Methods and Materials

2.2.1 DNA method

QIAprep spin miniprep kit (Qiagen Inc., catalog no. 27106) was used to extract plasmid DNA within colibacillus and the QIAprep gel extraction kit (Qiagen Inc., catalog no. 28706) was used to perform isolation and purification from gel. The protocols were provided by the manufacturer. Restriction enzyme digestion was performed for one hour. DNA ligation reaction was at 4°C for overnight with ligase.

2.2.2 Preparing Escherichia coli competent cell using calcium chloride

Escherichia coli DH5α was inoculated in 3 ml LB medium at 37ºC with

150 rpm shaking overnight. The 100 ml (1:100) of LB medium were added into the overnight culture and then incubated at 37ºC with shaking to OD

₆₀₀

of 0.4 to 0.6. The subsequent culture was placed onto the ice prior to transferring to sterile tubes, for centrifugation at a speed of 4,000 rpm at 4°C for 10 minutes.

The upper clear solution was then removed and 10 ml of ice-cold 0.1 M CaCl

₂

added to suspend the pellet. The cells were centrifuged with a speed of 4,000 rpm at 4°C and then the upper clear solution was removed. Next, 2 ml of ice-cold CaCl

2

solution added to suspend the pellet. The suspended cells were divided into 200 µl fraction each in eppendorff to be stored at -70°C for future use.

2.2.3 Escherichia coli transformation using calcium chloride prepared competent cells

Plasmid DNA was added into 200 µl of competent cell and the mixture kept on the ice for 30 minutes before placed at 42°C for 2 minutes. Next, one ml of rich medium (1.6% tryptone, 1% yeast extract, 0.5% NaCl) was added to the mixture that maintained on ice to chill, then incubated on a shaker at 37°C for one hour. After that, appropriate amount of the mixture was transferred and spread on LB agar plate that contains ampicillin. The plates were incubated at 37°C for overnight.

2.2.4 Construct the plasmids and strains of CaREP5 and CaREP6

Genetically engineered C. albicans strains used in this study are listed in Table 1. Primers used in this study are listed in Table 2, and plasmids used in this study are listed in Table 3.

2.2.4.1 pHC1: A region-pSFS2-SAT1 (CaREP5)

In this study, plasmid pSFS2 carrying the dominant nourseothricin resistance marker (SAT1) along with several unique restriction sites was used for construction and recombination (Reuss et al., 2004).

The C. albicans SC5314 genomic DNA was used as a template for PCR amplification of a 300 bp DNA fragment of CaREP5 using the primer HJL00840 (5'-ggtaccAGAAAGAGAGAGAGGGAACG-3') and HJL00841

restriction sites respectively at the 5' end. The amplified fragment starts 529 bp upstream to the predicted start codon of the CaREP5. The PCR product was cloned into pGEM-T Easy vector. After kpnI and XhoI digestion, the fragment was ligated to a binary vector (pSFS2-SAT) that had been digested with kpnI and

XhoI to create pHC1.

2.2.4.2 pHC2: A fragment-pSFS2-SAT1-B fragment (CaREP5)

The C. albicans SC5314 genomic DNA was used as a template for PCR amplification of a 444 bp DNA fragment of CaREP5 using the primer HJL00863 (5'-gcggccgcTTGAATTAATACGGTGATTC-3') and HJL00864 (5'-gagctcTTTATCTATTTGTTGCGGC-3'), containing

NotI

and

SacI

restriction sites respectively at the 5' end. The amplified fragment started 2359 bp downstream to 2802 bp of the CaREP5. The PCR product was cloned into pGEM-T Easy vector. After NotI and SacI digestion, the fragment was ligated with pHC1 to produce pHC2.

2.2.4.3 pHC3: A region-pSFS2-SAT1 (CaREP6)

The C. albicans SC5314 genomic DNA was used as a template for PCR amplification of a 525 bp DNA fragment of CaREP6 using the primer HJL00842 (5'-gggcccTATCATCACCACTACCTCC) and HJL00843 (5'-ctcgagAAGGAGAGGAAATGGAAGG), containing

ApaI

and

XhoI

restriction sites respectively at the 5' end. The amplified fragment started 528 bp upstream to the predicted start codon of the CaREP6. The PCR product was cloned into pGEM-T Easy vector. After ApaI and XhoI digestion, the

fragment was ligated to a binary vector (pSFS2-SAT) to create pHC3.

2.2.4.4 pHC4: A fragment-pSFS2-SAT1-B fragment (CaREP6)

The C. albicans SC5314 genomic DNA was used as a template for PCR amplification of a 556 bp DNA fragment of CaREP6 using the primer HJL00865 (5'-gcggccgcTTCCTTTCGTCCTCCAAC) and HJL00866 (5'-gagctcTTCTTTGGTTCTTCTCTTC), containing NotI and SacI restriction sites respectively at the 5' end. The amplified fragment started 1525 bp downstream to 2080 bp of the CaREP6. The PCR product was cloned into pGEM-T Easy vector. After NotI and SacI digestion, the fragment was ligated with pHC3 to produce pHC4.

2.2.5 Transformation of Candida albicans by electroporation

The protocol for yeast transformation by electroporation was modified from the previous report (Köhler et al., 1997). Candida albicans cells were grown overnight in YPD medium on a shaker at 30°C. The culture was diluted into fresh YPD medium in 1/10,000 ratio (OD

600

of 1.6 to 2.2) and incubated at 30°C with shaking. The cells were centrifuged at room temperature and re-suspended in 8 ml sterile water followed by adding 1 ml of 10X TE buffer and 1 ml of 1 M lithium acetate (pH=7.5). Then, 250 µl of 1 M DTT was added and the mixture shook at 30°C for 30 minutes followed by incubation at 30°C for 1 hour. The cells were then mixed with 40 ml of sterile water before centrifugation. The pellet was washed once with 25 ml sterile water, and 5 ml

re-suspended in 50 µl of 1 M sorbitol and kept on ice.

Transformation mixtures contained about 1 µg of the linear DNA and 40 µl of competent cells. The Elektroporator Gene pulser II (Bio-Rad) was set at 25 µF, 1.8 kV and 200 Ω, then electroporation was carried out in a chilled 0.2 cm electroporation cuvette.

The transformation mixture was added with 1 ml of 1 M sorbitol immediately before the re-suspension of the cells in 1 ml YPD medium. The suspension was transferred to a 15 ml centrifuge tube and incubated at 30°C for 1 hour with shaking. The cells were spread on YPD plates containing 100 µg/ml of nourseothricin and incubated at 30°C for 1 day to be selected for the nourseothricin-resistant cells. The resistant colonies were picked and inoculated in YP with 2% maltose liquid medium to pop-out the SAT1-cassette.

2.2.6 Replica-plating

The SAT1 flipper excised transformants were plated on YPD plates at several dilutions in order to obtain about 100 colonies on each plate to be used as the master plate. Cells were replica-plated onto new YPD plates containing 100 µg/ml of nourseothricin. The colonies which were nourseothricin sensitive colonies were identified by their inability to grow on the YPD/nourseothricin plates and rescued from the primary plate for analyses.

2.2.7 Morphology test of CaREP5 and CaREP6 mutants with germ tube analysis

The different strains were inoculated by aseptic toothpicks into Brain Heart

Infusion medium (Difco) that contains 10% fetal bovine serum (JRH BIOSCIENCES, Australia). The cells were incubated at 37ºC for 2 to 4 hours and then the states of germ tube formations were observed under microscope.

2.2.8 White-opaque switching assay of CaREP5

The mating type-like a (MTLa) and α strains were isolated on YEPS (yeast extract-peptone plus 2% sorbose) plates. The strains were streaked on 2%

Bacto-agar containing the nutrient components of the defined medium of Lee et al. (Lee et al., 1975), and colonies were resuspended into Lee’s liquid medium.

5×10

⁸

cells were resuspended into 50 ml double-distilled water then transferred to Petri dish for UV treatment with 124 Jm

^-2

. Each Lee’s media plate plus 5 µg/ml phloxine B with 34 µg/ml chloramphenicol, and contained a density between 500 and 1000 colonies roughly. Plates were incubated at room temperature for at least 7 days. The procedurd of integration refer to literature from Huang et al., Zordan et al., and srikantha et al (Huang et al., 2006; Zordan et al., 2006; and srikantha et al., 2006), and Morrow et al. demonstrated that UV irradiation induces white-opaque switching in C. albicans WO-1 (Morrow et al., 1989).

2.2.9 Quantitative analysis of the CaREP5 and CaREP6 mRNA level by real-time PCR (real-timepolymerase chain reaction)

The first day, strains were grown in centrifuge tube containing 3 ml SD (0.67% Difco-yeast nitrogen base w/o amino acid with 2% dextrose) medium at

fresh SD medium at 30°C overnight and the cells were diluted in 250 ml flask containing 50 ml fresh SD to OD

600

of 0.2. After 5 hours at 30°C with shaking incubation, 22 ml culture were transferred into new flask containing final miconazole concentration of 100 ug/ml dissolved in DMSO or without miconazole but equal amount of DMSO added as controls. The cells were harvested 1 hour after incubated at 30°C with shaking.

Total RNAs were isolated by QIAGEN RNeasy Mini Kit (catalog no.

74106) and Baseline-ZERO

^TM

DNase (catalog no. DB0711K). The modified procedures is as follows: the cell pellet was loosened thoroughly by flicking the tube, then adding 600 µl buffer RLT (containing β-mercaptoethanol), and vortexing to resuspend the cell pellet. The acid-washed glass beads (~300 µl) were added to the sample. The cells were disrupted through FastPrep®-24 (4.5 M/s, 30 seconds 4 times, cooling intervals 30 seconds). The lysate (usually 350 µl) was then transferred to a new microcentrifuge tube and centrifuged for 2 minutes at full speed. The supernatant was then transferred to a new microcentrifuge tube. One volume of 70% ethanol was added to the homogenized lysate, and the mixture was mixed well by pipetting (do not centrifuge). The sample (usually 700 µl) was transferred to an RNeasy spin column placed in a 2 ml collection tube. After centrifugation for 15 seconds at

≧8000 g, the flow-through was discarded. 700 µl buffer RW1 was added to the RNeasy spin column. The column was centrifuged for 15 seconds at

8000 g to wash the

≧ spin column membrane. 500 µl buffer RPE was added to the RNeasy spin column. The column was centrifuged for 15 seconds at

8000 g to wash the spin column membrane.

≧ Another 500 µl buffer RPE was

added to the RNeasy spin column. The column was centrifuged for 2 minutes

at ≧8000 g to wash the spin column membrane. The RNeasy spin column was placed in a new 2 ml collection tube and centrifuged at full speed for 1 minute.

The RNeasy spin column was placed in a new 1.5 ml collection tube and 30 µl RNase-free water was added directly to the spin column membrane. After incubation for 10 minutes, the column was centrifuged for 1 minute at ≧8000 g to elute the RNA. 30 µl RNase-free water was added to elute the RNA again.

6.5 µl of 10X Baseline-ZERO

^TM

DNase reaction buffer and 2 µl (2 MBU) of Baseline-ZERO

^TM

DNase were added to the sample and the mixture was incubated at 37°C for 60 minutes. 200 µl RNase-free water was added to the RNA sample. The mixture was kept on ice. One volume (200 µl) of 4 M LiCl-buffer (in DEPC water) and the mixture was set for at least 1 hour at -20°C before centrifugation at max speed for 30 minutes at 4°C. The pellet was washed twice with 70% ethanol and air dried. The pellet was dissolved in 30 to 35 µl of RNase-free water.

Reverse transcription was carried out by the ImProm-II

^TM

reverse transcription system (Promega, catalog no. A3800) according to the technical manual of manufacturer. The primer pairs used were as follows: for CaACT1, HJL00693 (5'-AGTGCTGAAAGAGAAATTGT-3') and HJL00694

(5'-AGCAGCTTCCAAACCTA-3'); for

CaCDR1,

HJL00315

(5'-GTGCTGAACGTGAATATGT-3') and HJL00316

(5'-CTCTCTGTTACCCTTTGG-3'); for

CaCDR2,

HJL00395

(5'-GTTTACACATCAACTATGGGAC-3') and HJL00396

(5'-GCAGCTTCGGTATAAGG-3'); for

CaCPH1,

HJL00538

(5'-GCTACCACCTTGACCG-3') and HJL00539

(5'-GCATAACTTCCTGCCTGA-3'); for

CaEFG1,

HJL00540

(5'-TGGATTTGGGAGAAGATTATG-3'); for

CaNDT80,

HJL00319

(5'-AGAGTTGCCTGACCAC-3') and HJL00320

(5'-ATCTGCAAGTCCTCGT-3'); for

CaREP5,

HJL00586

(5'-gAACAACTgTCgggAAT) and HJL00587

(5'-CagTgTgAgTgATACTACCT-3');

CaREP6,

HJL00588

(5'-gCAAcggTACTTACTgT-3') and HJL00589

(5'-gATgAgCAACCACTTgT-3');

CaSNF3,

HJL00338

(5'-ACATTCAGCAACGTATCG-3') and HJL00339

(5'-TGTTCCACCACCACTT-3'). The mRNA levels of sample genes were measured by real-time PCR using Rotor-Gene RG-3000 amplification system (Corbett Research) with CAS-1200 robotic liquid handling system (Corbett Research), which allows amplification and measuring the binding of the FastStart Universal SYBR Green Master (ROX) (Roche, catalog no. 04 913 850 001) to double-stranded DNA. The condition for real-time PCR was:

denaturation (120 seconds at 95°C), 35 cycles of repeated amplification (20 seconds at 95°C, 20 seconds at 65°C and 20 seconds at 72°C) and detected amplicon’s fluorescence signal at 80°C. The expressions of CaACT1 and

CaSNF3 were used to normalize the mRNA expression levels of target geness.

2.3 Results

2.3.1 Construction and confirmation of the heterozygous CaREP5 null mutant

The 2358 bp genomic DNA sequence of CaREP5 is obtained from The

Candida Genome Database, which provides the sequence of assembly

contig19-10215 of C. albicans. The C. albicans SC5314 genomic DNA was used as a template for PCR amplification using the primers HJL00840 and HJL00841, and the amplified fragment contained the sequence of CaREP5 from -529 to -230. After KpnI and XhoI digestion, the 300 bp fragment was ligated to pSFS2 to create pHC1. A fragment containing the sequence of CaREP5 from +2360 to +2803 was PCR amplified by primers HJL00863 and HJL00864 from SC5314 genomic DNA. After NotI and SacI digestion, the 444 bp fragment was ligated to pHC1 to create pHC2. The KpnI-SacI DNA fragment containing the constructed A and B fragments in pSFS2 was integrated into the wild type SC5314 strain to generate CaREP5/Carep5 (Fig. 26) transformants YLO00324 and YLO00325. Using YLO00324 and YLO00325 as template,

yeast colony PCR with primers HJL00814

(5'-CTCAACATGGAACGATCTAGC-3') and HJL00881

(5'-CCTATCTTTATCTTTCTATCT-3') generated a 1034 bp fragment due to the integration by SAT1 cassette. The HJL00840 and HJL00881 primers generated an 861 bp fragments that pop-out the SAT1 cassette already (Fig. 26).

2.3.2 Construction and confirmation of the homozygous CaREP5 null mutant

Homozygous knock-out mutants of C. albicans SC5314 strains were obtained after two rounds of insertion and excision of the SAT1 cassette. The

KpnI-SacI DNA fragment containing the SAT1 flipper cassette of pHC2 was

integrated into the CaREP5 heterozygous mutant strain to generate

Carep5/Carep5 (Fig. 27) transformants YLO00326 and YLO00327. In

contrast, using the HJL00934 (5'-CATCAAGAATCCAAGGTCG) and HJL00935 (5'- GGTGTTGTTGTTGTTGTTG) primer set in PCR with the wild type chromosome as templates produced a 693 bp DNA fragment, whereas the mutated chromosomes did not generate any product. The strains of both heterozygous and homozygous null mutants were confirmed by southern blot analysis (Fig. 28) that the procedure was as same as above-mentioned in 1.2.3 (Page 16).

2.3.3 Construction and confirmation of the Carep5/Carep5::CaREP5 rescued strains

The pHC2 was digested with KpnI and XhoI to excise the 5' fragment of

CaREP5, and then ligated with the fragment containing the sequence of

CaREP5 from -529 to +2804 which was amplified by primer HJL00840 (KpnI)

and HJL00959 (XhoI) (5'-CTCGAGCATTTATCTATTTGTTGCGGC) from wild type strain SC5314 genomic DNA to generate pHC5. The pHC5 digested with

KpnI-SacI was integrated into the Carep5/Carep5 mutants (YLO00326 and

YLO00327) to create the Carep5/Carep5::CaREP5 (Fig. 29) rescued strains

YLO00352 and YLO00353. Using the HJL00943 (5'-

ACAACAAGAACAAAGAAGCC) and HJL00947 (5'-

GCTGTTGATGATGATTCTGT) primer set, the rescued strains produced a 1794 bp DNA fragment, and the HJL01071 (5'- CTTCAACACCAACCACTTC) and HJL 00881 primer set generated a product of 1969 bp.

2.3.4 Germ tube test results of CaREP5 mutants

To analyze the effect of mutations on morphogenesis, the germ tube analysis was performed on the Carep5 mutant. It appeared that the germ tube formation was normal in the Carep5 mutant with no defect on hyphal formation in the presence of serum. The phenotype of Carep5/Carep5 mutant or the

Carep5/Carep5::CaREP5 rescued strain did not have significant difference

compared with the wild type strain (Fig. 30).

2.3.5 Agar dilution assay results of CaREP5 mutants

The agar dilution procedure was as same as above-mentioned in 1.2.7 (Page 21) and performed to examine antifungal susceptibility on SD or YPD plates. The natures of these compounds are as Table 4. All tested strains including wild type strain (SC5314), CaREP5/Carep5-1 (YLO00324),

Carep5/Carep5-1 (YLO00326), Carep5/Carep5::CaREP5-1 (YLO00352),

CaREP5/Carep5-2

(YLO00325),

Carep5/Carep5-2

(YLO00327),

Carep5/Carep5::CaREP5-2 (YLO00353) showed the same level of

susceptibility to drugs indicated that the CaREP5 is not involved in drug

Carep5 mutant was not sensitive to bile salts and common detergents (Fig. 32).

2.3.6 White-opaque switching assay of CaREP5

The tested strains including the SC5314 α, SC5314 a, CaREP5/Carep5 α,

CaREP5/Carep5 a, Carep5/Carep5::CaREP5 α, Carep5/Carep5::CaREP5 a

have not significant switch. The Carep5/Carep5 α and Carep5/Carep5 a strains have not significant blocked opaque formation (Fig. 33).

2.3.7 Comparison of the genes expression level of Carep5/Carep5 mutants by real-time PCR

The expression levels of CaACT1 and CaSNF3 used as loading control genes were not significantly induced by the treatment of 100 µg/ml miconazole.

There is no CaREP5 mRNA could be detected in Carep5/Carep5 at real-time PCR result (Fig. 34). The results of real-time PCR showed that the expression levels of CaCDR1, CaCDR2, CaNDT80, CaCPH1 and CaEFG1 were not significantly by different in the cells treated with or without 100 µg/ml miconazole (Fig. 35, 36, 37, 38 and 39).

2.3.8 Construction and confirmation of the heterozygous CaREP6 null mutant

The 1524 bp sequence of CaREP6 is obtained from The Candida Genome Database, which provides the sequence of assembly contig19-10205 of C.

albicans. The C. albicans SC5314 genomic DNA was used as a template for

PCR amplification using the primers HJL00842 (ApaI) and HJL00843 (XhoI), and the amplified fragment contained the sequence of CaREP6 from -528 to -4.

After ApaI and XhoI digestion, the 525 bp fragment was ligated to pSFS2 to create pHC3. A fragment contains the sequence of CaREP6 from +1526 to +2081 and was amplified by primers HJL00865 (NotI) and HJL00866 (SacI) from wild type strain SC5314 genomic DNA. After NotI and SacI digestion, the 556 bp fragment was ligated to pHC3 to create pHC4. The ApaI-SacI DNA fragment containing the SAT1 flipper cassette of pHC4 was integrated into the wild type SC5314 strain to generate CaREP6/Carep6 (Fig. 40) transformants YLO00348 and YLO00349. The HJL00814 and HJL00882 (5'-CGCAGAACAAAGAGAAGGA) primers generated a 1215 bp fragment in PCR due to the integration by SAT1 cassette (Fig. 40). The HJL00866 and HJL00944 (5'-TGCTGAATCAACACAATATC) primers generated a 1308 bp fragments due to the pop-out of the SAT1 cassette already (Fig. 40).

2.3.9 Construction and confirmation of the homozygous CaREP6 null mutant

The ApaI-SacI DNA fragment containing the SAT1 flipper cassette of pHC4 was integrated into the CaREP6 heterozygous mutant strain to generate

Carep6/Carep6 (Fig. 41) transformants YLO00350 and YLO00351. In

contrast, using the HJL00936 (5'-TCATCATCATAGCCGTCAC) and HJL00937 (5'-CCGTTTGTGTGGAGATTC) primer set in PCR, the wild type chromosome produced an 814 bp DNA fragment, whereas the mutated chromosomes did not generate any product. Furthermore, the results of southern blot analysis

2.3.10 Germ tube test results of CaREP6 mutants

The germ tube formation was normal on the Carep6 mutant and did not cause defect on hyphal formation in the presence of serum. The phenotype of

Carep6/Carep6 mutant did not have significant difference to that of the wild

type SC5314 strain (Fig. 43).

2.3.11 Agar dilution assay results of CaREP6 mutants

The agar dilution was performed to examine antifungal susceptibility on SD or YPD plates, and the natures of these compounds are as Table 4. Four tested strains including the wild type strain (SC5314), CaREP6/Carep6-1 (YLO00348), Carep6/Carep6-1 (YLO00350), CaREP6/Carep6-2 (YLO00349),

Carep6/Carep6-2 (YLO00351) had the same result indicated that the CaREP6 is

not involved in drug resistance (Fig. 44) in the tested conditions. The results also indicated that the Carep6 mutant was not sensitive to bile salts and common detergents (Fig. 45).

2.3.12 Comparison of the genes expression level of Carep6/Carep6 mutants by real-time PCR

The expression levels of CaACT1 and CaSNF3 used as loading control genes were not significantly induced by the treatment of 100 µg/ml miconazole.

There is no CaREP6 mRNA could be detected in Carep6/Carep6 at real-time PCR result (Fig. 46). The results of real-time PCR showed that the expression levels of CaCDR1, CaCDR2, CaNDT80, CaCPH1 and CaEFG1 were not

significantly by different in the cells treated with or without 100 µg/ml miconazole (Fig. 35, 36, 37, 38 and 39).

2.4 Discussion

Previous studies in the lab indicated that CaRep5p and CaRep6p can increase the β-galactosidase activity of CDR1

_YM990348

promoter-lacZ in S.

cerevisiae in the presence of miconazole. However, the results in this study

showed the germ tube formation and filamentous growth of the Carep5/Carep5 and Carep6/Carep6 mutants were similar to the wild-type. A possible reason is that the experiment condition of germ tube analysis was not suitable to induce germ tube formation and/or filament growth.

Deletion of CaREP5 and CaREP6 have no effect on the antifungal and chemical susceptibility, and the mRNA expression profiles of CaCDR1,

CaCDR2, CaNDT80, CaCPH1 and CaEFG1 were not change significantly

following miconazole treatment. The results did not meet the anticipation.

One reason is that previous experiments were conducted with the CDR1p-lacZ in S. cerevisiae but not in C.albicans. Or, there is no direct relation between

CaREP5/CaREP6 and drug susceptibility. The regulation needs the

involvement of other genes.

Deletion of CaREP5 failed to show defects in white-opaque switch. This is unexpected. In the literature, many studies have showed that CaREP5 is a regulator of white-opaque switching and is opaque-specific (Huang et al., 2006;

Sirkantha et al., 2006 and Zordan et al., 2006). According to these literatures about orf19.4884, WO-1 is the common strain used in white-opaque switching assays. WO-1 is MTLα genotype that high-frequency switching between white and opaque phenotypes (Slutsky et al., 1987; Lockhart et al., 2002). But in this study, SC5314 used as the strain to implement gene deletion and a/a and α/α strains construction. In addition, the condition of white-opaque switching

experiment may be inappropriate, and the reconfirmation or adjustment is necessary.

2.5 Future Work

In this study, the understanding of the relationship between

CaREP5/CaREP6 with CaCDR1 and drug susceptibility is the key point.

However, the result of agar dilution and real-time PCR showed CaREP5 and

CaREP6 unaffected drug susceptibility, CaREP5 and CaREP6 mutants also not

affect the morphogenesis. The function of CaREP5 and CaREP6 unable to understood by these results.

Later, the confirmation of the relationship between CaREP5/CaREP6 with morphology is appropriate to investigate the experiment condition of germ tube growing. In the more recent studies suggest that CaREP5 is required for establish and maintain the opaque cell，but CaREP6 is expressed in the white cell (Tsong et al., 2003). The new experiment should be designed for the role of CaREP5 and CaRep6 in mechanisms of white-opaque switch, and the experiment condition may need to be reset. CaREP5/CaREP6 of Parental strain SC5314 can compare with parental strain WO-1 in white-opaque switching assay. The biological significance and relationship to CaREP5 and

CaREP6 is not clear, CaREP5 and CaREP6 interactive with other genes may

investigated by microarray or quantitative PCR further. Furthermore, implementing the selection in C. albicans system for finding out the gene which can regulate CDR1 in C. albicans anew.

Reference

AB Biodisk. Etest for antifungal susceptibility testing of yeast. 1998. AB Biodisk, Solna, Sweden.

Albertyn, J., Hohmann, S., Thevelein, J.M., and Prior, B.A. GPD1, which encodes glycerol-3-phosphate dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high-osmolarity glycerol response pathway. Mol. Cell. Biol. 1994. 14(6):

4135-4144.

Argimón, S., Wishart, J.A., Leng, R., Macaskill, S., Mavor, A., Alexandris, T., Nicholls, S., Knight, A.W., Enjalbert, B., Walmsley, R., Odds, F.C., Gow, N.A.R., and Brown, A.J.P. Developmental regulation of an adhesin gene during cellular morphogenesis in the fungal pathogen Candida albicans. Eukaryot. Cell.

2007. 6: 682-692.

Argüelles, J.C., Rodriguez, T., and Alvarez-Peral, F.J. Trehalose hydrolysis is not required for human serum-induced dimorphic transition in Candida albicans:

evidence from a tps1/tps1 mutant deficient in trehalose synthesis. Res. Microbiol.

evidence from a tps1/tps1 mutant deficient in trehalose synthesis. Res. Microbiol.

在文檔中 探討剔除CaENO1、CaREP5及CaREP6對白色念珠菌之影響 (頁 59-179)