• 沒有找到結果。

evidences, it is significantly confirmed that kisspeptin/KISS1R system administrate the

17

key role on the pubertal onset and reproductive capacity (Pinilla et al., 2012).

Because these above data demonstrated the decrease concentration of gonadotropins

(FSH and LH) by abnormality of kisspeptins or/and its receptor in patients and

experimental animal models, scientists suggested that there might be a physiological

relevance of kisspeptin/KISS1R system in the regulation of HPG axis and a variety of

studies continuously documented the ability of kisspeptins to potently elicit gonadotropin

secretion. Being inspired by the hypothesis that kisspeptin/KISS1R system governing the

HPG axis, a number of groups evaluated the ability of kisspeptin to elicit LH release in

various species, such as rat (Gutierrez-Pascual et al., 2007), bovine (Ezzat et al., 2010)

and porcine (Suzuki et al., 2008), and then suggested a direct stimulation of pituitary LH

secretion by kisspeptin.

However, this affirmation of direct kisspeptin action at the pituitary level was later

denied by the study on hpg mice which is severely deficient in GnRH secretion and unable

to respond to kisspeptin stimulation for LH secretion (Gill et al., 2010). In other words,

kisspeptin-induced LH release must be arranged by hypothalamic GnRH. Besides, several

expression data from immunofluorescence indicated that there is a direct connection

between Kisspeptin neurons and GnRH neurons in mouse hypothalamus, majorly in the

medial preoptic area (POA) region (Clarkson and Herbison, 2006; Kinoshita et al., 2005).

Although kisspeptin neurons are mostly expressed in the anteroventral periventricular

18

nucleus (AVPV) region and the arcuate (ARC) nucleus of the hypothalamus, it seems like

that kisspeptin fibres could extend into POA and median eminence (ME) region to give

the signal to GnRH neurons (Clarkson et al., 2008; Herbison, 2008). Not only expression

studies but electrophysiological experiments within GnRH neuron also supported the

physiologic relevance of kisspeptin signaling in the control of gonadotropin secretion

(Han et al., 2005; Zhang et al., 2007). Therefore, those further proofs have substantiated

that the dominant site of action of kisspeptins in the regulation of the gonadotropic axis

is located at hypothalamic GnRH neurons (Roa et al., 2009).

All in all, the above set of data have solidly confirmed that initiating the pubertal

onset by increasing GnRH secretion is one of the physiological role of kisspeptin/KISS1R

system in reproduction.

In spite of abundant data focusing on functions of cerebral kisspeptins, compelling

evidences obtained in different species implies additional regulatory effects of kisspeptins

at other levels of the reproductive system. Since 2001, it has been known that Kiss1 and

Kiss1r gene are expressed in variant tissues (Kotani et al., 2001; Muir et al., 2001; Ohtaki

et al., 2001). Because the presence of Kiss1 and Kiss1r gene is also discovered in the

testis and the ovary, peripheral or local actions of kisspeptin and KISS1R in the gonad might be considered as responsible for cooperating individual’s reproduction with the

central control.

19

In terms of the ovary, Castellano et al. (2006) demonstrated that ovarian KiSS-1

levels increase during the pubertal transition and fluctuated in a cyclic-dependent manner

with a peak at the proestrus, i.e. preceding ovulation while Gpr54 mRNA levels remained

rather low and stable across the ovarian cycle. Besides, by immunohistochemistry, both

kisspeptin-IR and KISS1R-IR were observed in theca layers of growing follicles, corpora

lutea, and interstitial gland. They also found that gonadotropin priming enhanced levels

of Kiss1 mRNA which is previously negligible in immature ovaries. Gaytan et al. (2009)

further confirmed the observations of kisspeptin and KISS1R expression in the ovary of

human and monkey and also suggested that gonadotropin-induced ovarian Kiss1 mRNA

levels was inhibited by the inhibition of prostaglandin synthesis. Nevertheless, human

with impaired KISS1R signaling can still ovulate if properly primed with gonadotropins

(Pallais et al., 2006) while ovulation linked to the absence of KISS1R cannot be fully

rescued by gonadotropin replacement in mouse (Gaytan et al., 2014). Because of those

inconsistent observations, the indispensability of locally produced Kisspeptins in the

control of ovulation is still doubtful so far.

It contrast to the ovary, there is much less data on the potential local expression or

actions of kisspeptins in the testis. Based on the observations of established Kiss1‒/‒ and

Kiss1r‒/‒ mutant mouse model (d'Anglemont de Tassigny et al., 2007; Kauffman et al.,

2007b; Mei et al., 2011; Seminara et al., 2003), scientists noted that mutant male mice of

20

either genotype have failed reproductive capability with lower testicular weights and

reduced serum testosterone levels compared to wild-type. In addition, spermatogenesis is

severely impaired with spermatogenic arrest at the meiotic-division stage (primary

spermatocytes were expressed but few haploid spermatids were shown), resulting in the

absence of spermatozoa in the seminiferous tubules and epididymides. However, there

are some mutant mice presenting complete spermatogenesis and producing few

spermatozoa though they also have those abnormal phenotypes of male reproductive

system (Lapatto et al., 2007).

Recently, two studies in human and mouse spermatozoa sequentially demonstrated

the specific sites where kisspeptins and KISS1R exist in and the regulation of

kisspeptin/KISS1R system on the fertilization ability of sperm. Pinto et al. (2012) first

indicated both Kisspeptin IR and KISS1R IR were presented in post-acrosomal region of

the mature sperm head and also localized around the sperm neck while Kisspeptin IR is

particularly intense in the equatorial segment. Moreover, this group also investigated

calcium concentration in sperms and calcium-regulated sperm function, like motility,

hyperactivation and the acrosome reaction under the addition of kisspeptin. According to

the data, they suggested that kisspeptin, binding with KISS1R, could induce intracellular

calcium-signal transduction to modulate sperm moltility and hyperactivation but not

acrosome reaction.

21

Later, our previous data further showed extensive data related to expression profiles

and functions of kisspeptin and KISS1R in the mouse reproductive tissues (Hsu et al.,

2014). In contrast to the immunodetective results from described data (Pinto et al., 2012),

we found that only KISS1R is expressed in mouse mature spermatozoa, specifically on

the acrosome, and kisspeptin is localized in the interstitial testicular compartment and

epididymis instead. While focusing on female reproductive tissues, Kisspeptin but no KISS1R immunoreactivity was detected specifically in follicles, corpora lutea, and

interstitial glands, the results which are consistent with previous demonstration

(Castellano et al., 2006). In the test of fertilization capacity, we also confirmed the

regulation of kisspeptin on sperm capacitation, though acrosome reaction is not include,

by treating noncapacitated and capacitated sperm with p234. Combining those line of data,

we suggested that kisspeptin coming from the epididymis and oviduct regulates the

fertilization capacities of spermatozoa during capacitation in reproductive tract.

Overall, it seems like that kisspeptin/KISS1R system acts not only on central

neuronendocrine system but also on gonad locally to integrate the reproduction and

fertility.

2.2.3 Kisspeptin signaling via KISS1R

Since the fact that kisspeptins constitute natural agonists of KISS1R was found in

2001, the functions and signaling pathways regulated by kisspeptin/KISS1R system has

22

been investigated widely in several cell models, such as CHO-K1, HEK203, and

B16-BL6. At first scientists found an increasing calcium concentration in KISS1R-transfected cells after cells were treated with kisspeptin, but these increase didn’t disappear under the

treatment of pertussis toxin which blocks the activity of Gi protein. More, intracellular

cAMP were not modulated by Kisspeptin in cells transiently expressing KISS1R. Those

data suggested that KISS1R is a Gq-coupled receptor without the connection to Gs and/or

Gi proteins. Also, PLC–PKC and MAPK pathways which often activated by G

protein-coupled receptors were also disclosed by using specific inhibitors in kisspeptin-treated

cells (Kotani et al., 2001; Muir et al., 2001; Ohtaki et al., 2001).

Because the function on GnRH secretion was discovered later, many researches used

GnRH neurons as the model and revealed that intracellular calcium increased by

kisspeptin via KISS1R also regulated multiple ion channels [such as potassium channel,

transient receptor potential cation (TRPC) channel and so on] to depolarized the GnRH

neuron and induce GnRH release (Liu et al., 2008; Zhang et al., 2008).

In summary, the binding of kisspeptin and KISS1R activates phospholipase C (PLC),

then subsequently converts phosphatidylinositol bisphosphate (PIP2) into inositol

1,4,5-trisphosphate (IP3), which induces the mobilization of Ca2+ from intracellular reservoirs.

The increase of intracellular Ca2+ may results in phosphorylation of MAPK by

diacylglycerol (DAG) and protein kinase C (PKC) activation to regulate many cell

23

functions (like anti-metastasis and proliferation) or changes in ion channel permeability

thus causing depolarization responses (Fig. 1).

Fig. 1. Kisspeptin via GPR54 signaling at a glance. Schematic presentation of the major signaling pathways recruited upon GPR54 activation by kisspeptins.

Fig. 1. Kisspeptin via GPR54 signaling at a glance.

24

3. Materials and Methods

3.1 Synthetic peptides

KISS1R peptides (H-NASDDPGSAPRPLD-C) were synthesized from Kelowna

International Scientific Inc. (Taipei, Taiwan). For immunogens, KISS1R peptides were

conjugated with Keyhole limpet hemocyanin (KLH).

3.2 Preparation of antibodies

Modified immunization protocols were demonstrated previously (Narat, 2003), two

ISA Brown hens (40-week-old) were immunized by intramuscular injection at multiple

sites on breast. Primary immunization was performed with 400 μg of KISS1R

peptides-KLH in 0.5 mL of saline and equal volume of Freund’s complete adjuvant (Sigma-Aldrich, USA) for each hen. Total three boosters with 300 μg of KISS1R peptides-KLH in 0.5 mL

of saline and equal volume of Freund’s incomplete adjuvant were performed. The first

two boosters were performed at 1-week-intervals and the third booster was performed 4

weeks after the second one. The health status of hens was monitored daily and their blood

were taken weekly or laid eggs were collected daily. All of the samples were stored at

-20 or 4°C until further processing.

3.3 Purification of egg yolk antibody

IgY was purified by the polyethylene glycol (PEG) precipitation method as

previously described (Atha and Ingham, 1981). In order to analyze the average quality

25

of antibody along the weeks after immunization, eggs laid weekly (about 5-7 eggs)

from each hen were pooled prior to IgY extraction. Because IgY in the serum is

selectively transferred to the yolk, we only retained egg yolk. After recording total

volume of weekly yolk, the yolk was mixed with double yolk volume of PBS. Then,

3.5 % PEG 6000 (Sigma-Aldrich, USA) of the total volume (yolk + PBS) was added,

followed by 10 min mixing on a rolling mixer. The tubes were centrifuged at 13,000g

and 4°C for 20 min. After centrifugation, the supernatant was passed through a folded

filter and transferred to a new tube. 8.5 % PEG 6000 in gram (calculation based on the

new volume) were added into the tube. The tube was rolled on a rolling mixer and

centrifuged as above mentioned. The pellet was dissolved in 1 mL PBS by means of a

glass stick and the vortex. PBS was added to a final volume of 10 mL. The solution

was mixed with 12 % PEG 6000 (w/v, 1.2 gram), followed by rolling and

centrifugation again. The pellet was carefully dissolved in 2 mL PBS buffer and the

solution was dialyzed for 24 hr in PBS. Thereafter, the IgY-extract was taken out from

the dialysis bag (Membrane Filtration Products, INC., USA) and stored at -20°C until

further processing. The protein content (mg/mL) of the samples was measured by

PierceTM BCA protein assay kit (Thermo Fisher Scientific Inc., USA) and the quality

of the antibody was analyzed by simple SDS-PAGE.

26

3.4 Enzyme-linked immunosorbent assay (ELSIA)

The titers of chicken IgY anti-KISS1R production and its avidity were evaluated by

an indirect ELISA. Briefly, high affinity microtiter plates (Costar Corning Inc., USA)

were coated with KISS1R peptide (10 mg/mL) in coating buffer (35 mM NaHCO3, 15

mM Na2CO3, pH 9.6) and incubated overnight at 4°C. Plates were washed twice with

washing buffer (6.1 mM Na2HPO4 · 2H2O, 3.9 mM NaH2PO4 · H2O, 0.1% Tween-20, pH

7.0) and blocked with blocking buffer (0.25% gelatin, 0.15 M NaCl, 0.05 M Tris-base, 6

mM EDTA, 0.05% Tween-20, pH 8.0) overnight at 4°C. Antibodies (100 mg/mL) in

weekly serum or yolk extract were diluted 1:10,000 in assay buffer, added to the wells in

duplicate and incubated for 1 hr at room temperature. After washing, plates were

incubated with peroxidase-conjugated goat anti-chicken IgY antibody (Abcam plc,

Cambridge, UK), diluted 1:20,000 in assay buffer, for 1 hr at room temperature. The color

was revealed by adding 3.7 mM o-phneylenediamine in 0.03% H2O2 within 5 min, and

the color presenting reaction was stopped by addition of 8 N H2SO4. The optical density

(OD) was determined at 490 nm with the ELISA reader (Dynatech, Dnkendort, Germany).

3.5 Animals and tissues collection

ICR mice were purchased from National Taiwan University, maintained under a

12-h lig12-ht cycle and given c12-how diet and water ad libitum. All procedures conformed to t12-he

National Institutes of Health Guide for the care and use of laboratory animals. Testes used

27

for RNA extraction and Immunohistochemistry were obtained from male mice aged 0, 1,

2, 3, 4, 6, 8 and 12 weeks postpartum (wpp). Brain slices of the hypothalamus, testes,

epididymis, kidney, liver, and heart used for protein extraction were obtained from male

mice aged 8 wpp. For analyzing the specific site, the brain was positioned on the brain

blocker with the plane of section of the mouse brain and cut sagitally into 2-mm thick

slices containing the hypothalamus area. Also, brain slices and ovaries collected from

8-week-old female mice were used as the positive control in immunohistochemical staining.

Female mice were pretreated with 10 IU pregnant mares’ serum gonadotropin (PMSG;

Sigma–Aldrich) for 48 hr to maintain their estrous cycle during a preovulatory stage

before sacrifice and tissue collection.

3.6 Primary Mouse Leydig cell culture

Mice up to the age of 12 weeks were sacrificed by decapitation. Testes were

immediately collected and put into isolation buffer (10 mg collagenase and 10 mg BSA

in HBSS buffer). Buffer was renewed once for removing red blood cells and tissue debris.

Then, testes in isolation buffer were incubated at room temperature for 5 min. After

separating the seminiferous tubules by filtration through sterile stainless steel net with

nylon mesh, the filtrate was centrifuged at 300g for 5 min at room temperature. The

dissociated cells were resuspended in 15 mL Medium 199 (M-199) and incubated in at

37°C with 5% CO2.

28

In order to identify Leydig cells, 3β-HSD staining was carried out by a modification

of the method described previously (Payne et al., 1980). 2 x 105 cells were seeded on

6-well plate 24 hr before staining. Cells were allowed to dry on 6-well for 15 min at 37°C.

After drying was complete, cells were covered with staining solution (1% BSA, 1.5 mM β-NAD, 0.25 mM NBT, 0.2 mM DHEA, 80% PBS) for 8 hr. Then, cells were rinsed in

PBS, and fixed in 4% paraformaldehyde in PBS. Cells were observed at 400X

magnification for the presence of blue-purple formazan granules.

Before treatment, cells were counted and seeded (2 x 105) with M-199 FBS on

6-well plate for 24 hr. Then, Cells were treated with ovine luteinizing hormone (oLH) and

RP-cAMPS (Enzo Life Science, Inc., NY, USA), a PKA inhibitor, in serum-free medium

for additional 24 hr. Later, we extracted RNA from cells of each treatment for cDNA

synthesis and real-time PCR analysis.

3.7 Cell line culture

We used MA-10 mouse Leydig tumor cells as cell model to confirm the expression

of KISS1R on Leydig cell’s membrane by Immunohistochemistry and investigate the

mechanism of LH-dependent Kiss1 gene expression by real-time PCR. Cells were

maintained in DMEM/F-12 medium supplemented with 10% FBS, 2.2 mg/mL NaHCO3,

100U/mL penicillin and 0.1 mg/mL streptomycin under the condition of 37°C and 5%

CO2. For conducting the experiment, MA-10 cells were plated at 2 x 105 cells/well and

29

allowed to adhere for 24 hr. Then, we treated the cells with or without oLH and

RP-cAMPS in the following 24 hr. After the treatment, total RNA was extracted from cells

for gene analysis.

3.8 Immunohistochemistry

Formalin-fixed mouse tissues were embedded in paraffin, sectioned into 5-mm thick

slies, and adhered to poly-L-lysine-coated slides. Tissue sections were deparaffined in

xylene and rehydrated through descending concentrations of ethanol, washed with H2O,

then immersed in 10 mM citrate buffer (pH 6.0) with 0.05% Tween-20, and finally heated

twice in a microwave for 10 min at 750 W with the 5 min interval. The sections was

removed and allowed to cool by a brief wash in tap water and then in PBS. After

quenching endogenous peroxidase activity with 1% (v/v) H2O2 in methanol for 30 min, the sections were rinsed three times with PBS for 5 min each. Nonspecific binding sites

were blocked with goat serum in PBS [3% (v/v) normal goat serum and 0.2% (v/v) Triton

X-100 in PBS] for 1 hr. A commercial rabbit polyclonal antibody raised against mouse

kisspeptin 145 (1:100 dilution; Abcam) was used to visualize Kisspeptin. For KISS1R,

we used our own chicken-anti mouse KISS1R antibody described above at a dilution of

1 : 5,000. This antibody specificity had been validated by showing gradually obscure

bands when antibodies were pre-incubated with grading concentrations of antigen in

absorption test. Negative controls for antibodies were established using blocking buffer

30

alone. After 2 hr (KISS1R) or 20 hr (kisspeptin) of incubation at 4°C, antibodies were

revealed with a biotinylated secondary antibody directed against rabbit immunoglobulin

G (for kisspeptin) or chicken immunoglobulin G and Y (for KISS1R) for 1 hr. Slides were

washed three times with PBS for 5 min each at room temperature and incubated with an

avidin–biotin–HRP complex in the Vectastain Universal ELITE ABC kit (Vector

Laboratories, Burlington, ON, Canada) for 30 min according to the manufacturer’s

instructions. After rinsing again, slides were incubated for 10–20 min at room temperature

with diaminobenzidine to visualize immunostaining. Finally, slides were rinsed with

distilled water twice for 10 min each, counterstained with hematoxylin for 30 s and

hydrated with ethanol and xylene before adding mounting medium (Hecht-Assistent;

Sondheim, Germany). Sections were observed using optical microscope (Axioskop 40,

Carl Zeiss, Göttingen, Germany), and images were collected using an AxioCam ERc 5s

(Carl Zeiss) digital camera.

3.9 Western Blot

The tissues or cells were rinsed once with cold PBS and collected. They were ground

with a mechanical homogenizer in cold lysis buffer [150 nM NaCl, 0.1% Triton-X 100,

50 mM Tris-HCl (pH 8.0), protease inhibitor, phosphatase inhibitor]. Protein

concentrations were determined by using the PierceTM BCA protein assay kit according

to the manufactures instructions. Samples containing 30–60 μg protein were separated by

31

15% SDS–PAGE. The separated proteins were transferred onto a PVDF membrane. The

membrane was blocked by immersing in PBS containing 0.01% Tween 20 (PBST) and

2.5% BSA for 8 hr at room temperature, followed by incubation with our own

chicken-anti mouse KISS1R chicken-antibody (1:200,000 dilution or a serial diluted concentrations) in

PBST with 0.5% BSA for 18 hr at room temperature. Then, the membrane was washed

three times with PBST and incubated for 2 hr with peroxidase-conjugated goat anti-rabbit

IgG (1:25,000 dilution; Jackson ImmunoResearch Laboratory, PA, USA) or goat

anti-chicken IgY. The membrane was washed with PBST and bound antibodies were

visualized by the ECL system (Merck Millipore). The images were presented on Kodak

X-OMAT film (Eastman Kodak Co.).

3.10 RNA extraction and cDNA synthesis

Total RNA was extracted from tissues or cells with TRIsure reagent (Bioline Inc., USA) according to the manufacturer’s instructions. We used PrimeScript™ RT reagent

Kit (Takara Bio Inc., Japan) to synthesize cDNA. Total RNA (500 ng) was mixed with 25

pM oligo(dT) primer, 50 pM random hexamers, enzyme mix and reaction buffer, then

incubated at 37°C for 15 min. The reverse transcriptase was inactivated by heating to

85°C for 5 s, and cDNA products were stored at 4°C for further analysis.

3.11 Quantitative real-time PCR

Relative levels of target mRNA was examined with the StepOne Real-Time PCR

32

System (Applied Biosystems, CA, USA) according to the manufacturer’s instructions.

Transcripts were quantified using the Fast SYBR Green Master Mix (Applied Biosystems)

in a total volume of 10 μL. Samples were heated for 10 min at 95°C, followed by 40

cycles of 15 s at 95°C, 30 s at 60°C and 30 s at 72°C. Then, melting curve analysis was

conducted to observe the appearance of non-target products which may affect the final

data. The primer sequences are shown in table 2.

3.12 Statistical analysis

Each experiment was replicated at least three times. Data were expressed as mean ±

SD. Data were analyzed by Student’s t-test or one-way ANOVA followed by Duncan’s

method with Sigma Plot Software (Systat Software, CA, USA); p < 0.05 indicated significance.

33

Table 2. Primers used for quantitative real-time PCR in this study.

Table 2. Primers used for quantitative real-time PCR in this study TranscriptForward primerReverse primerLength (bp) Accession number Kiss1CTGCTGCTTCTCCTCTGTGTCTCCCAGGCATTAACGAGTTCC107NM_178260.3 Kiss1rGTGCAAATTCGTCAACTACATCCAGCGGGAACACAGTCACATAC103NM_053244.5 Insl3AAGCTCTGCGGCCACCAGTCTCTGCTCTAGCCACTGC127NM_013564.7 LhcgrGCCCGACTATCTCTCACCTATCCCTTTCCAGGGAATCACTCTGA111NM_013582.2 FshrGGAACGCCATTGAACTGAGATTTGGAGAACACATCTGCCTCTAT141NM_013523.3 Hsd3b-ITTTGCTCTCTCAGTTGTGACCAGCCTGCTTCGTGACCATATTTATT134NM_008293.3 Cyp19a1ACGTGGATGTGTTGACCCTCGATGAGGAGAGCTTGCCAGG137NM_007810.3 ArGTATCCTGGTGGAGTTGTGAACGGTACTGTCCAAACGCATGTC121NM_013476.3 Erα TGGACAGGAATCAAGGTAAATGTTGAGGCACACAAACTCTTCTC118NM_007956.4

34

4. Results

4.1 Titer of chicken-anti KISS1R antibody

In order to confirm when the hens had expressed the optimal quality of the antibody,

In order to confirm when the hens had expressed the optimal quality of the antibody,

相關文件