Methods

1. Feeder-independent mESCs culture

The mouse embryonic stem (mES) cell line (ES-E14TG2a) which was derived from ATCC CRL-1821 was purchased from the Bioresource Collection and Research Center (Hsinchu, Taiwan). Cells were cultivated in ES medium containing GMEM (Sigma) supplemented with 0.05 mM β-mercaptoethanol (Sigma), 1 mM sodium pyruvate, 2 mM L-glutamine, 1x non-essential amino acids, 10% FBS and 500~1000 U/ml LIF. The culture plates were coated with 0.1% gelatin (Sigma) for at least 30 min before use. When cell growth reached 90%~95% confluency, cells were split using trypsin/EDTA (Sigma) and continuously cultivated in a 37°C incubator with a 5% CO2 atmosphere for mESCs maintenance.

2. Neurons differentiated from mESCs-EB formation

As mESCs grew to 85%~90% confluency, they were trypsinized and collected by centrifugation at 1000 rpm for 5 min. The pellets were

resuspended in embryonic bodies (EB) medium which contained ES medium but no LIF. Cells at 1 x 10⁶ were cultivated in 10-cm bacterial

dishes. mESCs gradually proliferated and aggregated to form spherical shapes called EBs. After 2 days of cultivation in bacterial dishes, EBs were collected by passing cells though a 40-μm nylon cell strainer (BD Falcon). Collected cells were placed in fresh EB medium and cultivated in a new bacterial dish. According to this procedure, the EB medium was changed every 2 days.

3. EB dissociation and neuronal differentiation

To undergo neuronal differentiation, the day mESCs were cultivated in EB medium in bacteria dishes was counted as day 0. On day 4, a final concentration of 5 µM all-trans retinoic acid (Sigma) was directly added to the EB medium. This medium was replaced with fresh medium on day 6. Two days later (i.e., day 8), the EBs were trypsinized and placed on poly-DL-ornithine/laminin-coated plates. Culture plates coated with poly-DL-ornithine/laminin were prepared by immersion in 10 μg/ml poly-DL-ornithine (Sigma) in a 37°C incubator overnight followed by three washes with sterile distilled water. Laminin 5 μg/ml was then added in a 37°C incubator for at least another 2 h before use. When using

poly-DL-ornithine, the stock was prepared as 10 μg/μl in borate buffer (150 mM, pH 8.3, stored at 4°C; Sigma) while the working concentration was 0.1 μg/μl diluted in sterile water. To dissociate EBs, the

trypsinization buffer was freshly prepared from 0.05% powdered trypsin and 0.02% EDTA (Sigma) dissolved in a phosphate-buffered saline (PBS) solution. When cells were processed, EBs were dissociated and seeded

onto poly-DL-ornithine/laminin-coated plates, and this moment was designated “time after plating”. First, EBs were collected on a cell strainer and washed once with PBS. After washing, residual PBS was removed to avoid diluting the trypsinization efficiency. Freshly made 0.05% trypsin and 0.02% EDTA were added to fully cover the EBs, and the mixture was incubated at 37°C for various times as indicated in the figure. At the indicated times, the EBs were immediately resuspended in EB medium to neutralize trypsinization and further transferred to a 15-ml Falcon tube (BD Falcon). The mixture was gently pipetted up and down to resuspend the EBs which now contained single cells as well as smaller EB aggregations. After centrifugation for 5 min at 1000 rpm at room temperature and aspirating out the supernatant, the pellet in the tube was resuspended in N2 medium and filtered though a 40-μm cell strainer. An optimal cell density of 1.35 x 10⁵/cm² was determined and seeded onto poly-DL-ornithine/laminin-coated plates. The medium was changed to fresh N2 medium at 2 and 24 h after plating. At 48 h after plating, one-half of the N2 medium was preserved, and the other half was changed to neural-basal-B27 medium. For the long-term culture of neuronal cells, it was necessary to change the neuro-basal-B27 medium every other day. Instead of withdrawing the entire culture medium, the medium was partially replaced with fresh neuro-basal-B27 solution when changing medium thereafter.

4. Primary cortical neurons cultured from mice

In the experiments using primary neurons as a positive control, cerebral cortexes were dissociated from BALB/c mice during postnatal day 2 (P2). The protocol was adopted from Brewer et al. (Brewer and Torricelli, 2007) with modifications. Briefly, about 85 mg of dissociated cortex tissue was maintained temporarily in cold Neurobasal A medium.

We transferred cell pieces to a tube for papain digestion by shaking for 20 min. The residues after gravity precipitation were incubated in fresh Neurobasal A medium followed by gentle pipetting for 45 sec, then set still for 2 min precipitation. This step of dissociating residues was

repeated three times, and each time the supernatants were collected into a new tube. The cells collected were carefully laid onto a prepared

OptiPrep (Sigma) gradient tube according to Brewer et al.’s method. The upper layers were aspired out after centrifuging at 2000 rpm for 15 min and the lower layers containing neuronal cells were removed to a new tube containing 5 ml fresh Neurobasal A medium. We cleaned up these neuronal cells two more times to get rid of gradient medium by adding fresh Neurobasal A medium and centrifuging at 1250 rpm for 5 min.

They were plated onto poly-D-lysine (Sigma) coated culture dishes at a density of 1.04x10⁵/cm². Afterward, the medium was changed every three days using Neurobasal A medium.

5. Immunocytochemistry of neuronal cells and neurite density analysis

Differentiated neurons were seeded on glass coverslips coated with poly-DL-ornithine/laminin. At a given time after differentiation, cells were washed with PBS, fixed in 4% paraformaldehyde (Sigma) prepared

in PBS for 30 min, and permeabilized in 0.3% Triton X100 (Sigma) in PBS for 10 min. The sample was further blocked in 1% bovine serum albumin made in PBS for 1 h at room temperature. A corresponding primary antibody was added for 2 h, followed by washing with PBS. A secondary antibody such as Alexa 488-conjugated anti-mouse, Alexa 488-conjugated anti-rabbit, or rhodamine-conjugated anti-mouse was incubated for 45 min followed by a PBS wash. Nuclei of cells were stained with 4’, 6’-diamidino-2-phenyindole (DAPI) (Sigma) for an additional 15 min, followed by another PBS wash. The coverslip was then mounted on a glass slide using Fluoromount G. Images were collected using a Leica SP2 confocal microscope connected to a CCD camera (Leica, Wetzlar, Germany) or using a Zeiss Axio Observer D1 microscope (Carl Zeiss, Jena, Germany). We defined density of neurites as neurite length divided by neuron number measured by Metamorph software or Image-Pro Plus software. The images were usually taken as three different fields in each experiment, which was repeated three to four times. Therefore, a total of around 9 to 10 images were captured. Each image typically contained more than 50 counted neurons, so a total of around 500 neurons were evaluated. Figures were prepared using Adobe software.

6. Cell lysates and immunoblot assay

Cells used for the immunoblot assays were processed as previously described (Lin et al., 2002). Briefly, one 3.5-cm dish of frozen cells was

scraped into 0.1 ml of lysis buffer (50 mM Tris base, pH 7.9, 50 mM NaCl, 0.1 mM EDTA, 20 mM β-glycerophosphate, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 25 nM calyculin A, 0.5% Triton X-100, 1 tablet/50 ml of protease inhibitor (Roche)). Lysates were centrifuged at 13,500 rpm for 10 min. Aliquots of the supernatants containing equal amounts of protein, measured by Bradford assay

(Bio-Rad, Hercules, CA, USA). For low-molecular-weight proteins such as 4E-BP1, cell lysates were prepared as described above and subjected to tricine sodium dodecylsulfate polyacrylamide gel electrophoresis

(SDS-PAGE) according to Schagger’s method (Schagger, 2006). Briefly, the separation gel contained an additional 0.1% glycerol in a regular format. The cathode buffer (0.1 M Tris, 0.1 M Tricine, and 0.1% SDS;

pH 8.25) and anode buffer (0.1 M Tris and 0.0225 M HCl; pH 8.9) were loaded onto a gel apparatus, separated, and transferred. Blots were

visualized using a horseradish peroxide (HRP)-conjugated secondary antibody followed by chemiluminescence, as recommended by the manufacturer (Thermo Scientific/Pierce, Rockford, IL, USA).

7. Immunoprecipitation

Cell lysates were prepared as abovementioned procedures. For immunoprecipataion, primary antibodies were conjugated to protein A/G agarose beads at 4°C. After 1 h of incubation, the conjugated antibodies with beads were cleaning up in lysis buffer for 3 times. Cell lysates were put into antibody pre-conjugated beads and shacked for 2 to 3 h at 4°C.

The immunoprecipitate complexes were washed by using lysis buffer for 3 times and by lysis buffer containing 0.5 M LiCl for 2 more times.

Before loading into gels, the samples were added sample buffer and heated at 95°C for 10 min.

8. Treatment of drugs/inhibitors on neurons

As using pharmaceutical approaches to study, the treatment of drugs is described as follows. After EBs dissociation for 2 h, isolated neuronal cells were begun to expose to various inhibitors. These inhibitors

included 1) 1 μM rapamycin, a mTORC1 inhibitor 2) 1 μM Wortmannin, a PI3K inhibitor 3) 10 μM z-VAD, a caspase inhibitor. All the drugs were dissolved in DMSO which was also presented in control group. When the medium was changed within 72 h or thereafter, medium always contains these drugs/inhibitors so as to keep the efficacy of reagents.

9. RNAi viral particles preparation

Bacterial clones or plasmids containing short hairpin RNA oligonucleotides of the target genes were obtained from the National RNAi Core Facility (Genomic Research Center, Academia Sinica, Taipei, Taiwan). Functional clones and corresponding effective target sequences of control, raptor, and rictor were verified and are listed as follows:

luciferase (control), 5’-CGCTGAGTACTTCGAAATGTC, raptor

sequence, 5’- CCTCATCGTCAAGTCCTTCAA, and rictor sequence, 5’-

GCCAGTAAGATGGGAATCATT. RNAi plasmids were co-transfected with two other viral packaging plasmids, pCMV8.91 and pMD.G, into HEK 293T cells. The virus-containing medium was collected after 40 h of transfection and concentrated by ultracentrifugation at 25,000 rpm for 2 h. Pellets were concentrated and stored at -80 °C until use. We followed a protocol provided by the RNAi Core Facility in Academia Sinica,

Taipei, Taiwan to measure the RNAi titer

(http://rnai.genmed.sinica.edu.tw/file/protocol/4_1_EstimationLentivirus TiterRIUV1.pdf). To test the virus titer, we also modified this protocol using primary culture of mice cortex neurons—a cellular model that is much more sensitive to virus infection—instead of using A549 cells.

10. Plasmids construction

To develop plasmids carried target genes for overexpression in neuronal cells, we modified the lentivirus packaged plasmid,

pLKO.1-puro. Briefly, we aligned the fragments of human

cytomegalovirus (CMV) promoter fused with GFP genes with ClaI on 5’-terminal and AgeI on 3’-terminal. This fragment was further fused with polyA sequences by using PCR. The whole fragment was replaced with the U6 promoter and hairpin region in pLKO.1-puro plasmid. We temporally named it pLMG. Based on this vector, we further constructed S6K1 WT/S6K T389E/4E-BP1 WT/4E-BP1 T3746E into this plasmid after GFP gene to get expression of GFP tagged fusion proteins.