Chapter II Materials and methods
2.5 Western blot
Whole cell lysates are extracted by lysis buffer at 4 for 15 minutes. Lysates℃
were cleared of debris by centrifugation at 14,000 rpm (Eppendorf) for 15 minutes.
Equal amounts of samples were resolved in 7 % or 10 % sodium dodecyl
sulfate-polyacrylamide gels (SDS-PAGE), followed by transfering to polyvinylidene
difluoride membranes (PVDF) and immunoblotting with the indicated antibodies.
15 2.6 Cytosolic and nuclear extracts
Cells were washed twice with 1XPBS, and then scraped off of the dish and the
cell pellets were obtained by centrifugation (300 xg, 5 minutes, 4℃). Cells was
resuspended in RSB-G40 buffer and nuclei were centrifugated at 10,000 xg to obtain
the cytosolic supernatant. Nuclear extraction was obtained from resuspend nuclei by
using nuclear extraction buffer.
2.7 Co-immunopreciptation (CoIP)
Equal amount of whole cell lysetes were immunopreciptated using anti-HA
antibodies in cell lysis buffer, which was conjugated with protein G beads (Millipore).
Western blotting was performed as described in 2.5 using the indicated antibodies.
2.8 Chromatin immunoprecipitation (ChIP)
MEFs were stimulated with IFN-α4 for 30 minutes, and then fixed in 1.4 %
formaldehyde for 15 minutes at room temperature. Cells were lysed with
immunoprecipitation buffer prior to sonication (Nelson et al., 2006). Chromatins were
sheared by sonication with a Vibra-Cell VCX 130 sonicator (Sonics & Materials).
Cells were sonicated using 1 sec on/ 1 sec off pulses for 5 min at 70% power output to
shear the DNA to ~200 to 500 base pairs. Protein G-Sepharose beads (Millipore) were
16
added to cell lysates preincubated with corresponding antibody overnight at 4°C.
After extensive washes, bead-bound DNA was reverse-crosslinked by incubation
overnight at 67°C. Protein were removed by incubating with 20 μg proteinase K in
proteinase K buffer at 55°C for 4 hours. Recovered DNA from ChIP was analyzed by
QPCR using primers specific for corresponding ISRE elements in the promoters of
the indicated genes. Primer sequences are as follows:
(1) ISRE of IFIT1 promoter
Forward: 5'- GTGGAGAATGCAGTAGGGCAAAC -3'
Reverse: 5'- GTCACACCAACTGGAAGCTCAGG -3'
(2) ISRE of MDA5 promoter
Forward: 5'-ACCAAAGTCCTCACCTAAC-3'
Reverse: 5'-TATTGCCTTCCACCCAC-3'
2.9 In vitro antiviral state assay
MEF cells were pretreated with or without 2-fold serial dilution of IFN-α4 from
240 IU/ml for 24 hours. Cells were infected with EMCV at am MOI of 0.1. After
infection for 18 hours, the medium was removed and cells were fixed with 10 %
formaldehyde for 20 minutes at RT. After fixation, cells were visualized with crystal
violet. The excessive dye was then removed by immersing the plate in water.
17
2.10 Single primer based site-directed mutagenesis
pLPC-FH2-mSTAT3 was subjected to site-directed mutagenesis using one
primer in a single cloning step (Makarova et al., 2000). After PCR, the construct was
digested by DpnI twice to remove the parental unmutated strand DNA and then
transformed into Ecoli.. DNA sequencing was performed to confirm the mutation
sites.
The primers used for mutagenesis are as follows
(1) K49Q: GGCATATGCAGCCAGCCAAGAGTCACATGCCAC Tm= 60 ℃
(2) K87Q: CAACCTTCGAAGAATCCAGCAGTTTCTGCAGAG Tm= 60 ℃
(3) K49R: GCATATGCAGCCAGCAGAGAGTCACATGCCACG Tm= 60 ℃
(4) K87R: AACCTTCGAAGAATCAGGCAGTTTCTGCAGAGC Tm= 58 ℃
(5) K685R: GAGGAGGCATTTGGAAGGTACTGTAGGCCCGAG Tm= 56 ℃
PCR conditions are as follows
95 , 5 min. 98 ℃ ℃, 20 sec. Tm ℃, 20 sec. 72 ℃ 4 min. 72 ℃, 10 min.
2.11 Statistics
A student’s T test (two-tailed) was performed for statistical analysis.
18
Chapter III Results
3.1 STAT3 negatively regulates type I IFN-mediated response
Using STAT3KO MEFs, we have previously reported that STAT3 could suppress
type I IFN-mediated antiviral response (Wang et al., 2011). Since WT MEFs and
STAT3KO MEFs were generated from different mice, it is likely that the epigenetic
modifications are different, which may have additional effects independent of STAT3.
In this study a different approach was taken, STAT1 and STAT3 double knockout
(DKO) MEFs were restored with STAT1, STAT3, or both molecules. In principle, the
genetic makeup of different STAT-restored DKO MEFs should be similar. DKO
MEFs restored with empty vector (EV), Flag- and HA-tagged STAT1 or STAT3, or
both molecular (Fig. 1) with retroviral transduction were stimulated with IFN-α4 for
30 minutes (Fig. 2). STAT1 or STAT3 was expressed in WT, STAT1-restored,
STAT3-restored, and STAT1/3-restored DKO MEFs, and all of their STAT1 or STAT3
were phosphorylated in response to IFN-α4. As expected, STAT1 and STAT3 can also
be detected by anti-Flag and anti-HA antibodies in the restored cells. More
importantly, the phosphorylation of STAT1 and STAT3 in the restored cells was
comparable to that in WT MEFs. Interestingly, phosphorylation of STAT2 was
increased in cells restored with STAT1. These results suggested that DKO MEFs had
19
been successfully restored with Flag- and HA-tagged STAT1 and/or STAT3. We next
examined the functions of the restored STAT1 and STAT3 in these cells. Expression
of STAT1- or STAT3-downstream genes was measured by RT-QPCR. After IFN-α4
stimulation for 1 hour and 2 hours, Socs3 and JunB, two STAT3-dependent genes,
were upregulated, respectively, in STAT3- and STAT1/3-restored DKO MEFs (Fig. 3).
ISGs, including PKR, IP-10, IRF7, IFIT1, and IFIT2, were induced in STAT1 and
STAT1/3-restored DKO MEFs. Consistent with previous studies, the expressions of
ISGs were decreased in the STAT1/3-restored DKO MEFs as compared to
STAT1-restored DKO MEFs (Fig. 4). Besides, we also perform microarray to do
whole gene profiling, and found that there were 137 type I IFN-induced genes, such
as STAT2, IRF1, OAS2, and MX1, displaying the same phenotype (Fig. 5). The
scatterplot, which showed relationship of gene expression, showed that it a good
approach to do the experiment (Fig.6 and Fig. 7A). It revealed that STAT3 could exert
suppressive effect in STAT1/3-induced DKO MEFs as compared with STAT1-restored
DKO MEFs (Fig. 7B). Furthermore, we used antiviral state assay to confirm negative
effect of STAT3 on type I IFN-mediated antiviral response. As shown in Fig. 8 EV
and STAT3-restored DKO MEFs were susceptible to EMCV infection, which was due
to the absence of STAT1. STAT1- and STAT1/3-restored DKO MEFs were resistant to
EMCV infection. Nevertheless, single restoration of STAT1 showed more resistant to
20
EMCV infection than did STAT1/3 double restoration in DKO MEFs. These results
indicate that the phenotype of STAT1- and STAT3-restored DKO MEFs indeed
mimicked the phenotypes seen in STAT3KO and WT MEFs, respectively.
3.2 Suppression of type I IFN response by STAT3 is independent of phosphorylation and nuclear translocation of STAT1 or STAT2
Negative regulation of type I IFN by STAT3 may due to competition for receptor
occupancy to decrease the phosphorylation of STAT1 or STAT2. To examine this
possibility, STAT-restored DKO MEFs were treated with IFN-α4 for different times
and activation of STAT1 and STAT2 was assessed. As shown in Fig. 9,
phosphorylation of STAT1 was transient and decreased in the time-dependent manner,
and the activation of STAT2 was prolonged and remained, at least, for 18 hours.
However, STAT1/3-restored DKO MEFs failed to alter IFN-α-induced activation of
STAT1 and STAT2 as compared to STAT1-restored DKO MEFs. These results
suggested that STAT3 did not affect kinetics of phosphorylation of STAT1 or STAT2,
and it also implied that STAT3 does not compete receptor occupancy with STAT1 or
STAT2. We next investigate whether STAT3 influences nuclear translocation of
STAT1 or STAT2. After IFN-α4 treatment, the level of nuclear STAT1 or STAT2 was
comparable in STAT1- and STAT1/3-restored DKO MEFs, suggesting that STAT3 did
21
not alter nuclear translocation of activated STAT1 and STAT2 following stimulation
(Fig. 10).
3.3 STAT3 suppresses type I IFN-mediated response through blocking the recruitment of ISGF3 complex to ISRE in the ISGs promoters
Since STAT3 did alter phosphorylation or nuclear translocation of STAT1 and
STAT2, we next examined whether STAT3 influenced the binding of ISGF3 complex
binding to ISRE containing promoter using ChIP assay. After IFN-α4 stimulation,
STAT1-containing ISGF3 complex was recruited to the ISRE of IFIT1 and MDA5 in
STAT1-restored DKO MEFs. However, the binding of STAT1 on ISRE site of IFIT1
and MDA5 was reduced in STAT1/3-restored DKO MEF as compared to
STAT1-restored DKO MEFs (Fig. 11), suggesting that STAT3 attenuated ISGF3
complex binding and/or recruitment to the promoter of ISRE of ISGs.
3.4 STAT3 negatively regulates type I IFN-induced gene expression through acetylation-dependent mechanism by HDAC inhibitor
It has been reported that the interaction of STAT1 with p300 can increase the
binding ISGF3 complex to ISRE (Zhang et al., 2005b). However, whether STAT1 and
histone of ISRE promoter require acetylation is still controversial. We next
investigated if acetylation was involved in the suppressive effect of STAT3 by using a
22
HDAC inhibitor, SAHA. The results showed that ISRE gene expression decreased in
the high dose of SAHA treatment, but in 0.1 μM SAHA stimulation, type I
IFN-mediated gene induction decreased only in STAT1- but not STAT1/3-restored
DKO MEFs (Fig. 12). These results suggested that STAT3 may regulate type I IFN
signaling response through acetylation mechanism.
3.5 Lysine 49 and lysine 87 of STAT3 are important for inhibition of type I IFN-mediated gene induction
We have previously shown that NTD alone is sufficient to suppress
STAT1-dependent gene expression (Wang et al., 2011). NTD of STAT3 has two lysine
residues at positions 49 and 87. Acetylation of Lys 49 and 87 is shown to be critical
for STAT3 activation (Ray et al., 2005). K to R mutations in these two positions
decreases the interaction of STAT3 with p300 and HDAC1 (Hou et al., 2008; Ray et
al., 2008). Therefore, we next examined whether acetylation at NTD of STAT3 is
crucial for the suppressive effect of STAT3. Site-directed mutagenesis was performed
to generate STAT3 acetylation-deficient K49R or/and K87R (STAT349R, STAT387R,
and STAT3RR) mutants, and STAT3 acetylation mimics K49Q or/and K87Q
(STAT349Q, STAT387Q, and STAT3QQ) mutants. EV, WT STAT3, or mutant STAT3s
was transfected into STAT3KO MEFs, and the protein expression level was shown to
23
be comparable (Fig. 13). We further detected acetylation of mutant STAT3, and found
RR mutant STAT3 can not be acetylated (Fig. 14). WT STAT3, STAT349Q, STAT387Q,
and STAT3QQ could induce Scos3 and JunB expression in response to IFN-α4
stimulation, while the expression was diminished in STAT349R, STAT387R, and
STAT3RR mutant-restored cells (Fig. 15). However, both STAT3 acetylation-deficient
and STAT3 acetylation mimics mutant failed to negatively regulate type I
IFN-triggered gene expression except for STAT387R mutant (Fig. 16). These results
suggested that suppression effect of STAT3 is dependent on posttranslational
modification of Lys49 and Lys87.
3.6 Acetylation of STAT3 at Lys 685 also plays a critical role for suppression of type I IFN-induced gene production
K685 of STAT3 blocks acetylation, decreases STAT3 downstream gene induction,
and inhibits the interaction with DNMT1 (Lee et al., 2012; Yuan et al., 2005). Hence,
we further investigated whether K685 of STAT3 is involved in suppression of type I
IFN-mediated gene expression. K685R mutant STAT3 was transfected to STAT3KO
MEFs, and revealed that STAT3685R also failed to suppress type I IFN-mediated gene
expression as compared to WT STAT3 (Fig. 17), suggesting that K49, K87, and K685
of STAT3 are important to exert suppressive function.
24
Chapter IV Discussion
Using gain-of-fuction approach by restoring STAT1 and/or STAT3 into DKO
MEFs, we have confirmed the regulatory role of STAT3 in type I IFN response.
STAT1-restored DKO MEFs induced higher level of ISGs expressions and were more
resistant to EMCV infection than STAT1/3-restored DKO MEFs (Fig. 4, Fig. 5, and
Fig. 8). The negative effect of STAT3 is not working through activation or nuclear
translocation of STAT1 and STAT2 (Fig. 9 and Fig. 10), instead, it affects ISGF3
complex binding to ISRE in the promoter of ISGs (Fig. 11). In addition, acetylation of
STAT3 K49 and K87 at NTD and K685 plays a critical role in suppressive effect.
Nevertheless, the detailed mechanism remains to be determined.
4.1 Restored DKO MEFs could reduce the epigenetic difference between different cell lines
We generated STAT1- and/or STAT3-restored DKO MEFs to reduced variation
of epigenetics in WT and STAT3KO MEFs. Although retroviral transduction may
cause some gene overexpression or blockage, and affect cells phenotype, the
microarray results suggest the basal gene expression before IFN treatment were
comparable between different restored cells, confirming our hypothesis. In addition,
25
IFN-α-induced gene expression in STAT1- and STAT1/STAT3-restored DKO MEFs
were at similar magnetitude, despite a negative effect of STAT3 (Fig. 6). Moreover,
most of genes induced by IFN-α4 were known ISGs and the induction was eliminated
in EV-restored DKO MEFs (Fig. 7A), suggesting that gain-of-function is better than
loss-of-function approach in determing function of genes of interests.
4.3 Acetylated site of STAT3 is critical for the negative regulation
It has been shown that STAT3 could inhibit the expression of tumor suppressor
genes through the interaction with DNMT1 (Zhang et al., 2005a). In malignant T
lymphocytes, STAT3 was bound to the promoter of SHP-1 with DNMT1 and HDAC1,
resulting in DNA methylation and gene silencing. Besides, acetylation of STAT3 at
K685 was important for the interaction with DNMT1 (Lee et al., 2012). Acetylated
STAT3 was also increased in melanoma tissue as compared to normal skin cells,
which enhanced methylation of tumor suppressor genes through DNMT1. Taken
together, these data indicated that acetylated STAT3 could interact with DNA
modifying-enzymes, leading to suppression of gene expression. In this study, we
found that K685 of STAT3 also blocked its suppressive effect. In addition to K685,
K49 and K87 at STAT3 NTD are also involved in suppressing type I IFN-mediated
responses. For the moment, it is still unclear how K49 and K87 may contribute to the
26
effect. We propose that acetylation of STAT3 in K49, K87, and K685 is required for
interacting with HDAC1 or p300, which facilitates the binding to DNMT1, resulting
in methylation of ISRE in the promoters of ISGs and blocking the recruitment of
ISGF3.
4.4 STAT3 directly suppressed type I IFN-induced gene expression
Yu’s group showed that STAT3 and DNMT1 could bind to promoter of STAT1,
which is also an ISG, in cancer cells upon tumor conditioned medium treatment (Lee
et al., 2012). Interaction of acetylated STAT3 with DNMT1 resulted in DNA
methylaton, and gene silencing. Furthermore, in our microarray data, we found that
IFIT2 was decreased in STAT3-restored DKO MEFs after IFN-α4 treatment (Fig.
18A). It implies that STAT3 could directly inhibit type I IFN-mediated gene
expression independent of STAT1. In addition to IFIT2, endonuclease domain
containing 1 (ENDOD1), which is upregulated upon type I IFN treatment in
peripheral blood mononuclear cell (PBMC) (Baechler et al., 2003), was also suppressed by STAT3 in STAT3-restored DKO MEFs (Fig. 18B). These results indicated STAT3 not only affect ISGFs binding to promoter of ISRE and indirectly
regulates some ISGs, but it also directly silences gene expression.
27 References
Akira, S., Nishio, Y., Inoue, M., Wang, X.J., Wei, S., Matsusaka, T., Yoshida, K., Sudo,
T., Naruto, M., and Kishimoto, T. (1994). Molecular cloning of APRF, a novel
IFN-stimulated gene factor 3 p91-related transcription factor involved in the
gp130-mediated signaling pathway. Cell 77, 63-71.
Antunes, F., Marg, A., and Vinkemeier, U. (2011). STAT1 signaling is not regulated
by a phosphorylation-acetylation switch. Mol. Cell. Biol. 31, 3029-3037.
Bach, E.A., Aguet, M., and Schreiber, R.D. (1997). The IFN gamma receptor: a
paradigm for cytokine receptor signaling. Annu. Rev. Immunol. 15, 563-591.
Baechler, E.C., Batliwalla, F.M., Karypis, G., Gaffney, P.M., Ortmann, W.A., Espe,
K.J., Shark, K.B., Grande, W.J., Hughes, K.M., Kapur, V., et al. (2003).
Interferon-inducible gene expression signature in peripheral blood cells of patients
with severe lupus. Proc. Natl. Acad. Sci. U. S. A. 100, 2610-2615.
Biron, C.A. (2001). Interferons alpha and beta as immune regulators--a new look.
Immunity 14, 661-664.
Bowie, A.G., and Unterholzner, L. (2008). Viral evasion and subversion of
pattern-recognition receptor signalling. Nat. Rev. Immunol. 8, 911-922.
Chang, H.M., Paulson, M., Holko, M., Rice, C.M., Williams, B.R., Marie, I., and
Levy, D.E. (2004). Induction of interferon-stimulated gene expression and antiviral
28
responses require protein deacetylase activity. Proc. Natl. Acad. Sci. U. S. A. 101,
9578-9583.
Chin, K.C., and Cresswell, P. (2001). Viperin (cig5), an IFN-inducible antiviral
protein directly induced by human cytomegalovirus. Proc. Natl. Acad. Sci. U. S. A. 98,
15125-15130.
Chung, C.D., Liao, J., Liu, B., Rao, X., Jay, P., Berta, P., and Shuai, K. (1997).
Specific inhibition of Stat3 signal transduction by PIAS3. Science 278, 1803-1805.
Costa-Pereira, A.P., Tininini, S., Strobl, B., Alonzi, T., Schlaak, J.F., Is'harc, H.,
Gesualdo, I., Newman, S.J., Kerr, I.M., and Poli, V. (2002). Mutational switch of an
IL-6 response to an interferon-gamma-like response. Proc. Natl. Acad. Sci. U. S. A.
99, 8043-8047.
de Weerd, N.A., Samarajiwa, S.A., and Hertzog, P.J. (2007). Type I interferon
receptors: biochemistry and biological functions. J. Biol. Chem. 282, 20053-20057.
Durbin, J.E., Hackenmiller, R., Simon, M.C., and Levy, D.E. (1996). Targeted
disruption of the mouse Stat1 gene results in compromised innate immunity to viral
disease. Cell 84, 443-450.
Grander, D., Sangfelt, O., and Erickson, S. (1997). How does interferon exert its cell
growth inhibitory effect? Eur. J. Haematol. 59, 129-135.
Ho, H.H., and Ivashkiv, L.B. (2006). Role of STAT3 in type I interferon responses.
29
Negative regulation of STAT1-dependent inflammatory gene activation. J. Biol. Chem.
281, 14111-14118.
Horvai, A.E., Xu, L., Korzus, E., Brard, G., Kalafus, D., Mullen, T.M., Rose, D.W.,
Rosenfeld, M.G., and Glass, C.K. (1997). Nuclear integration of JAK/STAT and
Ras/AP-1 signaling by CBP and p300. Proc. Natl. Acad. Sci. U. S. A. 94, 1074-1079.
Hou, T., Ray, S., Lee, C., and Brasier, A.R. (2008). The STAT3 NH2-terminal domain
stabilizes enhanceosome assembly by interacting with the p300 bromodomain. J. Biol.
Chem. 283, 30725-30734.
Hutchins, A.P., Poulain, S., and Miranda-Saavedra, D. (2012). Genome-wide analysis
of STAT3 binding in vivo predicts effectors of the anti-inflammatory response in
macrophages. Blood 119, e110-119.
Isaacs, A., and Lindenmann, J. (1957). Virus interference. I. The interferon. Proc. R.
Soc. Lond. B. Biol. Sci. 147, 258-267.
Isaacs, A., Lindenmann, J., and Valentine, R.C. (1957). Virus interference. II. Some
properties of interferon. Proc. R. Soc. Lond. B. Biol. Sci. 147, 268-273.
Kim, T.K., and Maniatis, T. (1996). Regulation of interferon-gamma-activated STAT1
by the ubiquitin-proteasome pathway. Science 273, 1717-1719.
Komyod, W., Bauer, U.M., Heinrich, P.C., Haan, S., and Behrmann, I. (2005). Are
STATS arginine-methylated? J. Biol. Chem. 280, 21700-21705.
30
Kramer, O.H., Knauer, S.K., Greiner, G., Jandt, E., Reichardt, S., Guhrs, K.H.,
Stauber, R.H., Bohmer, F.D., and Heinzel, T. (2009). A phosphorylation-acetylation
switch regulates STAT1 signaling. Genes Dev. 23, 223-235.
Lee, H., Zhang, P., Herrmann, A., Yang, C., Xin, H., Wang, Z., Hoon, D.S., Forman,
S.J., Jove, R., Riggs, A.D., and Yu, H. (2012). Acetylated STAT3 is crucial for
methylation of tumor-suppressor gene promoters and inhibition by resveratrol results
in demethylation. Proc. Natl. Acad. Sci. U. S. A. 109, 7765-7769.
Levy, D.E., and Darnell, J.E., Jr. (2002). Stats: transcriptional control and biological
impact. Nat Rev Mol Cell Biol 3, 651-662.
Liao, J., Fu, Y., and Shuai, K. (2000). Distinct roles of the NH2- and COOH-terminal
domains of the protein inhibitor of activated signal transducer and activator of
transcription (STAT) 1 (PIAS1) in cytokine-induced PIAS1-Stat1 interaction. Proc.
Natl. Acad. Sci. U. S. A. 97, 5267-5272.
Lim, C.P., and Cao, X. (2006). Structure, function, and regulation of STAT proteins.
Mol Biosyst 2, 536-550.
Liu, S.Y., Sanchez, D.J., and Cheng, G. (2011). New developments in the induction
and antiviral effectors of type I interferon. Curr. Opin. Immunol. 23, 57-64.
Makarova, O., Kamberov, E., and Margolis, B. (2000). Generation of deletion and
point mutations with one primer in a single cloning step. Biotechniques 29, 970-972.
31
Malakhova, O.A., Yan, M., Malakhov, M.P., Yuan, Y., Ritchie, K.J., Kim, K.I.,
Peterson, L.F., Shuai, K., and Zhang, D.E. (2003). Protein ISGylation modulates the
JAK-STAT signaling pathway. Genes Dev. 17, 455-460.
Meissner, T., Krause, E., Lodige, I., and Vinkemeier, U. (2004). Arginine methylation
of STAT1: a reassessment. Cell 119, 587-589; discussion 589-590.
Meraz, M.A., White, J.M., Sheehan, K.C., Bach, E.A., Rodig, S.J., Dighe, A.S.,
Kaplan, D.H., Riley, J.K., Greenlund, A.C., Campbell, D., et al. (1996). Targeted
disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the
JAK-STAT signaling pathway. Cell 84, 431-442.
Mui, A.L. (1999). The role of STATs in proliferation, differentiation, and apoptosis.
Cell. Mol. Life Sci. 55, 1547-1558.
Nelson, J.D., Denisenko, O., and Bomsztyk, K. (2006). Protocol for the fast chromatin
immunoprecipitation (ChIP) method. Nat Protoc 1, 179-185.
Nusinzon, I., and Horvath, C.M. (2003). Interferon-stimulated transcription and innate
antiviral immunity require deacetylase activity and histone deacetylase 1. Proc. Natl.
Acad. Sci. U. S. A. 100, 14742-14747.
Ohbayashi, N., Kawakami, S., Muromoto, R., Togi, S., Ikeda, O., Kamitani, S.,
Sekine, Y., Honjoh, T., and Matsuda, T. (2008). The IL-6 family of cytokines
modulates STAT3 activation by desumoylation of PML through SENP1 induction.
32 Biochem. Biophys. Res. Commun. 371, 823-828.
Pestka, S., Krause, C.D., and Walter, M.R. (2004). Interferons, interferon-like
cytokines, and their receptors. Immunol. Rev. 202, 8-32.
Ray, S., Boldogh, I., and Brasier, A.R. (2005). STAT3 NH2-terminal acetylation is
activated by the hepatic acute-phase response and required for IL-6 induction of
angiotensinogen. Gastroenterology 129, 1616-1632.
Ray, S., Lee, C., Hou, T., Boldogh, I., and Brasier, A.R. (2008). Requirement of
histone deacetylase1 (HDAC1) in signal transducer and activator of transcription 3
(STAT3) nucleocytoplasmic distribution. Nucleic Acids Res 36, 4510-4520.
Robertson, G., Hirst, M., Bainbridge, M., Bilenky, M., Zhao, Y., Zeng, T., Euskirchen,
G., Bernier, B., Varhol, R., Delaney, A., et al. (2007). Genome-wide profiles of
STAT1 DNA association using chromatin immunoprecipitation and massively parallel
sequencing. Nat Methods 4, 651-657.
Rogers, R.S., Horvath, C.M., and Matunis, M.J. (2003). SUMO modification of
STAT1 and its role in PIAS-mediated inhibition of gene activation. J. Biol. Chem. 278,
30091-30097.
Sadler, A.J., and Williams, B.R. (2008). Interferon-inducible antiviral effectors.
Nature reviews. Immunology 8, 559-568.
Nature reviews. Immunology 8, 559-568.