evidences, it is significantly confirmed that kisspeptin/KISS1R system administrate the
17
key role on the pubertal onset and reproductive capacity (Pinilla et al., 2012).
Because these above data demonstrated the decrease concentration of gonadotropins
(FSH and LH) by abnormality of kisspeptins or/and its receptor in patients and
experimental animal models, scientists suggested that there might be a physiological
relevance of kisspeptin/KISS1R system in the regulation of HPG axis and a variety of
studies continuously documented the ability of kisspeptins to potently elicit gonadotropin
secretion. Being inspired by the hypothesis that kisspeptin/KISS1R system governing the
HPG axis, a number of groups evaluated the ability of kisspeptin to elicit LH release in
various species, such as rat (Gutierrez-Pascual et al., 2007), bovine (Ezzat et al., 2010)
and porcine (Suzuki et al., 2008), and then suggested a direct stimulation of pituitary LH
secretion by kisspeptin.
However, this affirmation of direct kisspeptin action at the pituitary level was later
denied by the study on hpg mice which is severely deficient in GnRH secretion and unable
to respond to kisspeptin stimulation for LH secretion (Gill et al., 2010). In other words,
kisspeptin-induced LH release must be arranged by hypothalamic GnRH. Besides, several
expression data from immunofluorescence indicated that there is a direct connection
between Kisspeptin neurons and GnRH neurons in mouse hypothalamus, majorly in the
medial preoptic area (POA) region (Clarkson and Herbison, 2006; Kinoshita et al., 2005).
Although kisspeptin neurons are mostly expressed in the anteroventral periventricular
18
nucleus (AVPV) region and the arcuate (ARC) nucleus of the hypothalamus, it seems like
that kisspeptin fibres could extend into POA and median eminence (ME) region to give
the signal to GnRH neurons (Clarkson et al., 2008; Herbison, 2008). Not only expression
studies but electrophysiological experiments within GnRH neuron also supported the
physiologic relevance of kisspeptin signaling in the control of gonadotropin secretion
(Han et al., 2005; Zhang et al., 2007). Therefore, those further proofs have substantiated
that the dominant site of action of kisspeptins in the regulation of the gonadotropic axis
is located at hypothalamic GnRH neurons (Roa et al., 2009).
All in all, the above set of data have solidly confirmed that initiating the pubertal
onset by increasing GnRH secretion is one of the physiological role of kisspeptin/KISS1R
system in reproduction.
In spite of abundant data focusing on functions of cerebral kisspeptins, compelling
evidences obtained in different species implies additional regulatory effects of kisspeptins
at other levels of the reproductive system. Since 2001, it has been known that Kiss1 and
Kiss1r gene are expressed in variant tissues (Kotani et al., 2001; Muir et al., 2001; Ohtaki
et al., 2001). Because the presence of Kiss1 and Kiss1r gene is also discovered in the
testis and the ovary, peripheral or local actions of kisspeptin and KISS1R in the gonad might be considered as responsible for cooperating individual’s reproduction with the
central control.
19
In terms of the ovary, Castellano et al. (2006) demonstrated that ovarian KiSS-1
levels increase during the pubertal transition and fluctuated in a cyclic-dependent manner
with a peak at the proestrus, i.e. preceding ovulation while Gpr54 mRNA levels remained
rather low and stable across the ovarian cycle. Besides, by immunohistochemistry, both
kisspeptin-IR and KISS1R-IR were observed in theca layers of growing follicles, corpora
lutea, and interstitial gland. They also found that gonadotropin priming enhanced levels
of Kiss1 mRNA which is previously negligible in immature ovaries. Gaytan et al. (2009)
further confirmed the observations of kisspeptin and KISS1R expression in the ovary of
human and monkey and also suggested that gonadotropin-induced ovarian Kiss1 mRNA
levels was inhibited by the inhibition of prostaglandin synthesis. Nevertheless, human
with impaired KISS1R signaling can still ovulate if properly primed with gonadotropins
(Pallais et al., 2006) while ovulation linked to the absence of KISS1R cannot be fully
rescued by gonadotropin replacement in mouse (Gaytan et al., 2014). Because of those
inconsistent observations, the indispensability of locally produced Kisspeptins in the
control of ovulation is still doubtful so far.
It contrast to the ovary, there is much less data on the potential local expression or
actions of kisspeptins in the testis. Based on the observations of established Kiss1‒/‒ and
Kiss1r‒/‒ mutant mouse model (d'Anglemont de Tassigny et al., 2007; Kauffman et al.,
2007b; Mei et al., 2011; Seminara et al., 2003), scientists noted that mutant male mice of
20
either genotype have failed reproductive capability with lower testicular weights and
reduced serum testosterone levels compared to wild-type. In addition, spermatogenesis is
severely impaired with spermatogenic arrest at the meiotic-division stage (primary
spermatocytes were expressed but few haploid spermatids were shown), resulting in the
absence of spermatozoa in the seminiferous tubules and epididymides. However, there
are some mutant mice presenting complete spermatogenesis and producing few
spermatozoa though they also have those abnormal phenotypes of male reproductive
system (Lapatto et al., 2007).
Recently, two studies in human and mouse spermatozoa sequentially demonstrated
the specific sites where kisspeptins and KISS1R exist in and the regulation of
kisspeptin/KISS1R system on the fertilization ability of sperm. Pinto et al. (2012) first
indicated both Kisspeptin IR and KISS1R IR were presented in post-acrosomal region of
the mature sperm head and also localized around the sperm neck while Kisspeptin IR is
particularly intense in the equatorial segment. Moreover, this group also investigated
calcium concentration in sperms and calcium-regulated sperm function, like motility,
hyperactivation and the acrosome reaction under the addition of kisspeptin. According to
the data, they suggested that kisspeptin, binding with KISS1R, could induce intracellular
calcium-signal transduction to modulate sperm moltility and hyperactivation but not
acrosome reaction.
21
Later, our previous data further showed extensive data related to expression profiles
and functions of kisspeptin and KISS1R in the mouse reproductive tissues (Hsu et al.,
2014). In contrast to the immunodetective results from described data (Pinto et al., 2012),
we found that only KISS1R is expressed in mouse mature spermatozoa, specifically on
the acrosome, and kisspeptin is localized in the interstitial testicular compartment and
epididymis instead. While focusing on female reproductive tissues, Kisspeptin but no KISS1R immunoreactivity was detected specifically in follicles, corpora lutea, and
interstitial glands, the results which are consistent with previous demonstration
(Castellano et al., 2006). In the test of fertilization capacity, we also confirmed the
regulation of kisspeptin on sperm capacitation, though acrosome reaction is not include,
by treating noncapacitated and capacitated sperm with p234. Combining those line of data,
we suggested that kisspeptin coming from the epididymis and oviduct regulates the
fertilization capacities of spermatozoa during capacitation in reproductive tract.
Overall, it seems like that kisspeptin/KISS1R system acts not only on central
neuronendocrine system but also on gonad locally to integrate the reproduction and
fertility.
2.2.3 Kisspeptin signaling via KISS1R
Since the fact that kisspeptins constitute natural agonists of KISS1R was found in
2001, the functions and signaling pathways regulated by kisspeptin/KISS1R system has
22
been investigated widely in several cell models, such as CHO-K1, HEK203, and
B16-BL6. At first scientists found an increasing calcium concentration in KISS1R-transfected cells after cells were treated with kisspeptin, but these increase didn’t disappear under the
treatment of pertussis toxin which blocks the activity of Gi protein. More, intracellular
cAMP were not modulated by Kisspeptin in cells transiently expressing KISS1R. Those
data suggested that KISS1R is a Gq-coupled receptor without the connection to Gs and/or
Gi proteins. Also, PLC–PKC and MAPK pathways which often activated by G
protein-coupled receptors were also disclosed by using specific inhibitors in kisspeptin-treated
cells (Kotani et al., 2001; Muir et al., 2001; Ohtaki et al., 2001).
Because the function on GnRH secretion was discovered later, many researches used
GnRH neurons as the model and revealed that intracellular calcium increased by
kisspeptin via KISS1R also regulated multiple ion channels [such as potassium channel,
transient receptor potential cation (TRPC) channel and so on] to depolarized the GnRH
neuron and induce GnRH release (Liu et al., 2008; Zhang et al., 2008).
In summary, the binding of kisspeptin and KISS1R activates phospholipase C (PLC),
then subsequently converts phosphatidylinositol bisphosphate (PIP2) into inositol
1,4,5-trisphosphate (IP3), which induces the mobilization of Ca2+ from intracellular reservoirs.
The increase of intracellular Ca2+ may results in phosphorylation of MAPK by
diacylglycerol (DAG) and protein kinase C (PKC) activation to regulate many cell
23
functions (like anti-metastasis and proliferation) or changes in ion channel permeability
thus causing depolarization responses (Fig. 1).
Fig. 1. Kisspeptin via GPR54 signaling at a glance. Schematic presentation of the major signaling pathways recruited upon GPR54 activation by kisspeptins.
Fig. 1. Kisspeptin via GPR54 signaling at a glance.
24
3. Materials and Methods
3.1 Synthetic peptides
KISS1R peptides (H-NASDDPGSAPRPLD-C) were synthesized from Kelowna
International Scientific Inc. (Taipei, Taiwan). For immunogens, KISS1R peptides were
conjugated with Keyhole limpet hemocyanin (KLH).
3.2 Preparation of antibodies
Modified immunization protocols were demonstrated previously (Narat, 2003), two
ISA Brown hens (40-week-old) were immunized by intramuscular injection at multiple
sites on breast. Primary immunization was performed with 400 μg of KISS1R
peptides-KLH in 0.5 mL of saline and equal volume of Freund’s complete adjuvant (Sigma-Aldrich, USA) for each hen. Total three boosters with 300 μg of KISS1R peptides-KLH in 0.5 mL
of saline and equal volume of Freund’s incomplete adjuvant were performed. The first
two boosters were performed at 1-week-intervals and the third booster was performed 4
weeks after the second one. The health status of hens was monitored daily and their blood
were taken weekly or laid eggs were collected daily. All of the samples were stored at
-20 or 4°C until further processing.
3.3 Purification of egg yolk antibody
IgY was purified by the polyethylene glycol (PEG) precipitation method as
previously described (Atha and Ingham, 1981). In order to analyze the average quality
25
of antibody along the weeks after immunization, eggs laid weekly (about 5-7 eggs)
from each hen were pooled prior to IgY extraction. Because IgY in the serum is
selectively transferred to the yolk, we only retained egg yolk. After recording total
volume of weekly yolk, the yolk was mixed with double yolk volume of PBS. Then,
3.5 % PEG 6000 (Sigma-Aldrich, USA) of the total volume (yolk + PBS) was added,
followed by 10 min mixing on a rolling mixer. The tubes were centrifuged at 13,000g
and 4°C for 20 min. After centrifugation, the supernatant was passed through a folded
filter and transferred to a new tube. 8.5 % PEG 6000 in gram (calculation based on the
new volume) were added into the tube. The tube was rolled on a rolling mixer and
centrifuged as above mentioned. The pellet was dissolved in 1 mL PBS by means of a
glass stick and the vortex. PBS was added to a final volume of 10 mL. The solution
was mixed with 12 % PEG 6000 (w/v, 1.2 gram), followed by rolling and
centrifugation again. The pellet was carefully dissolved in 2 mL PBS buffer and the
solution was dialyzed for 24 hr in PBS. Thereafter, the IgY-extract was taken out from
the dialysis bag (Membrane Filtration Products, INC., USA) and stored at -20°C until
further processing. The protein content (mg/mL) of the samples was measured by
PierceTM BCA protein assay kit (Thermo Fisher Scientific Inc., USA) and the quality
of the antibody was analyzed by simple SDS-PAGE.
26
3.4 Enzyme-linked immunosorbent assay (ELSIA)
The titers of chicken IgY anti-KISS1R production and its avidity were evaluated by
an indirect ELISA. Briefly, high affinity microtiter plates (Costar Corning Inc., USA)
were coated with KISS1R peptide (10 mg/mL) in coating buffer (35 mM NaHCO3, 15
mM Na2CO3, pH 9.6) and incubated overnight at 4°C. Plates were washed twice with
washing buffer (6.1 mM Na2HPO4 · 2H2O, 3.9 mM NaH2PO4 · H2O, 0.1% Tween-20, pH
7.0) and blocked with blocking buffer (0.25% gelatin, 0.15 M NaCl, 0.05 M Tris-base, 6
mM EDTA, 0.05% Tween-20, pH 8.0) overnight at 4°C. Antibodies (100 mg/mL) in
weekly serum or yolk extract were diluted 1:10,000 in assay buffer, added to the wells in
duplicate and incubated for 1 hr at room temperature. After washing, plates were
incubated with peroxidase-conjugated goat anti-chicken IgY antibody (Abcam plc,
Cambridge, UK), diluted 1:20,000 in assay buffer, for 1 hr at room temperature. The color
was revealed by adding 3.7 mM o-phneylenediamine in 0.03% H2O2 within 5 min, and
the color presenting reaction was stopped by addition of 8 N H2SO4. The optical density
(OD) was determined at 490 nm with the ELISA reader (Dynatech, Dnkendort, Germany).
3.5 Animals and tissues collection
ICR mice were purchased from National Taiwan University, maintained under a
12-h lig12-ht cycle and given c12-how diet and water ad libitum. All procedures conformed to t12-he
National Institutes of Health Guide for the care and use of laboratory animals. Testes used
27
for RNA extraction and Immunohistochemistry were obtained from male mice aged 0, 1,
2, 3, 4, 6, 8 and 12 weeks postpartum (wpp). Brain slices of the hypothalamus, testes,
epididymis, kidney, liver, and heart used for protein extraction were obtained from male
mice aged 8 wpp. For analyzing the specific site, the brain was positioned on the brain
blocker with the plane of section of the mouse brain and cut sagitally into 2-mm thick
slices containing the hypothalamus area. Also, brain slices and ovaries collected from
8-week-old female mice were used as the positive control in immunohistochemical staining.
Female mice were pretreated with 10 IU pregnant mares’ serum gonadotropin (PMSG;
Sigma–Aldrich) for 48 hr to maintain their estrous cycle during a preovulatory stage
before sacrifice and tissue collection.
3.6 Primary Mouse Leydig cell culture
Mice up to the age of 12 weeks were sacrificed by decapitation. Testes were
immediately collected and put into isolation buffer (10 mg collagenase and 10 mg BSA
in HBSS buffer). Buffer was renewed once for removing red blood cells and tissue debris.
Then, testes in isolation buffer were incubated at room temperature for 5 min. After
separating the seminiferous tubules by filtration through sterile stainless steel net with
nylon mesh, the filtrate was centrifuged at 300g for 5 min at room temperature. The
dissociated cells were resuspended in 15 mL Medium 199 (M-199) and incubated in at
37°C with 5% CO2.
28
In order to identify Leydig cells, 3β-HSD staining was carried out by a modification
of the method described previously (Payne et al., 1980). 2 x 105 cells were seeded on
6-well plate 24 hr before staining. Cells were allowed to dry on 6-well for 15 min at 37°C.
After drying was complete, cells were covered with staining solution (1% BSA, 1.5 mM β-NAD, 0.25 mM NBT, 0.2 mM DHEA, 80% PBS) for 8 hr. Then, cells were rinsed in
PBS, and fixed in 4% paraformaldehyde in PBS. Cells were observed at 400X
magnification for the presence of blue-purple formazan granules.
Before treatment, cells were counted and seeded (2 x 105) with M-199 FBS on
6-well plate for 24 hr. Then, Cells were treated with ovine luteinizing hormone (oLH) and
RP-cAMPS (Enzo Life Science, Inc., NY, USA), a PKA inhibitor, in serum-free medium
for additional 24 hr. Later, we extracted RNA from cells of each treatment for cDNA
synthesis and real-time PCR analysis.
3.7 Cell line culture
We used MA-10 mouse Leydig tumor cells as cell model to confirm the expression
of KISS1R on Leydig cell’s membrane by Immunohistochemistry and investigate the
mechanism of LH-dependent Kiss1 gene expression by real-time PCR. Cells were
maintained in DMEM/F-12 medium supplemented with 10% FBS, 2.2 mg/mL NaHCO3,
100U/mL penicillin and 0.1 mg/mL streptomycin under the condition of 37°C and 5%
CO2. For conducting the experiment, MA-10 cells were plated at 2 x 105 cells/well and
29
allowed to adhere for 24 hr. Then, we treated the cells with or without oLH and
RP-cAMPS in the following 24 hr. After the treatment, total RNA was extracted from cells
for gene analysis.
3.8 Immunohistochemistry
Formalin-fixed mouse tissues were embedded in paraffin, sectioned into 5-mm thick
slies, and adhered to poly-L-lysine-coated slides. Tissue sections were deparaffined in
xylene and rehydrated through descending concentrations of ethanol, washed with H2O,
then immersed in 10 mM citrate buffer (pH 6.0) with 0.05% Tween-20, and finally heated
twice in a microwave for 10 min at 750 W with the 5 min interval. The sections was
removed and allowed to cool by a brief wash in tap water and then in PBS. After
quenching endogenous peroxidase activity with 1% (v/v) H2O2 in methanol for 30 min, the sections were rinsed three times with PBS for 5 min each. Nonspecific binding sites
were blocked with goat serum in PBS [3% (v/v) normal goat serum and 0.2% (v/v) Triton
X-100 in PBS] for 1 hr. A commercial rabbit polyclonal antibody raised against mouse
kisspeptin 145 (1:100 dilution; Abcam) was used to visualize Kisspeptin. For KISS1R,
we used our own chicken-anti mouse KISS1R antibody described above at a dilution of
1 : 5,000. This antibody specificity had been validated by showing gradually obscure
bands when antibodies were pre-incubated with grading concentrations of antigen in
absorption test. Negative controls for antibodies were established using blocking buffer
30
alone. After 2 hr (KISS1R) or 20 hr (kisspeptin) of incubation at 4°C, antibodies were
revealed with a biotinylated secondary antibody directed against rabbit immunoglobulin
G (for kisspeptin) or chicken immunoglobulin G and Y (for KISS1R) for 1 hr. Slides were
washed three times with PBS for 5 min each at room temperature and incubated with an
avidin–biotin–HRP complex in the Vectastain Universal ELITE ABC kit (Vector
Laboratories, Burlington, ON, Canada) for 30 min according to the manufacturer’s
instructions. After rinsing again, slides were incubated for 10–20 min at room temperature
with diaminobenzidine to visualize immunostaining. Finally, slides were rinsed with
distilled water twice for 10 min each, counterstained with hematoxylin for 30 s and
hydrated with ethanol and xylene before adding mounting medium (Hecht-Assistent;
Sondheim, Germany). Sections were observed using optical microscope (Axioskop 40,
Carl Zeiss, Göttingen, Germany), and images were collected using an AxioCam ERc 5s
(Carl Zeiss) digital camera.
3.9 Western Blot
The tissues or cells were rinsed once with cold PBS and collected. They were ground
with a mechanical homogenizer in cold lysis buffer [150 nM NaCl, 0.1% Triton-X 100,
50 mM Tris-HCl (pH 8.0), protease inhibitor, phosphatase inhibitor]. Protein
concentrations were determined by using the PierceTM BCA protein assay kit according
to the manufactures instructions. Samples containing 30–60 μg protein were separated by
31
15% SDS–PAGE. The separated proteins were transferred onto a PVDF membrane. The
membrane was blocked by immersing in PBS containing 0.01% Tween 20 (PBST) and
2.5% BSA for 8 hr at room temperature, followed by incubation with our own
chicken-anti mouse KISS1R chicken-antibody (1:200,000 dilution or a serial diluted concentrations) in
PBST with 0.5% BSA for 18 hr at room temperature. Then, the membrane was washed
three times with PBST and incubated for 2 hr with peroxidase-conjugated goat anti-rabbit
IgG (1:25,000 dilution; Jackson ImmunoResearch Laboratory, PA, USA) or goat
anti-chicken IgY. The membrane was washed with PBST and bound antibodies were
visualized by the ECL system (Merck Millipore). The images were presented on Kodak
X-OMAT film (Eastman Kodak Co.).
3.10 RNA extraction and cDNA synthesis
Total RNA was extracted from tissues or cells with TRIsure reagent (Bioline Inc., USA) according to the manufacturer’s instructions. We used PrimeScript™ RT reagent
Kit (Takara Bio Inc., Japan) to synthesize cDNA. Total RNA (500 ng) was mixed with 25
pM oligo(dT) primer, 50 pM random hexamers, enzyme mix and reaction buffer, then
incubated at 37°C for 15 min. The reverse transcriptase was inactivated by heating to
85°C for 5 s, and cDNA products were stored at 4°C for further analysis.
3.11 Quantitative real-time PCR
Relative levels of target mRNA was examined with the StepOne Real-Time PCR
32
System (Applied Biosystems, CA, USA) according to the manufacturer’s instructions.
Transcripts were quantified using the Fast SYBR Green Master Mix (Applied Biosystems)
in a total volume of 10 μL. Samples were heated for 10 min at 95°C, followed by 40
cycles of 15 s at 95°C, 30 s at 60°C and 30 s at 72°C. Then, melting curve analysis was
conducted to observe the appearance of non-target products which may affect the final
data. The primer sequences are shown in table 2.
3.12 Statistical analysis
Each experiment was replicated at least three times. Data were expressed as mean ±
SD. Data were analyzed by Student’s t-test or one-way ANOVA followed by Duncan’s
method with Sigma Plot Software (Systat Software, CA, USA); p < 0.05 indicated significance.
33
Table 2. Primers used for quantitative real-time PCR in this study.
Table 2. Primers used for quantitative real-time PCR in this study TranscriptForward primerReverse primerLength (bp) Accession number Kiss1CTGCTGCTTCTCCTCTGTGTCTCCCAGGCATTAACGAGTTCC107NM_178260.3 Kiss1rGTGCAAATTCGTCAACTACATCCAGCGGGAACACAGTCACATAC103NM_053244.5 Insl3AAGCTCTGCGGCCACCAGTCTCTGCTCTAGCCACTGC127NM_013564.7 LhcgrGCCCGACTATCTCTCACCTATCCCTTTCCAGGGAATCACTCTGA111NM_013582.2 FshrGGAACGCCATTGAACTGAGATTTGGAGAACACATCTGCCTCTAT141NM_013523.3 Hsd3b-ITTTGCTCTCTCAGTTGTGACCAGCCTGCTTCGTGACCATATTTATT134NM_008293.3 Cyp19a1ACGTGGATGTGTTGACCCTCGATGAGGAGAGCTTGCCAGG137NM_007810.3 ArGTATCCTGGTGGAGTTGTGAACGGTACTGTCCAAACGCATGTC121NM_013476.3 Erα TGGACAGGAATCAAGGTAAATGTTGAGGCACACAAACTCTTCTC118NM_007956.4
34
4. Results
4.1 Titer of chicken-anti KISS1R antibody
In order to confirm when the hens had expressed the optimal quality of the antibody,
In order to confirm when the hens had expressed the optimal quality of the antibody,