J. Biol. Chem. 2004; 279: 30158-67.
39. Ellison DW, Miller VL. Regulation of virulence by members of the
MarR/SlyA family. Curr. Opin. Microbiol. 2006; 9: 153-9.
40. Nasser W, Shevchik VE, Hugouvieux-Cotte-Pattat N. Analysis of three
clustered polygalacturonase genes in Erwinia chrysanthemi 3937 revealed an
anti-repressor function for the PecS regulator. Mol. Microbiol. 1999; 34:
641-50.
41. Hugouvieux-Cotte-Pattat N, Shevchik VE, Nasser W. PehN, a
polygalacturonase homologue with a low hydrolase activity, is coregated with
the other Erwinia chrysanthemi polygalacturonases. J. Bacteriol. 2002; 184:
2664-73.
42. Alekshun MN, Lecy SB, Mealy TR, Seaton BA, Head JF. The crystal structure
of MarR, a regulator of multiple antibiotic resistance, at 2.3 Å resolution. Nat.
Struct. Biol. 2001; 8: 710-4.
43. Mol O, Oudega B. Molecular and structural aspects of fimbriae biosynthesis
and assembly in Escherichia coli. FEMS Microbiol. Rev. 1996; 19: 25-52.
44. Newman EB, D’ari R, Lin RT. The leucine-Lrp regulon in E. coli: A global
response in search of a raison d'Être. Cell 1992; 68: 617-9.
45. Boddicker JD, Anderson RA, Jagnow J, Clegg S. Signature-tagged
mutagenesis of Klebsiella pneumoniae to identify genes that influence biofilm
formation on extracellular matrix material. Infect. Immun. 2006; 74: 4590-7.
46. Huang YJ. Characterization of type 3 fimbriae in Klebsiella pneumoniae.
National Chiao Tung University. Department of Biological Science and
Technology, 2007.
47. Dower WJ, Miller JF, Ragsdale CW. High efficiency transformation of E. coli
by high voltage electroporation. Nucleic Acids Res. 1988; 16: 6127-45.
48. Miller JH. Experiments in Molecular Genetics. Cold Spring Harbor
Laboratroy Press. Cold Spring Harbor, NY. 1972.
49. Baker CN, Stocker SA, Culver DH, Thornsberry C. Comparison of the E Test
to agar dilution, broth microdilution, and agar diffusion susceptibility testing
techniques by using a special challenge set of bacteria. J. Clin. Microbiol.
1991; 29 (3): 533-8.
50. Schembri MA, Klemm P. Biofilm formation in a hydrodynamic environment
by novel fimh variants and ramifications for virulence. Infect Immun. 2001;
69: 1322-8.
51. Saulino ET, Thanassi DG, Pinkner JS, Hultgren SJ. Ramification of kinetic
partitioning on usher-mediated pilus biogenesis. EMBO J. 1998; 17: 2177-85.
52. Bishop RE, Leskiw BK, Hodges RS, Kay CM, Weiner JH. The entericidin
locus of Escherichia coli and its implications for programmed bacterial cell
death. J. Mol. Biol. 1998; 280: 583-96.
53. Paulsen TT, Skurray RA, Tam R, Saier MH, Turner RJ, Weiner JH, Goldberg
EB, Grinius LL. The SMR family: a novel family of multidrug efflux proteins
involved with the efflux of lipophilic drugs. Mol. Microbiol. 1996; 19:
1167-75.
54. Phadtare S, Yamanaka K, Inouye M. Bacterial Stress Responses. ASM Press.
Washington, DC 20036-2804. 2000; 33-45.
55. Bernstein C, Bernstein H, Payne CM, Beard SE, Schneider J. Bile salt
activation of stress response Promoters in Escherichia coli. Curr Microbiol.
1999; 39: 68-72.
56. Lin TL, Tang SI, Fang CT, Hsueh PR, Chang SC, Wang JT.
Extended-spectrum β-lactamase genes of Klebsiella pneumoniae strains in
Taiwan: recharacterization of shv-27, shv-41, and tem-116. Microb Drug
Resist. 2006; 12: 12-5.
57. Zuo B, Liu ZH, Wang HP, Yang YM, Chen JL, Ye HF. Genotype of TEM- and
SHB-type beta-lactamase producing Klebsiella pneumoniae in Guangzhou
area. Zhonghua Yi Xue Za Zhi. 2006 Nov 7; 86(41):2928-32.
58. Lai YC, Peng HL, Chang HY. Identification of genes induced in vivo during
Klebsiella pneumoniae CG43 infection. Infect Immun. 2001; 69: 7140-5.
59. Skorupski K, Taylor RK. Positive selection vectors for allelic exchange. Gene
1996; 169: 47-52.
60. Lin CT, Huang TY, Liang WC, Peng HL. Homologous response regulators
KvgA, KvhA and KvhR regulate the synthesis of capsular polysaccharide in
Klebsiella pneumoniae CG43 in a coordinated manner. J. Biochem. (Tokyo).
2006; 140: 429-38.
61. Jeong SH, Bae IK, Lee JH, Sohn SG, Kang GH, Jeon GJ, Kim YH, Jeong BC,
Lee SH. Molecular characterization of extended-spectrum beta-lactamase
produced by clinical isolates of Klebsiella pneumoniae and Escherichia coli
from a Korean nationwide survey. J. Clin. Microbiol. 2004; 42 (7): 2902-6.
62. Tzouvelekis LS, Bonomo RA. SHV-type beta-lactamase. Curr. Pharm. Des.
1999; 5 (11): 847-64.
Table 1. Bacterial strains and plasmids used in this study (A)
Strain or plasmid Description Reference
Strain
PPfimA ~500-bp BamHI fragment containing the putative fimA promoter, cloned into BamHI site of placZ15 (46) pPfimB ~500-bp BamHI fragment containing the putative fimB promoter, cloned into BamHI site of placZ15 (46) pPfimE ~500-bp BamHI fragment containing the putative fimE promoter, cloned into BamHI site of placZ15 (46) pPmrkA ~500-bp BamHI fragment containing the putative mrkA promoter, cloned into BamHI site of placZ15 (46)
(B)
Plasmid Description
pPkpaA 580-bp BamHI fragment containing the putative kpaA promoter, cloned into BamHI site of placZ15 pPkpbA 639-bp BamHI fragment containing the putative kpbA promoter, cloned into BamHI site of placZ15 pPkpbR 639-bp BamHI fragment containing the putative kpbR promoter, cloned into BamHI site of placZ15 pPkpdA 602-bp BamHI fragment containing the putative kpdA promoter, cloned into BamHI site of placZ15 pPkpdR 602-bp BamHI fragment containing the putative kpdR promoter, cloned into BamHI site of placZ15 pPkpfA 746-bp BamHI fragment containing the putative kpfA promoter, cloned into BamHI site of placZ15 pPkpgA 578-bp BamHI fragment containing the putative kpgA promoter, cloned into BamHI site of placZ15 pPkpgA1 420-bp BamHI fragment containing the putative kpgA promoter, cloned into BamHI site of placZ15 pPkpgA2 388-bp BamHI fragment containing the putative kpgA promoter, cloned into BamHI site of placZ15 pPmrkAt 386-bp BamHI fragment containing the putative mrkA promoter, cloned into BamHI site of placZ15 pKpdR 867-bp EcoRI fragment containing the kpdR of K. pneumoniae NTUH-K2044, cloned into pETQ33, Kmr pKpbR 843-bp EcoRI fragment containing the kpbR of K. pneumoniae NTUH-K2044, cloned into pETQ33, Kmr pKpfR 893-bp EcoRI fragment containing the kpfR of K. pneumoniae NTUH-K2044, cloned into pETQ33, Kmr
Table 2. Primers used in this study
Primer Sequence Complementary position
ZY001 5'-CAT ATGAAAAAATACAGCAGAGGAATGG-3' -3 relative to the kpdA start codon ZY002 5'-GCGGGTGGAGCATAACTTTG-3' +371 relative to the kpdD stop codon ZY003 5'-CATATGAAAATGAAATCACTTTGCCTGG-3' -3 relative to the kpfA start codon ZY004 5'-ATGGTGACTTTCGCCCTGGAG-3' +45 relative to the kpfD stop codon ZY005 5'-CATATGAAAAAACAACCTCGCTTTATAACC-3' -3 relative to the kpgA start codon ZY006 5'-CGAGAACGCCGAAGCTGG-3' +77 relative to the kpgD stop codon ZY007 5'- GATCCGAATTCGCCAAAACC -3' +1289 relative to the kpgC start codon ZY008 5'- GGTTTTGGCGAATTCGGATC -3' -1284 relative to the kpgC stop codon ZY009 5’-CTGCGGGATCCTGTGGGCTG-3’ -102 relative to the kpbR start codon ZY010 5’-GACCAGCAAATGACTATCGCACC-3’ +52 relative to the kpbR stop codon ZY011 5’-CCAGGGGATCCTTATGTTGATCTGC-3’ -13 relative to the kpdR start codon ZY012 5’-CTGGGCGTGGCGAGTAATG-3’ +177 relative to the kpdR stop codon ZY013 5’-CATGCAACATCTTTCATTAGGATCCTTC-3’ -30 relative to the kpfR start codon ZY014 5’-CCGACGAGTGCCATTGCCAG-3’ +41 relative to the kpfA start codon
ZY101 5'-CGCTCATGAGACAATAACCC-3' -56 relative to the blaTEM-116 start codon (56) ZY102 5'-CAGTGAGGCACCTATCTC-3' -51 relative to the blaTEM-116 stop codon (56) ZY013 5’-CATTTTGCCTTCCTGTTTTTG-3’ +67 relative to the blaTEM-116 start codon ZY104 5’-CTACGATACGGGAGGGCTTACC-3’ -129 relative to the blaTEM-116 stop codon ZY105 5'-GTAGGATCCGACGAGCGCAC-3' -442 relative to the kpgA start codon ZY106 5'-GAATGGATCCGTTGTTGTTTAAAGG-3' -373 relative to the kpgA start codon ZY107 5'-CTGGATCCTGTTGCGGTC-3' -358 relative to the mrkA start codon pCC033 5’-CGTGCGCTGGATCCTGTT-3’ -532 relative to the kpaA start codon pCC034 5’-TAAAAGATCTATGGCGGGTGC-3’ +50 relative to the kpaA start codon pCC035 5’-GCATTGAGGCGGATCCACT-3’ -597 relative to the kpbA start codon pCC036 5’-GGTCGCTAGATCTGCAGTGC-3’ +46 relative to the kpbA start codon pCC039 5’-CGGATCCGCATATGCTGA-3’ -555 relative to the kpdA start codon pCC040 5’-GCCGCTGACGGGAAGATCT-3’ +46 relative to the kpdA start codon pCC043 5’-ACAGGCCGGATCCATGAC-3’ -681 relative to the kpfA start codon pCC044 5’-GCTGGCCTTAGATCTGGCTAC-3’ +59 relative to the kpfA start codon pCC045 5’-GGATCCGGTCTCTGGTTAACAT-3’ -526 relative to the kpgA start codon pCC046 5’- CCATCCTCATAGGAGCGCTGCT-3’ +47 relative to the kpgA start codon
Table 3. Effect of culture condition on the fimbrial expression
Promoter activity (Miller units)a Fimbriae
Growth conditions kpaA kpdA kpdR kpfA kpgA fimA fimB fimE mrkA
Aerated culture (37℃) 183.2 (±10.7) Standing culture (37℃) 272.6
(±12.9)