinsdale, D., Morone, N., Knight, R. A., Mak, T. W., and Melino, G. (2016) Metabolic regrogramming during neuronal differentiation. Cell Death Differ
doi:10.1038/cdd.2016.36.
79. Nakashima, K., Takizawa, T., Ochiai, W., Yanagisawa, M., Hisatsune, T., Nakafuku, M., Miyazono, K., Kishimoto, T., Kageyama, R., and Taga, T.
(2001) BMP2-mediated alteration in the developmental pathway of fetal mouse brain cells from neurogenesis to astrocytogenesis. Proc Natl Acad Sci U S A 8, 5868-5873.
80. Wang, Y., Yang, J., Li, H., Wang, X., Zhu, L., Fan, M., and Wang, X. (2013) Hypoxia promotes dopaminergic differentiation of mesenchymal stem cells and shows benefits for transplantation in a rat model of Parkinson’s disease. PLoS One doi:1371/journal.pone.0054296.
81. Jeon, E. S., Shin, J. H., Hwang, S. J., Moon, G. J., Bang, O. Y., and Kim, H. H.
(2014) Cobalt chloride induces neuronal differentiation of human mesenchymal stem cells through upregulation of microRNA-124a. Biochem Biophys Res Commun 444, 581-587.
82. Luo, W., Hu, H., Chang, R., Zhong, J., Knable, M., O’Meally, R., Cole, R. N., Pandey, A., and Semenza, G. L. (2011) Pyruvate kinase M2 is a PHD3-stimulated coactivator for hypoxia-inducible factor 1. Cell 145, 732-744.
83. Gueroussov, S., Gonatopoulos-Pournatzis, T., Irimia, M., Raj, B., Lin, Z. Y., Gingras, A. C., and Blencowe, B.J. (2015) An alternative splicing event amplifies
84. Lee, J., Kim, H. K., Han, Y.M., and Kim, J. (2008) Pyruvate kinase isozyme type M2 (PKM2) interacts and cooperates with Oct4 in regulating transcription.
Int J Biochem Cell Biol 40, 1043-1054.
85. Yang, W., Xia, Y., Hawke, D., Li, X., Liang, J., Xing, D., Aldape, K., Hunter, T., Alfred Yung, W. K., and Lu, Z. (2012) PKM2 phosphorylates histone H3 and promotes gene transcription and tumorigenesis. Cell 150, 685-696.
86. Zhang, Y., Chen, K., Sloan, S. A., Bennett, M. L., Scholze, A. R., O’Keeffe, S., Phatnani, H. P., Guarnieri, P., Caneda, C., Ruderisch, N., Deng, S., Liddelow, S. A., Zhang, C., Daneman, R., Maniatis, T., Barres, B. A., and Wu, J. Q. (2014) An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci 34, 11929-11947.
87. Mohyeldin, A., Garzón-Muvdi, T., and Quiñones-Hinojosa, A. (2010) Oxygen in stem cell biology: a critical component of the stem cell niche. Cell Stem Cell 7, 150-161.
88. Vieira, H. L., Alves, P. M., and Vercelli, A. (2011) Modulation of neuronal stem cell differentiation by hypoxia and reactive oxygen species. Prog Neurobiol 93, 444-455.
89. Pacary, E., Legros, H., Valable, S., Duchatelle, P., Lecocq, M., Petit, E., Nicole, O., and Bernaudin, M. (2006) Synergistic effect of CoCl(2) and ROCK inhibition on mesenchymal stem cell differentiation into neuron-like cells. J Cell Sci 199, 2667-2678.
90. Makeyev, E. V., Zhang, J., Carrasco, M. A., and Maniatis, T. (2007) The microRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing. Mol Cell 27, 435-448.
91. Lou, C. H., Shao, A., Shum, E. Y., Espinoza, J. L., Huang, L., Katam, R., and Wilkinson, M. F. (2014) Posttranscriptional control of the stem cell and
neurogenic programs by the nonsense-mediated RNA decay pathway. Cell Rep 6, 748-764.
Figure 1. Pkm isoform switched during mouse embryo development. (A) Schematic diagram of alternative splicing of the mouse Pkm gene. Arrows depict primers used in RT-PCR (Table 1). (B) Total RNA was extracted from indicated mouse tissues at indicated embryonic days and subjected to RT-PCR analysis using primers as depicted in panel A.
Representative lanes were spliced from original gels (Fig. 2B, C). The relative levels of Pkm1 vs. total Pkm transcripts (T) are shown below the gels; the average values and standard deviation were obtained from 2-3 sets of samples.
Figure 2. RBM4 significantly affects Pkm isoform switch in highly
energy-consuming tissues. (A) The RBM4 expression was analysis by immunoblotting from the embryonic brain lysates at indicated embryonic days. α-Tubulin was used as control.
energy-consuming tissues. (A) The RBM4 expression was analysis by immunoblotting from the embryonic brain lysates at indicated embryonic days. α-Tubulin was used as control.