• 沒有找到結果。

Chapter 4. Discussions

4.1 Significance of the work

By using genetic sparsely labeling method, here we show there are at least two different morphologically distinct types of intra-retinal collateral from intrinsically photosensitive retinal ganglion cells (ipRGCs) that stratified retrograded at the inner plexiform layer. Furthermore, we demonstrated that collaterals co-stratified with dopaminergic amacrine cells (DACs) form putative synaptic contact with DACs by immunofluorescence and transmission electron microscopy. Together, these results indicate that ipRGCs send feedback signals to DACs, which are involved in many retinal functions including adaptation, circadian rhythm and contract sensitivity. We also found another population of ipRGC axon collaterals that stratified in the off-layer of the inner plexiform layer. These axon collateral may innervate other types of inter-neuron for different feedback functions. In addition, result of ex vivo electroporation indicates ipRGCs modulate retina by feedback signals via intra-retinal collaterals not only on adult but also during developmental stages. This study would open a new field of research on the retinal feedback circuitry, and advance our knowledge of retinal visual function though a population of specific neuron that is mainly involved in non-visual light functions.

- 32 -

Figures

Figure 1. We hypothesized intrinsically photosensitive retinal ganglion cells (ipRGCs) send feedback signals to dopaminergic amacrine cells (DACs) by intra-retinal axon collateral co-stratified with DACs in S1 sublayer of inner plexiform layer (IPL).

- 33 -

- 34 -

Figure 2. Morphological characteristics of intrinsically photosensitive retinal ganglion cells intra-retinal axon collaterals. A. An illustration of transgenic mice line for random ipRGCs labeling. CreER/T2 is driven by melanopsin promotor Opn4. Artificially applied tamoxifen is needed to conjugate with creER/T2 for operating endonucleus loxP sequence, activating functional human placental alkaline phosphatase (HPAP) driven by universal promotor Rosa26. Alkaline phosphatase produce dark-blueish precipitation with NBT/BCIP under histochemistry procedures. By adjusting tamoxifen dosage, number of ipRGCs presenting precipitation could be optimized to observe intra-retinal collaterals of ipRGCs. B-F demonstrated two dimensions of collaterals’

characteristics. Firstly collaterals were different in complexity and can be classified into single collaterals (E-F) and complex collaterals (B-D).

Secondly they were different in reached depth in inner plexiform layer (IPL). Some collaterals reached in deepest IPL and co-stratified with dopaminergic amacrine cells in S1 sub layer (B-D), while others did not reach that deep (E-F). Blue arrows indicate main axon of ipRGCs and red arrows indicate axon collaterals. Gray boxes indicate focal plans in IPL.

Distance from soma to branch point was defined as “branch distance”

and illustrated by “d” in G. H shows branch distances of collaterals reached S1 were significantly shorter than those collaterals don’t reach

- 35 -

S1. (Student t test, p=0.006)

- 36 -

- 37 -

Figure 3. Collateral of ipRGCs contact with to dopaminergic amacrine cells. A. A whole-mounted retina with sparsely NBT/BCIP labeling. B-C. Higher magnifications in two focal plans of A showed an ipRGC with intra-retinal collateral. B and C were focus on ganglion cell layer and DAC stratified S1 sublayer, respectively. Blue arrows indicate main axon and red arrows indicate collateral. D shows confocal image of square region in C. E-G. Higher magnifications showed co-localization of ipRGC collateral (red), DACs (blue) and bassoon (green), indicated by white arrows. Scale bar: A 1 mm, B-D 100 μm, E-G 10 μm.

- 38 -

- 39 -

Figure 4. Cross section view of an ipRGC collateral. A. A whole-mounted retina with sparsely NBT/BCIP labeling. B-E. Higher magnifications of A under serial DIC images, focused from ganglion cell layer to boundary of inner plexiform layer and inner nucleus layer, respectively. Blue arrows indicate main axon and red arrows indicate collateral. Yellow arrows in E indicates collateral terminals in later figures. Two 20 μm cross sections were cut from A, location indicate by blue lines on B-E. Upper section is shown in F. Yellow arrow indicates same collateral terminal in E. G. Confocal image of F. Red, yellow, green and blue channels present immuno-positive of tyrosine hydroxylase, postsynaptic density, synaptophysin and NBT/BCIP precipitation in reflex mode, respectively. Yellow arrow indicates same collateral terminal in E. Scale bar: A 1 mm, B-E 100 μm.

- 40 -

Figure 5. Collateral of ipRGC connect to DAC neurites. A. Higher magnification of figure 4G showed co-localization of ipRGC (blue) collateral, DAC (red), synaptophysin (SYP, green) and postsynaptic density (PSD, yellow), indicated by red arrow. B-G. Split channels of A.

- 41 -

B. IpRGC and SYP. C. DAC and PSD. D. IpRGC. E. Synaptophysin. F.

Dopaminergic amacrine cell. G. Postsynaptic density. H-J. Other samples of co-localization in the other section from figure 4E, indicated by red arrows. Scale bar: 10μm.

- 42 -

Figure 6. Melanopsin positive RGCs in cultured retina express synaptophysin. A. N1 vectors with synaptophysin::eGFP were sent into retina by ex vivo electroporation. Cells without activated Opn4 promotor received vectors expressed dsRed, while ipRGCs expressed synaptophysin::eGFP. B. Retina from P2 mouse express eGFP after five

- 43 -

day culture, indicated by arrows.

- 44 -

Figure 7. Synaptic ultra-structure of ipRGC collateral. A. A whole-mounted retina with sparsely NBT/BCIP labeling. B. Higher magnification of A. Green, blue and red indicate dendrites, main axon and axon collateral of an ipRGC, respectively. C. Cross section view of

- 45 -

bold line in B, counter stained with safranin O to indicate cell bodies.

Red arrow indicates collateral. D. Synaptic ultra-structure of collateral under transmission electron microscope. NBT/BCIP formed electron dense precipitations appear in dark particles while cell membrane and synaptic vesicles were enhanced by osmium tetroxide fixation and uranium acetate staining, appear in light gray. Green, blue, red and yellow arrows indicate cell membrane of axon collateral, electron dense NBT/BCIP precipitation particles, synaptic vesicles and postsynaptic density. Scale bar: A 1 mm, B 100 μm, D 200 nm.

- 46 -

Figure 8. Illustration of the conclusion. We conclude our study that ipRGCs send feedback signals to DACs by intra-retinal collaterals co-stratified with DAC in S1 sublayer of inner plexiform layer, and furthermore modulate retinal circuitry by different DAC neurite.

Collaterals don’t co-stratified with DAC may also innervate to SACs during developmental stages and modulate retinal development.

- 47 -

References

1. Wald, G. (1955). The photoreceptor process in vision. American journal of ophthalmology 40, 18-41.

2. Wald, G. (1955). Visual pigments and vitamins A of the clawed toad, Xenopus laevis. Nature 175, 390-391.

3. Wassle, H. (2004). Parallel processing in the mammalian retina.

Nature reviews. Neuroscience 5, 747-757.

4. Provencio, I., Rodriguez, I.R., Jiang, G., Hayes, W.P., Moreira, E.F., and Rollag, M.D. (2000). A novel human opsin in the inner retina.

The Journal of neuroscience : the official journal of the Society for Neuroscience 20, 600-605.

5. Provencio, I., Rollag, M.D., and Castrucci, A.M. (2002).

Photoreceptive net in the mammalian retina. This mesh of cells may explain how some blind mice can still tell day from night.

Nature 415, 493.

6. Provencio, I., Jiang, G., De Grip, W.J., Hayes, W.P., and Rollag, M.D. (1998). Melanopsin: An opsin in melanophores, brain, and eye. Proceedings of the National Academy of Sciences of the United States of America 95, 340-345.

7. Hattar, S., Liao, H.W., Takao, M., Berson, D.M., and Yau, K.W.

- 48 -

(2002). Melanopsin-containing retinal ganglion cells: architecture, projections, and intrinsic photosensitivity. Science 295, 1065-1070.

8. Panda, S., Sato, T.K., Castrucci, A.M., Rollag, M.D., DeGrip, W.J., Hogenesch, J.B., Provencio, I., and Kay, S.A. (2002). Melanopsin (Opn4) requirement for normal light-induced circadian phase shifting. Science 298, 2213-2216.

9. Schmidt, T.M., Do, M.T., Dacey, D., Lucas, R., Hattar, S., and Matynia, A. (2011). Melanopsin-positive intrinsically photosensitive retinal ganglion cells: from form to function. The Journal of neuroscience : the official journal of the Society for Neuroscience 31, 16094-16101.

10. Ecker, J.L., Dumitrescu, O.N., Wong, K.Y., Alam, N.M., Chen, S.K., LeGates, T., Renna, J.M., Prusky, G.T., Berson, D.M., and Hattar, S. (2010). Melanopsin-expressing retinal ganglion-cell photoreceptors: cellular diversity and role in pattern vision. Neuron 67, 49-60.

11. Schmidt, T.M., Alam, N.M., Chen, S., Kofuji, P., Li, W., Prusky, G.T., and Hattar, S. (2014). A role for melanopsin in alpha retinal ganglion cells and contrast detection. Neuron 82, 781-788.

12. Panda, S., Provencio, I., Tu, D.C., Pires, S.S., Rollag, M.D., Castrucci, A.M., Pletcher, M.T., Sato, T.K., Wiltshire, T., Andahazy,

- 49 -

M., et al. (2003). Melanopsin is required for non-image-forming photic responses in blind mice. Science 301, 525-527.

13. Takahashi, J.S., DeCoursey, P.J., Bauman, L., and Menaker, M.

(1984). Spectral sensitivity of a novel photoreceptive system mediating entrainment of mammalian circadian rhythms. Nature 308, 186-188.

14. Freedman, M.S., Lucas, R.J., Soni, B., von Schantz, M., Munoz, M., David-Gray, Z., and Foster, R. (1999). Regulation of mammalian circadian behavior by non-rod, non-cone, ocular photoreceptors. Science 284, 502-504.

15. Rollag, M.D., Berson, D.M., and Provencio, I. (2003). Melanopsin, ganglion-cell photoreceptors, and mammalian photoentrainment.

Journal of biological rhythms 18, 227-234.

16. Lucas, R.J., Hattar, S., Takao, M., Berson, D.M., Foster, R.G., and Yau, K.W. (2003). Diminished pupillary light reflex at high irradiances in melanopsin-knockout mice. Science 299, 245-247.

17. Xue, T., Do, M.T., Riccio, A., Jiang, Z., Hsieh, J., Wang, H.C., Merbs, S.L., Welsbie, D.S., Yoshioka, T., Weissgerber, P., et al.

(2011). Melanopsin signalling in mammalian iris and retina.

Nature 479, 67-73.

18. Chen, S.K., Badea, T.C., and Hattar, S. (2011). Photoentrainment

- 50 -

and pupillary light reflex are mediated by distinct populations of ipRGCs. Nature 476, 92-95.

19. Semo, M., Gias, C., Ahmado, A., and Vugler, A. (2014). A role for the ciliary marginal zone in the melanopsin-dependent intrinsic pupillary light reflex. Experimental eye research 119, 8-18.

20. Dacey, D.M. (1990). The dopaminergic amacrine cell. The Journal of comparative neurology 301, 461-489.

21. Zhang, D.Q., Wong, K.Y., Sollars, P.J., Berson, D.M., Pickard, G.E., and McMahon, D.G. (2008). Intraretinal signaling by ganglion cell photoreceptors to dopaminergic amacrine neurons. Proceedings of the National Academy of Sciences of the United States of America 105, 14181-14186.

22. Zhang, D.Q., Belenky, M.A., Sollars, P.J., Pickard, G.E., and McMahon, D.G. (2012). Melanopsin mediates retrograde visual signaling in the retina. PloS one 7, e42647.

23. Hampson, E.C., Vaney, D.I., and Weiler, R. (1992). Dopaminergic modulation of gap junction permeability between amacrine cells in mammalian retina. The Journal of neuroscience : the official journal of the Society for Neuroscience 12, 4911-4922.

24. Jackson, C.R., Ruan, G.X., Aseem, F., Abey, J., Gamble, K., Stanwood, G., Palmiter, R.D., Iuvone, P.M., and McMahon, D.G.

- 51 -

(2012). Retinal dopamine mediates multiple dimensions of light-adapted vision. The Journal of neuroscience : the official journal of the Society for Neuroscience 32, 9359-9368.

25. Van Hook, M.J., Wong, K.Y., and Berson, D.M. (2012).

Dopaminergic modulation of ganglion-cell photoreceptors in rat.

The European journal of neuroscience 35, 507-518.

26. Dkhissi-Benyahya, O., Coutanson, C., Knoblauch, K., Lahouaoui, H., Leviel, V., Rey, C., Bennis, M., and Cooper, H.M. (2013). The absence of melanopsin alters retinal clock function and dopamine regulation by light. Cellular and molecular life sciences : CMLS 70, 3435-3447.

27. Dubocovich, M.L., Lucas, R.C., and Takahashi, J.S. (1985).

Light-dependent regulation of dopamine receptors in mammalian retina. Brain research 335, 321-325.

28. He, Q., Xu, H.P., Wang, P., and Tian, N. (2013). Dopamine D1 receptors regulate the light dependent development of retinal synaptic responses. PloS one 8, e79625.

29. Renna, J.M., Weng, S., and Berson, D.M. (2011). Light acts through melanopsin to alter retinal waves and segregation of retinogeniculate afferents. Nature neuroscience 14, 827-829.

30. Peterson, B.B., and Dacey, D.M. (1998). Morphology of human

- 52 -

retinal ganglion cells with intraretinal axon collaterals. Visual neuroscience 15, 377-387.

31. Dacey, D.M. (1989). Axon-bearing amacrine cells of the macaque monkey retina. The Journal of comparative neurology 284, 275-293.

32. Dacey, D.M. (1985). Wide-spreading terminal axons in the inner plexiform layer of the cat's retina: evidence for intrinsic axon collaterals of ganglion cells. The Journal of comparative neurology 242, 247-262.

33. Joo, H.R., Peterson, B.B., Dacey, D.M., Hattar, S., and Chen, S.K.

(2013). Recurrent axon collaterals of intrinsically photosensitive retinal ganglion cells. Visual neuroscience 30, 175-182.

34. Metzger, D., Clifford, J., Chiba, H., and Chambon, P. (1995).

Conditional site-specific recombination in mammalian cells using a ligand-dependent chimeric Cre recombinase. Proceedings of the National Academy of Sciences of the United States of America 92, 6991-6995.

35. Kam, W., Clauser, E., Kim, Y.S., Kan, Y.W., and Rutter, W.J.

(1985). Cloning, sequencing, and chromosomal localization of human term placental alkaline phosphatase cDNA. Proceedings of the National Academy of Sciences of the United States of America

- 53 -

82, 8715-8719.

36. Indra, A.K., Warot, X., Brocard, J., Bornert, J.M., Xiao, J.H., Chambon, P., and Metzger, D. (1999). Temporally-controlled site-specific mutagenesis in the basal layer of the epidermis:

comparison of the recombinase activity of the tamoxifen-inducible Cre-ER(T) and Cre-ER(T2) recombinases. Nucleic acids research 27, 4324-4327.

37. Snyder, E.Y., Deitcher, D.L., Walsh, C., Arnold-Aldea, S., Hartwieg, E.A., and Cepko, C.L. (1992). Multipotent neural cell lines can engraft and participate in development of mouse cerebellum. Cell 68, 33-51.

38. Spurr, A.R. (1969). A low-viscosity epoxy resin embedding medium for electron microscopy. Journal of ultrastructure research 26, 31-43.

39. Wang, Q., Li, A., Gong, H., Xu, D., and Luo, Q. (2012).

Quantitative study on the hygroscopic expansion of spurr resin to obtain a high-resolution atlas of the mouse brain. Experimental biology and medicine 237, 1134-1141.

40. Jackson, C.R., Capozzi, M., Dai, H., and McMahon, D.G. (2014).

Circadian perinatal photoperiod has enduring effects on retinal dopamine and visual function. The Journal of neuroscience : the

- 54 -

official journal of the Society for Neuroscience 34, 4627-4633.

41. Kirkby, L.A., and Feller, M.B. (2013). Intrinsically photosensitive ganglion cells contribute to plasticity in retinal wave circuits.

Proceedings of the National Academy of Sciences of the United States of America 110, 12090-12095.

42. Famiglietti, E.V., Jr. (1983). 'Starburst' amacrine cells and cholinergic neurons: mirror-symmetric on and off amacrine cells of rabbit retina. Brain research 261, 138-144.

43. Koontz, M.A., and Hendrickson, A.E. (1987). Stratified distribution of synapses in the inner plexiform layer of primate retina. The Journal of comparative neurology 263, 581-592.

44. Wong, R.O. (1999). Retinal waves: stirring up a storm. Neuron 24, 493-495.

45. Wong, R.O. (1999). Retinal waves and visual system development.

Annual review of neuroscience 22, 29-47.

46. Friedmann, D., Hoagland, A., Berlin, S., and Isacoff, E.Y. (2015).

A spinal opsin controls early neural activity and drives a behavioral light response. Current biology : CB 25, 69-74.

- 55 -

Appendix

Buffers and formulas

Phosphate buffer saline (PBS)

Mix 0.1M sodium phosphate monobasic and 0.1M sodium phosphate dibasic in 40.5:9.5 ratio and solve 0.9% sodium chloride in the solution.

Adjust to pH 7.4 (or pH 6.8 in 10x prepare) by NaOH or HCl.

Dissecting buffer

10X HBSS 200ml GIBCO #14065-056 1M HEPES 20ml Sigma #H7523 + NaHCO3 0.7g

Add the water till 1800ml in 2L bottle.

Adjust solution to pH 7.35 by NaOH. Solution should be filtered and then store in 4 °C.

Culture buffer

Item and concentration For 10ml Cat. No.

Neural Basal A medium 9.6ml GIBCO #10888

Glucose (0.6%) 0.06

- 56 -

L-Glutamine (200mM Stock) 100ul Sigma #G-6392 B27 Supplement (50X stock) 200ul GIBCO #17504-044 HEPES (1M, pH 7.35-7.4) 100ul

Sodium pyruvate (100mM Stock) 100ul GIBCO #11360-070 Insulin

(200X; 0.5mg/ml Stock, pH 2.5 in H2O)

50ul Sigma #I1882

Penicillin/Streptomycin (10mg/ml) 100ul GIBCO #15140 Forskolin (30 mM stock) 2ul Sigma #F-6886 Forskolin should be applied after filtering the solution.

Cacodylate buffer with sucrose (CBC)

0.1M sodium cacodylate, 4% sucrose, 0.05M MgCl2 and 0.05M CaCl2, pH 7.4 (adjusted by HCl)

Spurr’s resin A

It would be better to prepare Spurr’s resin in dry days (RH < 50%). We used EMS “low viscosity embedding media Spurr’s kit” (cat. #14300) here. The mixture can be stored in 4 °C for a week. and should be warmed up by room temperature for 20-30 min before use. Although mixture can be store in sealed container in -20 °C for 1-2 months, fresh

- 57 -

prepared resin is always recommended. Optimized formulas for retina are listed below.

ERL 4221 5.00g DER 736 3.80g

NSA 13.0g

Spurr’s resin B ERL 4221 5.00g DER 736 3.80g

NSA 13.0g

This three compound should be mixed thoroughly before adding DAME.

DAME 0.15g

Antibodies

Primary antibodies

Antigen Host Dose Brand

Bassoon Mouse IgG2a 1/400 Enzo

PSD95 Rabbit 1/200 Abcam

Synaptophysin (SYP) Chicken 1/1000 Abcam Tyrosine hydroxylase (TH) Mouse IgG1 1/1000 ImmunoStar

- 58 -

Secondary antibodies

Antigen Host Primary antibody

Fluorophore Dose Brand

Chicken Goat SYP Alexa 488 1/500 Biotium

Insert following sequence into N1 vector by XhoI and NotI.

CTCGAGATAACTTCGTATAGCATACATTATACGAAGTTAT(LoxP)A

CGGCGTGGCGACCGTGACCCAGGACTCCTCCCTGCAGGACGGC

GCCTGGGCCAAAGGCCTGTCCGATGTGAAGATGGCCACGGACC

GACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACA

Chemicals and commercial reagent

Calcium chloride (anhydrous): J.T.Baker 1311-01 Lot#0000024781 Lead citrate: Electron Microscopy Science #17800 Lot#890322 Magnesium chloride: Sigma M8266 Lot#11M0118V

NBT/BCIT (tablet) Roche 11697471001 Lot#10559000 OCT compound: Sakura 4583 Lot#0004348-01

Paraformaldehyde Sigma-Aldrich 158127 Lot#BCBJ1144V

Sodium cacodylate (trihydrate): Electron Microscopy Science #124-65-2 Lot#030130

Sodium Chloride (crystal): J.T.Baker 3624-05 Lot#0000006228

Sodium phosphate, dibasic (anhydrous): J.T.Baker 3829-69 Lot#K20142 Sodium phosphate, monobasic (monohydrate, crystal): J.T.Baker 3818-69

- 62 -

Lot#G22149

Sucrose (crystal): J.T.Baker 4072-05 Batch#0000024483 Sunflower seed oil: Sigma S5007 Lot#MKBK1503V Triton X-100: Sigma X-100 Lot#BB1491V

Trizma base: Sigma T1503 Lot#SLBC4082V

Vectashield with DAPI: Vector Laboratories H-1200

Devices

Microtome: Leica cryostat microtome and Ultracut E.

Brightfield and fluorescent microscope: Zeiss Observer Z.1 with Zeiss MRc camera. Operating by software ZEN 2012.

Confocal microscope: Zeiss LSM 780 system, operating by software ZEN 2010.

Transmission electron microscope: Hitachi H-7650 with Gatan ES500 camera.

- 63 -

相關文件