खज༸ಒझ(Embryonic stem celltǴᙁᆀ ES cells)ǴٰԾܭথ٢ނ៶ख ϣޑϣखቫಒझǴڀԖคज़ғߏૈΚ٠ЪёаϩϯࣁҺՖΟखቫύޑಒझ (1-3)Ƕҗܭखज༸ಒझӕਔڀԖԾך׳ཥکϩϯԋӭᅿಒझᜪࠠޑૈΚǴ ჹܭᖏޑಒझᕍݤǴᏱԖѮεޑወΚ(4)ǶӢԜǴΓॺයࡑखज༸ಒझё аҔܭΑှ҂ޕޑੰᐒᙯǴཥᛰ໒วύᑔᒧԖਏ܄کӼӄ܄ޑࡰǴа ϷݯᕍکڋӚᅿ੯ੰ(3, 5)ǴٯӵǺମᡎ౽[hematopoietic stem cells (HSCs)]ᔈҔܭқՈੰǵՈ϶ੰک೦Ոǹ໔፦༸ಒझ[Mesenchymal stem cells (MSCs)]ᔈҔܭલՈ܈ཞکՉԖਏޑՈᆅӆғǴঅൺڙཞୱ(6)Ƕӧа
ޑࣴزύǴखज༸ಒझёаϩϯԋӭЃữઓϡՉಒझݯᕍ(7)ǶՠࢂǴ खज༸ಒझҔܭಒझݯᕍԖٿঁεୢᚒǺБय़Ѹሡय़ᖏউၰቺݾޑ
ୢᚒǴќБय़߾ࢂޣ౽ࡕౢғխࣝ௨ѾޑୢᚒǴᏤठखज༸ಒझޑ ᔈҔڙډߔᛖǶ
ᇨᏤࠠӭૈ༸ಒझ(Induced pluripotent stem cellsǴᙁᆀ iPS cells) ࢂࣴز
༸ಒझݯᕍ࣬ख़ाޑཥᑉሦୱǶiPS cells ࢂஒ Oct4, Sox2, c-Myc ک Klf4 ೭Ѥঁ୷ӢᙯࢉΕԴႵ܈Γᜪޑᠼᆢ҆ಒझ܌ғԋ(3, 8)ǶiPS ᆶ ES cells ޑ܄ߚத࣬՟ǴόࢂቚૈΚǵಒझࠠᄊǵ୷Ӣ߄ǵಒझ߄य़לচǵ
ᆄಈ䁙ࢲ܄ǴᗋԖ୷ӢፓҘ୷ϯޑ AP genetic site ࣬ठǶiPS cells 1.1.2 Leukemia Inhibitory Factor (LIF) ک Jak2-Stat3 signaling pathway
ᗨฅٰԾόӕނޑखज༸ಒझ܄کᆢԖ܌όӕǴԴႵޑखज༸
ಒझᎦਔǴሡाၸқՈౚቚғڋӢη(Leukemia inhibitory factorǴᙁ ᆀ LIF)ٰᆢखज༸ಒझޑԾך׳ཥૈΚ(11-13)ǶLIF ࢂឦܭ IL-6 ৎޑ
ǴѬёаᇨᏤԴႵखज༸ಒझғߏǴ٠ЪڋԴႵखज༸ಒझϩϯ (14-16)ǶLIF ߾ࢂၸᆶ LIF receptor ک gp130 [IL-6 ৎޑӅӕڙᡏ(IL-6, IL-11, CNTF, OSMک LIF)] (17-21)ፄӝނ่ӝǴࢲϯ Janus kinase (Jak)ک signal transducer and activator of transcription (Stat)ǴԶ٬खज༸ಒझёаᆢ
Ծך׳ཥૈΚکӭૈ܄Ȑკȑ(22-24)Ƕ
Jak (Janus Kinases)ޑৎԋх֖ Jak1ǵJak2ǵJak3ǵTYK2 (Tyrosine Kinase 2)ǴѬॺՏܭಒझጢϣୁ٠ߕܭڙᏔǴࣣឦܭߚڙᏔೈқᐟ䁙 (nonreceptor protein kinases)Ǵϩηໆϟܭ 120~135 KDa ϐ໔ǹJaks ֖Ύঁᐟ 䁙ୱ(JH domains 1~7)ǴՠѝԖ C ᆄޑ JH1 domain ڀഢϯࢲ܄ǴԶ N
ᆄϐ JH6 domain ک JH7 domain ᆶڙᏔϐ໔ࣣԖҬϕբҔ(25)Ƕ
ӧ Jak ޑৎԋύǴJak2 ܭҁጇፕЎ္תᄽঁख़ाޑفՅǹJak2
ࢂୖᆶܭ cytokine receptor signaling ύႀữለᐟ䁙ৎޑǴᙖҗ IL-6 ৎ
ޑ cytokines ၸ gp130 ܈ځдଯ߄ޑ LIFR ٰӅӕࢲϯ Jak2 (26-29)Ǵ
Զ٬ Stat3 ࢲϯǴᆢ༸ಒझޑԾך׳ཥૈΚکӭૈ܄Ƕ
Stats (signal transducer and activator of transcription) ၸJak2ۚύϟᏤ٬
ځႀữለූ୷ᕗለϯǴԋΒᆫᡏࢲϯǴ٠ᙯၮډಒझਡϣаᇨᏤ౦
܄ޑ୷Ӣಔ(30, 31)Ƕӧথ٢ᜪނύǴStatsԿҞࣁЗςԖΎঁৎԋ
ዴᇡрٰǴϩձࢂStat1ǵStat2ǵStat3ǵStat4ǵStat5aǵStat5bǵStat6Ǵځ ϩηໆϟܭ75~95 KDaϐ໔ǹԶStatsڀԖѤঁӅӕߥ੮ୱǴх֖ΑSH2 domainǵLinker domainǵDNA binding domainǵCoiled-coil domainǴ೭Ѥঁ
ୱᆢΑStatsޑ୷ҁ่ᄬکфૈǴԿܭځCᆄޑTAD(transcriptional activation domain)߾ڀԖ௴୷Ӣᙯᒵϐфૈ(32, 33)Ƕ
ӧStatsޑΎঁৎԋύǴStat3ࢂgp130ૻ৲ሀޑനЬाፓޣ(31,
1.1.3 n-Butylidenephthalide (BP) ࣬ᜢғނࢲ܄ϐࣴز
Angelica sinensis ࣁゾࣽނឦܭӭԃғҁނǴࢂךॺ߫ᆀ ޑᘜǴᘜਥёΕᛰǴࢂനதҔޑύᛰϐǶᘜӧύᛰ္ё
բံࠔǴӧᖏύёҔܭံՈࢲՈǵፓЗภǴዎဉ೯ߡ (47)ǹӧ ऍ୯ΨᔈҔܭᖏ൳ঁࣽੱރ (48)ǶҞǴςவᘜਥϩᚆளډϤ ᅿϯӝނǺ(E)-liguistilide, (Z)-ligustilide, (Z)-n-butylidenephthalide, palmitic acid, beta-sitosterol ک ferulic acid (47)Ǵځύ n-Butylidenephthalide (კΒ)ࣁന Ьाಔԋԋϩ(ຬၸ 30%)Ƕ
ӧаޑࣴزύǴว BP ԖᡉޑלဍዦբҔǴόፕӧᡏϣ܈ᡏѦࣣ
ςჴ BP ёаᏤठൾ܄ဍዦғߏଶᅉǴ٠Ъၸ p53-dependent ک -independentޑૻ৲৩Չࢥఠᐒڋ٬ဍዦಒझΫ(49, 50)Ƕ
BPԖ൳ᅿᛰҔޑ܄ǴٯӵǺၸڋ cyclo-oxygenase ၲډלՈλ݈
ޑբҔ(51)ǹ෧Ј็ภޑੱރ(52, 53)ǶԜѦǴஒ BP ޑ่ᄬу hydroxyl
LIFǴ٠Ъගଯౢғ iPS cells ޑਏǶӢԜǴҁጇፕЎՉسӈޑჴᡍǴ
ჴவ Angelica sinensis ਥڗрٰޑપϯӝނ BPǴёаၸࢲϯ Jak2/Stat3ૻ৲ሀ৩Ǵٰᆢ ES cells ک iPS cells ޑӭૈ܄کԾך׳ཥ
ૈΚǴ٠Ъჴ๏ϒ BP ёаቚуౢғ iPS cells ޑਏǶ
ಃΒക ᆶБݤ
2.1 ಒझᎦ
2.1.1 ԴႵखजᠼᆢ҆ಒझ (Mouse Embryoic Fibroblasts)
Mouse Embryoic Fibroblasts (MEF)ࢂڗԾܭ C57BL / 6 ࠔس 13.5 Ϻޑज ႵǶஒ MEF Ꭶܭ֖Ԗ 10% FBSǴ1% penicillin-Streptomycin (Invitrogen)Ǵ 1% NEAA (Invitrogen)ǴаϷ 1% L-glutamine ޑ DMEM (Invitrogen) Ꭶన ύǴ٠ܫӧ 37ɗǵ5% CO2ϐᎦጃϣғߏǴٿϺඤԛᎦనǶಒ DMEMᎦనǴуΕӣྕޑ stem cell Ꭶన [42.5mL 1% L-glutamine ޑ
DMEM (Invitrogen) + 7.5mL Hyclon FBS (Thermo) + 0.5mL NEAA (Invitrogen) + 91l -mercaptoethanol (Invitrogen) + 5l leukemia inhibitory factor (Millipore) ] ǴܫԿ 37ɗǵ5% CO2ϐᎦጃϣᎦ 1 λਔǴӆஒ stem cellsᎦܭ֖Ԗ feeder cells ϐᎦҝϣǴ٠ܫӧ 37ɗǵ5 % CO2ϐᎦ ጃϣғߏǴܭٿϺࡕඤಃԛᎦనϐࡕሡϺ׳ඤᎦనǴаዴߥಒझ ғߏ܌ሡϐᎦϩкىǶ
2.2 ಒझӸࢲෳ၂ (MTT Assay)
3- (4,5-dimethyl-thiazol-2-yl) -2,5-diphenyl tetrazolium bromide (Sigma)ᙁ ᆀ MTTǴࣁՅНྋ܄ޑ tetrazolium saltǴtetrazolium bromide җࢲಒझ ಈጕᡏύϐณࣕለѐణ䁙 (mitrchondrial succinate dehydrogenases) жᖴᗋ চౢғόྋܭНޑ๋Յ؈ᐘނ formazanǴуΕ Isopropaonal ஒϐྋှǶѝԖ ࢲಒझϣϐಈጕᡏωӸӧڀԖࢲ܄ޑณࣕለѐణ䁙ǴӢԜёբࣁಒझᛰ ނೀࡕӸࢲޑࡰǶჴᡍᡯǺᝩжᎦࡕޑಒझǴၸಒझीኧǴ ٩ঁ well 5×103ޑଆۈಒझኧҞᎦܭ 96-well ޑ culture plate ύǴ24 λ ਔࡕ౽ନচᎦనǴуΕ֖Ԗςޕόӕᐚࡋ N-Butylidenephthalide (BP) ޑ ཥᗲᎦనǴၸόӕਔ໔ᗺᎦࡕǴܭঁ well ύϩձуΕ 10l ޑ MTT ྋన(0.5mg/mL)Ǵܫӧ 37 ɗǵ5% CO2ϐᎦጃϣբҔ 2~4 λਔࡕǴ౽ ନӄᎦనǴӆঁ well ϩձуΕ 100l ޑ IsopropaonalǴа 570nm ෳۓ ځ֎ӀॶǶஒуԖᛰނྋᏊ (DMSO) ޑಔձբࣁჹྣಔǴ٠аჴᡍಔϐ֎
Ӏॶঁձନаჹྣಔϐ֎ӀॶǴբკीᆉрಒझ࣬ჹӸࢲǶ
2.3 RNAޑڗϷ cDNA ޑᇙഢ
ಒझᎦԿ 7~8 ϩᅈਔǴ౽ନᎦనǴуΕ 1mL TRIzol (Invitrogen)Ǵ
࠻ྕᎦ 5 ϩដǴճҔڊஒಒझӄڊΠǴӆஒ֖Ԗಒझޑ TRIzol ౽Կ 1.5mL tubeύǴкϩஒಒझѺઇࡕǴܭ tube ύуΕ 0.2mL ChloroformǴΠ འਗ 15 ࣾǴ࠻ྕᎦ 2~3 ϩដǴ ᚆЈ (12000gǴ15 ϩដǴ4ɗ)ࡕǴஒ
మన౽Կќཥޑ 1.5mL tube ύǴӆуΕ 0.5mL Isopropyl-alcoholǴкϩష ӝࡕǴ࠻ྕᎦ 10 ϩដǴᚆЈ (12000gǴ10 ϩដǴ4ɗ) ࡕǴ౽ନమనǴ outǵ0.5l SSIII (Invitrogen)] Ъܭ 50ɗϸᔈ 30~60 ϩដࡕǴӆܭ 75ɗ ϸᔈ 15 ϩដࡕǴspin down ٠ᓯӸܭ-80ɗӇጃǶ
2.4 ջਔᆫӝ䁙ೱᙹϸᔈ (Real-time Polymerase Chain Reaction)
ךॺճҔ real-time PCR ٰୀෳ Oct4, Sox2, c-Myc, Klf4, Jak2, Stat3, LIF, EGF, IL5, IL11, EPOک OSM ೭٤୷Ӣޑ߄ໆǶჴᡍᡯǺڗ 4l ีញၸ
ޑ cDNA ϩձуΕԿ 96-well ϸᔈዬύǴௗϩձуΕ 6l ϸᔈྋన [0.5l 6M Forward Primer (߄) + 0.5l 6M Reverse Primer (߄) + 5l SYBR Green PCR Master mix (Roche)]Ǵ ֡ Ϭ ష ӝ Ϸ spin down ࡕ ܫ Ε StepOnePlus Real-Time PCR System (Applied Biosystems) ޑሺᏔύ 95ɗ 10ϩដǴӆՉ 40 ঁൻᕉයǺ95ɗ 15 ࣾǴ60ɗ 60 ࣾǶ่״ࡕǴႣෳޑ cycle threshold (CT)ॶޔௗճҔ EXCEL πբ߄ٰՉϩǶ
2.5 ᡵ܄ᕗለ䁙ࢉՅ (Alkaline Phosphatase Staining)
ஒ iPS cells ܈ ES cells Ꭶܭ 6-well ޑ culture plate ύǴ 48 λਔࡕ౽ ନচᎦనǴуΕ֖Ԗςޕόӕᐚࡋ N-Butylidenephthalide (BP) ޑཥᗲ
ᎦనǴၸόӕਔ໔ᗺᎦࡕǴஒᎦన౽ନǴӆуΕ PBS ዎమࢱಒझ ࡕ౽ନǴख़ፄమࢱ 2 ԛǶ౽ନᎦዬϣ PBS ࡕǴϩձஒ 1mL 80% ethanol уΕᎦዬϣǴ٠ܫܭ 4ɗڰۓ 2~24 λਔǶௗஒᎦዬϣ 80% ethanol
౽ନǴ٠а Distilled Water ዎమࢱಒझࡕ౽ନǴӆуΕ Distilled WaterǴܭ
࠻ྕݰ 2~3 ϩដࡕ౽ନǴӆа 100mM Tris-HCl buffer (pH 8.2~8.5) ܭ࠻ྕ
ύݰ 5 ϩដࡕ౽ନࡕǴ٬Ҕ Leukocyte Alkaline Phosphatase kit (Vector) ࢉ Յऊ 20~30 ϩដǴ౽ନ Alkaline Phoshatase Substrate working solutionǴа 100mM Tris-HCl buffer (pH 8.2~8.5) ዎమࢱࡕǴᢀჸܡྣǶ҂ϩϯޑख ज༸ಒझڀԖଯໆ alkaline phosphatase ϐࢲ܄ևआՅϸᔈǴςϩϯޑख ज༸ಒझ߾ alkaline phosphatase ࢲ܄եǴआՅϸᔈ১ࣗԿคՅǶ
2.6 խࣝᑻӀࢉՅ (Immunofluence stain)
ஒ iPS cells ܈ ES cells Ꭶܭ 24-well ޑ culture plate ύǴ 48 λਔࡕ
౽ନচᎦనǴуΕ֖Ԗςޕόӕᐚࡋ BP ޑཥᗲᎦనǴၸόӕਔ໔ᗺ
ᎦࡕǴஒᎦన౽ନǴӆуΕ PBS ዎమࢱಒझࡕ౽ନǴௗуΕ 4%
paraformaldehydeܭ࠻ྕΠڰۓ 10 ϩដࡕǴ౽ନ 4% paraformaldehydeǴճ Ҕ 0.1% Tween-20 / 1X PBS ዎమࢱ 3 ԛǴԛ 10 ϩដǴӆуΕ 0.3%
Triton-X 100 / 1X PBSܭ࠻ྕΠբҔ 30 ϩដஒಒझጢѺࢰаճࢉᏊΕǶ ӆճҔ 0.1% Tween-20 / 1X PBS ዎమࢱ 3 ԛࡕǴуΕ 5% FBS / 1X PBS ܭ
࠻ྕΠՉ blocking 2 λਔǴԶᆶ 1:100 ีញࡕޑԛלᡏ[Nanog (Novus)ǵSSEA1 (Millipore)]ӧ࠻ྕΠբҔ over nightǶճҔ 0.1% Tween-20 / 1X PBSዎమࢱ 5 ϩដࡕǴуΕ 1:500 ีញޑΒԛלᡏӧ࠻ྕΠᗉӀϸᔈ 1λਔࡕǴӆа 0.1% Tween-20 / 1X PBS మࢱ 10 ϩដǴ֖Ԗ DAPI ࢉᏊ ޑ UltraCruz™ Mounting Medium ࠾ТࡕǴջёճҔॹҥᑻӀᡉ༾᜔ᢀჸǶ 2.7 ख ज ౚ ޑ ԋ ک ϩ ϯ (Embryoid body (EB) formation and
differentiation)
ஒES cellsճҔ֖ԖBPޑᎦనᎦΟжϐࡕǴҔEB formation medium [DMEM (GIBCO BRL)బу20% fetal bovine serum (FBS) (GIBCO BRL), 1mM -mercaptoethan (GIBCO BRL), 1% L-glutamin (GIBCO BRL), 1% insulin-transferin-selenium-Gsupplement (ITSG)(GIBCO BRL), 1%
Plate (Costar)ǴᎦऊ2~3ϺࡕǴES cellsߡёаԋEBǶӆஒ EBҔ differentiation medium [DMEMబу20% fetal bovine serum (FBS)(GIBCO BRL), 1% L-glutamine (GIBCO BRL), 1% non-essential amino acids (NEAA)(GIBCO BRL), 1% penicillin and streptomycin (p/s)(GIBCO BRL), 1mM -mercaptoethanol (GIBCO BRL)]ᎦԿ٣Ӄςcoating Gelactinޑ 24-wellύǴঁwellऊᎦ5~6ᗭޑEBǴᎦऊ3ϺǴ٬EBёаϩϯԋΟঁ Tris-HCl (pH 7.5)Ǵ1mM EDTAǴ 0.5M NaClǴ1mM beta-MercaptoethanolǴ 1% NP40Ǵ1% GlycerolǴ1% Protein Kinase inhibitor] բҔ 30 ϩដǴ 5 ϩ ដ Vortex ԛǴ٬ಒझྋှనкϩషӝǴӆа 4ɗᚆЈ(13,000rpmǴ20 ϩដ)Ƕ ᚆЈࡕǴڗమనԿཥޑ 1.5ml ༾ໆᚆЈᆅǶೈқ፦ᐚࡋޑෳۓ߾ࢂ٬Ҕ
“Bio-Rad Protein Assay”Ƕа BSA ྗࠔǴଛᇙόӕᐚࡋྗࠔ (ఊࡋᐚ ࡋǺ0ǵ0.25ǵ0.5ǵ0.75ǵ1ǵ1.25Pg/Pl)Ǵஒีញޑኬࠔೈқ፦ྋనᆶྗ
ࠔӚڗр 10l ܭཥޑ 1.5ml ༾ໆᚆЈᆅύǴ٠ϩձуΕ 490l ޑ 1 ७
plateύǴ٠аݢߏ 595nm ෳۓځ֎ӀॶǴ٠ਥᏵ֎ӀॶբрྗԔጕǴа R2>0.99ޑྗԔጕωϒаीᆉԶෳໆрೈқ፦ᐚࡋǶਥᏵኬࠔೈқ፦ྋన ޑᐚࡋόӕǴуΕಒझྋှፂనϷ Laemmli sample buffer [2% SDSǴ50mM Tris-HCl (pH 6.8)Ǵ0.2mg/mL Bromphenol BlueǴ0.1M DTTǴ10% GlycerolǴ 7.5mL H2O]Ǵനಖଛᇙԋ 30l ྋనύ֖Ԗ 40g ೈқ፦ޑ loading sampleǴ ӆаଳԄуᏔǴՉуǴ100ɗǴ10 ϩដǴஒኬࠔᓯӸܭ-80ɗӇጃύ ഢҔǶ
2.9 ౷ለΜΒ✊໊—ᆫЧㄽữᏉጤᡏႝݚȐSDS-PAGEȑ
SDS-PAGE (SDS-polyacrylamide gel eletrophoresis)ՉӃஒྋܭ sample bufferޑኬࠔܭ 100ɗύу 3 ϩដǶҁჴᡍ࠻܌٬Ҕޑႝݚഢࣁ Bio-Rad SystemǶ२Ӄע glass plate sandwiches းӳǴځԛଛᇙ running gel (8%) Ϸ 5% stacking gelǶӆஒໆޑ 8% running gel [4mL 1.5M Tris-HCl (pH 8.8)Ǵ0.2mL 10% SDSǴ4mL 40% acrylamideǴ0.2mL 10% ammonium persulfate (APS)Ǵ0.012mL TEMEǴ10.6mL H2O ] ݙΕпኲǴǶݙΕၲໆଯࡋޑ running gelࡕǴӧय़ᇸᇸᙟቫΒԛᇃᚖНǶࡑ running gel ᏉڰࡕǴ
౽ନቫНǴஒ comb කӧ running gel БǴฅࡕݙΕໆ 5% stacking gel [1.5mL 0.5M Tris-HCl (pH 6.8)Ǵ0.06mL 10% SDSǴ0.75mL 40% acrylamideǴ 0.06mL 10% APSǴ0.006mL TEMEDǴ3.6mL H2O]Ƕ stacking gel Ꮙ่ࡕǴ ஒႝݚഢးӳǴ٠౽ѐ combǶуΕ running buffer (0.025M TrisǴ0.192 M
glycineǴ3.5 mM SDS)ࡕջёஒ 30Pl ኬࠔݙΕϾࢰϣǶӧ 4ɗՉႝݚǴԶ
ႝᓸϩձࣁǺstacking gel ਔڰۓӧ 50 ҷǹډኬࠔາԿ running gel ࡕڰ ۓӧ 110 ҷǴޔډኬࠔၲ࣒ዟ҃ᆄՏǶ
2.10 ՋБᏀᗺݤȐWestern Blotting Analysisȑ
ҁჴᡍБݤЬाࢂ٩Ᏽ“ECL Western Blotting Protocols”Ƕஒಒझྋှނ
܌ڗளޑమనೈқ፦ۓໆϩǶௗڗኬࠔՉॊޑ SDS-PAGEǶ ڗᆶటᙯᅄೈқ፦ጤελӝޑ PVDF membrane (polyvinylidene difluoride membrane)Ǵஒځݰܭ 100% methanol ዎᔸǴаࢲϯ PVDF membraneǴӆஒ PVDF membrane ݰܭᙯᅄፂన [25 mM TrisǴ192 mM glycineǴ20% (v/v) methanolǴpH 8.3] ύǴӆڗ 2 filter paper ک 2 Blotting PadݰܭᙯᅄፂనύǶӧॄཱུ݈ܫ 1 Blotting Pad ک filter paperǴ ӆע gel ܫǴϐࡕӆܫ PVDF membraneǴௗӆᇂ 1 filter paper ک Blotting PadǴӆᇂཱུ݈҅ǴܫΕᙯᅄኲϣǶӧᙯᅄፂనύаڰۓӼ
ԛ 10 ϩដǶϐࡕуΕа PBS-T 1:1000 ีញϐ߃ભלᡏ(primary antibody)
[phospho-Jak2 (cell signaling)ǵJak2 (cell signaling) ǵphospho-Stat3 (cell signaling)ǵStat3 (BD)]Ǵܭ࠻ྕΠ٬ځ֡ϬբҔ 2 λਔ(ҭё 4ɗ႖ڹϸᔈ)Ƕ ߃ભלᡏ่ӝࡕǴӆа PBS-T ፂనమࢱ PVDF membrane 30 ϩដǶௗ
уΕ Horseradish Peroxidase ܌่ӝޑΒભלᡏ(mouse 1:10000; rabbit 1:5000)Ǵܭ࠻ྕΠբҔ 1 λਔǶᒿࡕҥջа PBS-T ፂనؑࢱ PVDF membrane 1 λਔǶࢱృޑ PVDF membrane നࡕуΕ ECL հӀགᔈᏊ (Amershan International, England) բҔ 3 ϩដࡕǴаܴቹТᇂӧ PVDF membraneǴ٠ᇴوݰǴஒܴቹТᙟᇂӳޑ PVDF membrane ѳܫ ܭ X ӀТьպύǴ٠ܭས܊ϣᓸΕଯགࡋۭТȐhyperfilm-MPȑ(Amershan International, Sweden)ǴаᡉቹᏊکۓቹᏊᡉႽǶۭТؑࢱࡕǴӆаஏࡋϩ
೬ᡏϩᡉቹӧۭТޑ bands மࡋǴԶΑှࡑෳೈқ፦ޑխࣝࢲ܄
߄Ƕ
2.11 DNA ༾ତӈϩ(DNA Microarray Analysis)
MEF cellsҗ 10g/ml ک 40g/ml ޑ BP ೀ 24 λਔࡕǴڗр total RNAǴӆஒځϩձۓܫጕӕՏન (Cy3)Ƕ٩Ᏽᇙቷޑ protocol ஒኬ ࠔᆶ Agilent Mouse G3 Whole Genome Oligo 8×60K Microarray (Agilent) ՉᚇҬǶArrays ޑඔࢂճҔ Microarray Scanner System (Agilent)ǶኧᏵޑ ϩࢂճҔ GeneSpring GX ೬ᡏ (Agilent)Ƕ
2.12 iPS cellsғԋਏޑෳۓ
ךॺճҔڗԾ Pou5f1-GFP ԴႵ(The Jackson Lab)ޑ MEF cells ٰୀෳ
iPS cellsғԋޑਏǶᙁൂٰᇥǴճҔওဎౢஒखजڗрǴ٠Ъஒखजޑᓐǵ ϣ᠌ǵѤަک׀ЃѐନଳృǹಔᙃǴճҔΘ࿗Ǵӧᙯ౽ډ֖ Trypsin ޑ ၂ᆅύϯϩှǶMEF cells ᎦԿىໆਔǴךॺճҔӅӕᙯࢉ
pcDNA-Oct4Ǵ pcDNA-Sox2Ǵ pcDNA-c-Myc ک pcDNA-Klf4 ډ Pou5f1-GFP MEF cellsύǴٿϺᙯࢉԛ(ᕴӅѤԛ)Ǵჴᡍಔӧᙯࢉϐࡕ๏ϒ 20g/ml BPǶӧಃΐϺஒԜಒझᎦܭ feeder cells Ǵ٠ុᢀჸ GFP ܄ޑ clones کϺ׳ඤᎦనǶӧԜჴᡍύ BP ೀϩࣁٿಔǺಔࢂុೀ 20μg/ml ޑ BP (BP(T+P))ǹќಔ߾ࢂѝԖ iPS cells Ꭶన(BP(T))Ƕ
2.13 ीϩ
࣬ᜢኧᏵϐ໔ৡ౦߾٬Ҕ one-way ANOVA ϩᔠۓǶӆճҔ Tukey HSD٣ࡕᔠۓݤϩǴऩ p<0.05 ߾߄ҢीԖᡉৡ౦Ƕ
ಃΟക ࣴز่݀
MEF cells җόӕᐚࡋޑ BP ೀ (5g/mlǵ10g/mlǵ20g/mlǵ 40g/mlǵ80g/mlǵ160g/mlǵ320g/mlǵ640g/ml)Ǵϩձӧ 24 λਔǵ72 λਔճҔ MTT assay ޑБԄᔠෳ BP ჹ MEF cells ғߏૈΚޑቹៜǶკѤᡉ Ң BP ೀࡕǴ24 λਔک 72 λਔࣣᡉҢ 80g/mlǵ160g/mlǵ320g/mlǵ 640g/mlޑೀᐚࡋቹៜ MEF cells ӸࢲΠफ़ǴӢԜךॺᒧӧቹៜᐚ ࡋϐΠޑ 5g/mlǵ10g/mlǵ20g/mlǵ40g/ml ՉௗΠٰޑჴᡍǶ
3.3 BPჹ Oct4ǵSox2ǵc-Myc ک Klf4 ୷Ӣ߄ໆޑቹៜ
ࣁΑෳ၂ BP ёаҔٰғԋ iPS cells ٠Ъᆢ༸ಒझޑӭૈ܄೭ঁଷ ᇥǴךॺஒ MEF cells җ 5g/mlǵ10g/mlǵ20g/mlǵ40g/ml ޑ BP ೀ
բҔ 24 λਔࡕǴୀෳ Oct4, Sox2, c-Myc ک Klf4 ୷Ӣ߄ໆǶკϖᡉҢ MEF
10g/mlǵ20g/mlǵ40g/ml ޑ BP ೀࡕǴAP ܄ޑୱዴჴК܄ჹྣ
ಔ LIF OUT ቚуӭǶฅԶǴES cells 5g/ml ޑ BP ೀࡕǴAP ܄ޑ
ୱࠅؒԖКჹྣಔ LIF OUT ӭǶკΎ C ᡉҢܭᡉ༾᜔ᢀჸΠǴว่݀
ᆶॊ่݀࣬ӕǶҗ೭٤ኧᏵᡉҢǴӧ ES cells ᎦύǴBP ԖૈΚᆢ ES cellsޑԾך׳ཥૈΚکӭૈ܄Ƕ࣬ӕޑ่݀ǴკΖ AǵB ᡉҢ iPS cells ϩ ձ 10g/mlǵ20g/mlǵ40g/ml ޑ BP ೀࡕǴAP ܄ޑୱዴჴК
܄ჹྣಔ LIF OUT ቚуӭǶฅԶǴiPS cells 5g/ml ޑ BP ೀࡕǴAP
܄ޑୱࠅؒԖКჹྣಔ LIF OUT ӭǶკΖ C ᡉҢܭᡉ༾᜔ᢀჸΠǴว
่݀ᆶॊ่݀࣬ӕǶҗ೭٤ኧᏵᡉҢǴӧ iPS cells ᎦύǴBP ΨԖૈ
Κᆢ iPS cells ޑԾך׳ཥૈΚکӭૈ܄Ƕ
ԜѦǴךॺΨճҔځдޑ༸ಒझٰܴ೭ঁଷᇥǶךॺӧ ES cells
ᎦਔǴϩձҔ 5g/mlǵ10g/mlǵ20g/mlǵ40g/ml ޑ BP ڗж LIFǶך ॺճҔխࣝᑻӀࢉՅǴᢀჸ Nanog ک SSEA-1 ޑᑻӀ߄ໆǴჴ BP ࢂց Ψёа٬ ES cells ᆢԾך׳ཥૈΚکӭૈ܄Ƕკΐ A ᡉҢ ES cells ϩձ
10g/mlǵ20g/mlǵ40g/ml ޑ BP ೀࡕǴNanog ޑ߄ໆዴჴК܄ჹ
ྣಔ LIF OUT ቚуӭǴԶ ES cells 5g/ml ޑ BP ೀࡕǴNanog ޑ߄
ໆࠅؒԖКჹྣಔ LIF OUT ӭǶךॺճҔќঁ༸ಒझ SSEA-1 ٰ ᢀჸࢂցԖ࣬ӕޑ่݀Ǵҗკΐ B ᡉҢޑ่݀ᆶ Nanog ߄ໆޑ่݀ठǶ
ךॺ٬ҔޑԴႵ iPS cells ࢂٰԾ Nanog-GFP ୷ӢᙯႵ(8)Ǵ܌аךॺ Ψᙖҗᢀჸ Nanog-GFP ޑ߄ໆٰჴǶკΜ A ᡉҢޑ่݀ᆶ ES cells ޑ Nanog ߄ໆ࣬಄Ǵҗ BP 10g/mlǵ20g/mlǵ40g/ml ዴჴК܄ჹྣ
ಔ LIF OUT ቚуӭǶკΜ B ᡉҢᆶ ES cells ޑ SSEA-1 ߄ໆΨ࣬ pathwaysǵECM-receptor interaction ک Jak-Stat signaling pathwaysǶୖԵӭ යтளޕ Jak-Stat signaling pathways ᆶ stem cells നࣁ࣬ᜢǴӢԜךॺᒧ
Jak-Stat signaling pathwaysǶ
3.6 BPჹ Jak2 ک Stat3 ୷Ӣ߄ϐቹៜ
ӧ༸ಒझ࣬ᜢ Jak-Stat signaling pathways ύǴJak2 ک Stat3 ࢂᆢ༸ಒ झӭૈ܄ޑനЬाፓϐ୷ӢǶךॺஒ ES cells җ 5g/mlǵ10g/mlǵ 20g/mlǵ40g/ml ޑ BP ೀբҔ 72 λਔࡕǴճҔ real time PCR ୀෳ Jak2 ک Stat3 ୷Ӣޑ߄ǶკΜΒᡉҢ ES cells җ BP ೀࡕǴว BP 10g/mlޑᐚࡋ٬ Jak2 ک Stat3 ϐ୷Ӣቚуਏ݀നࣁᡉǶ
3.7 BPჹ Jak2 ک Stat3 ೈқ፦߄ϐቹៜ
ךॺୀෳΑ Jak2 ک Stat3 ୷Ӣޑ߄Ǵว BP Ψቹៜ Jak2 ک Stat3 ୷Ӣ߄ໆቚуǶǴךॺճҔՋБᏀᗺݤϩǴES cells җ 5g/mlǵ10g/mlǵ20g/mlǵ40g/ml ޑ BP ೀբҔ 72 λਔࡕǴJak2 ک Stat3
ೈқ፦߄Ƕ(კΜΟ A) ES cells җ BP ೀբҔ 72 λਔǴJak2 ک phosphorylation-Jak2ޑೈқ፦߄ໆᆶ܄ჹྣಔ LIF OUT КၨԖܴᡉቚ уǶკΜΟ B ᡉҢ࣬ӕޑ่݀ǴES cells җ BP ೀբҔ 72 λਔǴStat3 ک phosphorylation-Stat3 ೈқ፦߄ໆᆶ܄ჹྣಔ LIF OUT КၨΨԖܴᡉ ቚуǶ
3.8 BPჹ cytokine ޑ୷Ӣ߄ϐቹៜ
җॊޑኧᏵᡉҢǴ༸ಒझҗ BP ೀࡕǴёаࢲϯ Jak2-Stat3 signaling pathwaysǶࣁΑ൨פ BP ࢂၸবঁ cytokineǴԶࢲϯ Jak2-Stat3 signaling pathwaysǴךॺճҔ real time PCR ٰϩፓ Jak2-Stat3 signaling
pathways ޑෞ cytokine ϐ୷Ӣ߄ໆǶკΜѤᡉҢஒ ES cells җ 5g/mlǵ10g/mlǵ20g/mlǵ40g/ml ޑ BP ೀբҔ 72 λਔࡕǴୀෳ LIF, EGF, IL5, IL11, EPO ک OSM ୷Ӣޑ߄ໆǶว ES cells җ 10g/ml ޑ BPೀբҔ 72 λਔࡕǴLIF, EGF, IL5, IL11, EPO ک OSM ୷Ӣޑ߄ໆᆶ
܄ჹྣಔ LIF OUT ࣬КዴჴԖᡉޑቚуǶ 3.9 BPჹ iPS cells ғԋϐቹៜ
җаޑኧᏵᡉҢǴBP ёаቚу Oct4 ک Sox2 ୷Ӣ߄ໆǴԶЪёа ᆢ༸ಒझޑԾך׳ཥૈΚکӭૈ܄ǶӢԜǴךॺճҔ MEF cells ᙯࢉ Oct4, Sox2, c-Myc, Klf4Ѥঁ୷ӢǴӕਔуΕ BP ၂კቚуౢғ iPS cells ޑਏǶ ךॺ٬ҔޑԴႵ MEF cells ࢂٰԾ Oct4-GFP ୷ӢᙯႵǴ܌аךॺΨᙖҗ ᢀჸ Oct4-GFP ޑ߄ໆٰჴǶკΜϖᡉҢ MEF cells 20g/ml BP ೀ
ࡕǴOct4-GFP ޑ߄ໆዴჴК܄ჹྣಔቚуӭǴԶ BP(T+P) (seeding ࡕុу BP)ѝԖӧಃϤϺ Oct4-GFP ޑ߄ໆК BP(T) (seeding ࡕόុ
у BP)ᡉǴ೭ΨཀښǴӧᙯࢉޑၸำύуΕ BP ೀቚу iPS cells ғ ԋޑਏǶ
ಃѤക ፕ
༸ಒझёаՉԾך׳ཥکϩϯԋӭᅿಒझᜪࠠǴ٠ЪᔈҔܭӭᅿᖏ
ݯᕍ(55)ǶךॺૈՉᡏѦᎦޑ܌Ԗ༸ಒझύǴES cells ڀԖӭૈ܄کϩ ϯԋΟঁЬाखቫಒझޑ܄Ǵ೭٤ख़ाޑ܄ёаౢғ଼நޑಒझҔܭ ᖏݯᕍǶӧ 2006 ԃǴВҁޑ Takahashi ი໗ᙖҗᙯࢉ Oct4, Sox2, c-Myc ک Klf4 ೭Ѥঁ୷ӢΕᡏಒझౢғ iPS cells (8)ǴԜ iPS cells ёаլܺ ES cells ܌य़ᖏޑٿঁख़ाϐୢᚒǺխࣝ௨ѾϸᔈکᙴᕍၰቺǴӧ҂ٰѬԋ ࣁߚதख़ाޑಒझݯᕍϐמೌǶՠࢂǴES ک iPS cells ޑᎦѸᙖҗ LIFٰࢲϯ Jak-Stat pathwayǴԶᆢځӭૈ܄(39)ǶԜѦǴiPS cells ғԋਏ
ߚதեࢂҞ iPS cells מೌޑനεज़ڋǶӧҁࣴزύǴךॺวঁપ
Ψࢂ BP ٬Ҕܭ༸ಒझޑ२ԛࣴزǶ
ٰᎦ ES celltǴว BP Ψёаᡣ Oct4, Sox2, c-Myc ک Klf4 ୷Ӣ߄ܴ
ᡉቚу(კϤ)Ƕ٠Ъ٬Ҕ BP ٰᎦ ES ک iPS cellsǴךॺҔΑ൳ঁ༸ಒझ
Ǵх֖ AP ࢉՅǵNanog ک SSEA1Ǵٰዴۓ BP ёаڗж LIF ٰᎦ ES ک iPS cellsǴЀځࢂ 10 ک 20 g/ml (კΎǵΖǵΐǵΜ)Ǵ೭ঁኧᏵᆶ Oct4 ک Sox2 ୷Ӣ߄ޑኧᏵठǶԜѦǴךॺճҔ 10 g/ml ޑ BP ڗж LIF ٰ
Ꭶ ES ک iPS cellsǴၸΟжᎦࡕǴճҔ embryoid body (EB)ԋ೭ঁ
מೌ(3, 8)Ǵٰෳ၂༸ಒझޑӭૈ܄Ǵ೭ঁኧᏵࡰрǴBP ёаڗж LIF ٰ
Ꭶ ES ک iPS cellsǶ
ࣁΑࣴز BP ೀࡕځբҔޑᐒڋǴךॺճҔ microarray ϩפр BP Ьाፓޑ৩ǶΟӜޑ৩ǺPPAR signaling pathwayǵ ECM-receptor interaction ک Jak-Stat signaling pathway (߄Β)Ƕӧ 2010 ԃǴMo et al.ࣴزᡉ Ң PPAR ፓ LIF ၸ Tyk2-Stat3 ৩ǴᇨᏤԴႵޑखज༸ಒझғߏᆶԾ ך׳ཥ(59)ǶךॺୀෳΑ ES cells BP ೀࡕ PPAR ޑ୷Ӣ߄Ǵว
PPAR ୷Ӣ߄ᆶڋಔ࣬К٠ؒԖৡ౦ǴਥᏵ೭ঁচӢǴךॺஒख़ܭ Jak-Stat signaling pathway Ƕ ך ॺ ዴ ᇡ ༸ ಒ झ BP ೀ ࡕ Ǵ phosphorylation-Jak2 ک phosphorylation-Stat3 ޑೈқ፦߄ቚу(კΜΟ)Ƕ LIFޑૻ৲ၸ Jak ࢲϯΑ࣬ᜢޑૻ৲ሀǴ٠Ъࢲϯ Stat3 (39)Ǵჹܭ ES cells ޑԾך׳ཥૈΚ LIF ࢂתᄽঁόё܈લޑفՅ(31)ǶךॺޑኧᏵࡰ
рǴ BP ೀёаࢲϯ Jak2 ک Stat3 ٬ ES cells ᆢԾך׳ཥૈΚǶԜѦǴ
Jak-Stat signaling pathwayёаၸ LIF, EGF, EPO, IL5, IL11 ک OSM (17-21) ύǴԖঁλϩη[valproic acid (VPA)]ёаҔٰගଯ iPS cells ޑғԋਏ
(10)ǶVPA ٠όቚу Oct4 ک Sox2 ޑ୷Ӣ߄ǴՠࢂѬቚуੰࢥ൪Ε
ךॺዴۓΑ BP ၸፓୖᆶܭ Jak2-Stat3 signaling pathways ύޑಒझ ᐟનǴቚу Jak2 ک Stat3 ޑೈқ፦߄Ǵᡣ༸ಒझᆢӭૈ܄کԾך׳ཥ
ૈΚǹԜѦǴBP ޑೀࡕёаቚу iPS cells ғԋޑਏǶஒٰ BP ёаว
ԋࣁ଼ந१ࠔǴҔٰࢲϯ༸ಒझǴԶЪӧ҂ٰ BP ёаҔܭׯ๓ iPS cell ғԋϐਏǶ
ୖԵЎ
1. Evans, M. J., and Kaufman, M. H. (1981) Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154-156
2. Martin, G. R. (1981) Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A 78, 7634-7638
3. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861-872
4. Marson, A., Levine, S. S., Cole, M. F., Frampton, G. M., Brambrink, T., Johnstone, S., Guenther, M. G., Johnston, W. K., Wernig, M., Newman, J., Calabrese, J. M., Dennis, L.
M., Volkert, T. L., Gupta, S., Love, J., Hannett, N., Sharp, P. A., Bartel, D. P., Jaenisch, R., and Young, R. A. (2008) Connecting microRNA genes to the core transcriptional regulatory circuitry of embryonic stem cells. Cell 134, 521-533
5. Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A., Swiergiel, J. J., Marshall, V. S., and Jones, J. M. (1998) Embryonic stem cell lines derived from human blastocysts. Science 282, 1145-1147
6. Liu, S. P., Fu, R. H., Yu, H. H., Li, K. W., Tsai, C. H., Shyu, W. C., and Lin, S. Z. (2009) MicroRNAs regulation modulated self-renewal and lineage differentiation of stem cells.
Cell Transplant 18, 1039-1045
7. Kim, D. S., Kim, J. Y., Kang, M., Cho, M. S., and Kim, D. W. (2007) Derivation of functional dopamine neurons from embryonic stem cells. Cell Transplant 16, 117-123 8. Takahashi, K., and Yamanaka, S. (2006) Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676
9. Ezashi, T., Das, P., and Roberts, R. M. (2005) Low O2 tensions and the prevention of differentiation of hES cells. Proc Natl Acad Sci U S A 102, 4783-4788
10. Huangfu, D., Osafune, K., Maehr, R., Guo, W., Eijkelenboom, A., Chen, S., Muhlestein, W., and Melton, D. A. (2008) Induction of pluripotent stem cells from primary human fibroblasts with only Oct4 and Sox2. Nat Biotechnol 26, 1269-1275
11. Kawase, E., Suemori, H., Takahashi, N., Okazaki, K., Hashimoto, K., and Nakatsuji, N.
(1994) Strain difference in establishment of mouse embryonic stem (ES) cell lines. Int J Dev Biol 38, 385-390
12. Ichikawa, Y. (1970) Further studies on the differentiation of a cell line of myeloid leukemia. J Cell Physiol 76, 175-184
13. Smith, A. G. (1992) Mouse embryo stem cells: their identification, propagation and manipulation. Semin Cell Biol 3, 385-399
14. Williams, R. L., Hilton, D. J., Pease, S., Willson, T. A., Stewart, C. L., Gearing, D. P.,
Wagner, E. F., Metcalf, D., Nicola, N. A., and Gough, N. M. (1988) Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells. Nature 336, 684-687
15. Moreau, J. F., Donaldson, D. D., Bennett, F., Witek-Giannotti, J., Clark, S. C., and Wong, G. G. (1988) Leukaemia inhibitory factor is identical to the myeloid growth factor human interleukin for DA cells. Nature 336, 690-692
16. Smith, A. G., Heath, J. K., Donaldson, D. D., Wong, G. G., Moreau, J., Stahl, M., and Rogers, D. (1988) Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336, 688-690
17. Metcalf, D. (1991) The leukemia inhibitory factor (LIF). Int J Cell Cloning 9, 95-108 18. Ip, N. Y., Nye, S. H., Boulton, T. G., Davis, S., Taga, T., Li, Y., Birren, S. J., Yasukawa,
K., Kishimoto, T., Anderson, D. J., and et al. (1992) CNTF and LIF act on neuronal cells via shared signaling pathways that involve the IL-6 signal transducing receptor component gp130. Cell 69, 1121-1132
19. Wijdenes, J., Heinrich, P. C., Muller-Newen, G., Roche, C., Gu, Z. J., Clement, C., and Klein, B. (1995) Interleukin-6 signal transducer gp130 has specific binding sites for different cytokines as determined by antagonistic and agonistic anti-gp130 monoclonal antibodies. Eur J Immunol 25, 3474-3481
20. Gearing, D. P., Thut, C. J., VandeBos, T., Gimpel, S. D., Delaney, P. B., King, J., Price, V., Cosman, D., and Beckmann, M. P. (1991) Leukemia inhibitory factor receptor is structurally related to the IL-6 signal transducer, gp130. EMBO J 10, 2839-2848
21. Guschin, D., Rogers, N., Briscoe, J., Witthuhn, B., Watling, D., Horn, F., Pellegrini, S., Yasukawa, K., Heinrich, P., Stark, G. R., and et al. (1995) A major role for the protein tyrosine kinase JAK1 in the JAK/STAT signal transduction pathway in response to interleukin-6. EMBO J 14, 1421-1429
22. Matsuda, T., Nakamura, T., Nakao, K., Arai, T., Katsuki, M., Heike, T., and Yokota, T.
(1999) STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells. EMBO J 18, 4261-4269
23. Sumi, T., Fujimoto, Y., Nakatsuji, N., and Suemori, H. (2004) STAT3 is dispensable for maintenance of self-renewal in nonhuman primate embryonic stem cells. Stem Cells 22, 861-872
24. Burdon, T., Stracey, C., Chambers, I., Nichols, J., and Smith, A. (1999) Suppression of SHP-2 and ERK signalling promotes self-renewal of mouse embryonic stem cells. Dev Biol 210, 30-43
25. Gual, P., Baron, V., Lequoy, V., and Van Obberghen, E. (1998) Interaction of Janus kinases JAK-1 and JAK-2 with the insulin receptor and the insulin-like growth factor-1 receptor. Endocrinology 139, 884-893
26. Andus, T., Geiger, T., Hirano, T., Kishimoto, T., and Heinrich, P. C. (1988) Action of
recombinant human interleukin 6, interleukin 1 beta and tumor necrosis factor alpha on the mRNA induction of acute-phase proteins. Eur J Immunol 18, 739-746
27. Narazaki, M., Witthuhn, B. A., Yoshida, K., Silvennoinen, O., Yasukawa, K., Ihle, J. N., Kishimoto, T., and Taga, T. (1994) Activation of JAK2 kinase mediated by the interleukin 6 signal transducer gp130. Proc Natl Acad Sci U S A 91, 2285-2289
28. Stahl, N., Boulton, T. G., Farruggella, T., Ip, N. Y., Davis, S., Witthuhn, B. A., Quelle, F.
W., Silvennoinen, O., Barbieri, G., Pellegrini, S., and et al. (1994) Association and activation of Jak-Tyk kinases by CNTF-LIF-OSM-IL-6 beta receptor components.
Science 263, 92-95
29. Parganas, E., Wang, D., Stravopodis, D., Topham, D. J., Marine, J. C., Teglund, S., Vanin, E. F., Bodner, S., Colamonici, O. R., van Deursen, J. M., Grosveld, G., and Ihle, J. N. (1998) Jak2 is essential for signaling through a variety of cytokine receptors. Cell 93, 385-395
30. Darnell, J. E., Jr. (1997) STATs and gene regulation. Science 277, 1630-1635
31. Raz, R., Lee, C. K., Cannizzaro, L. A., d'Eustachio, P., and Levy, D. E. (1999) Essential role of STAT3 for embryonic stem cell pluripotency. Proc Natl Acad Sci U S A 96, 2846-2851
32. Schindler, C. (1999) Cytokines and JAK-STAT signaling. Exp Cell Res 253, 7-14 33. Bromberg, J., and Darnell, J. E., Jr. (2000) The role of STATs in transcriptional control
and their impact on cellular function. Oncogene 19, 2468-2473
34. Raz, R., Durbin, J. E., and Levy, D. E. (1994) Acute phase response factor and additional members of the interferon-stimulated gene factor 3 family integrate diverse signals from cytokines, interferons, and growth factors. J Biol Chem 269, 24391-24395 35. Zhong, Z., Wen, Z., and Darnell, J. E., Jr. (1994) Stat3: a STAT family member
activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science 264, 95-98
36. Akira, S., Nishio, Y., Inoue, M., Wang, X. J., Wei, S., Matsusaka, T., Yoshida, K., Sudo, T., Naruto, M., and Kishimoto, T. (1994) Molecular cloning of APRF, a novel IFN-stimulated gene factor 3 p91-related transcription factor involved in the gp130-mediated signaling pathway. Cell 77, 63-71
37. Lutticken, C., Wegenka, U. M., Yuan, J., Buschmann, J., Schindler, C., Ziemiecki, A., Harpur, A. G., Wilks, A. F., Yasukawa, K., Taga, T., and et al. (1994) Association of transcription factor APRF and protein kinase Jak1 with the interleukin-6 signal transducer gp130. Science 263, 89-92
38. Wegenka, U. M., Buschmann, J., Lutticken, C., Heinrich, P. C., and Horn, F. (1993) Acute-phase response factor, a nuclear factor binding to acute-phase response elements, is rapidly activated by interleukin-6 at the posttranslational level. Mol Cell Biol 13, 276-288
39. Niwa, H., Burdon, T., Chambers, I., and Smith, A. (1998) Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev 12, 2048-2060 40. Boeuf, H., Hauss, C., Graeve, F. D., Baran, N., and Kedinger, C. (1997) Leukemia
inhibitory factor-dependent transcriptional activation in embryonic stem cells. J Cell Biol 138, 1207-1217
41. Minami, M., Inoue, M., Wei, S., Takeda, K., Matsumoto, M., Kishimoto, T., and Akira, S. (1996) STAT3 activation is a critical step in gp130-mediated terminal differentiation and growth arrest of a myeloid cell line. Proc Natl Acad Sci U S A 93, 3963-3966 42. Nakajima, K., Yamanaka, Y., Nakae, K., Kojima, H., Ichiba, M., Kiuchi, N., Kitaoka, T.,
Fukada, T., Hibi, M., and Hirano, T. (1996) A central role for Stat3 in IL-6-induced regulation of growth and differentiation in M1 leukemia cells. EMBO J 15, 3651-3658 43. Yamanaka, Y., Nakajima, K., Fukada, T., Hibi, M., and Hirano, T. (1996)
Differentiation and growth arrest signals are generated through the cytoplasmic region of gp130 that is essential for Stat3 activation. EMBO J 15, 1557-1565
44. Cressman, D. E., Greenbaum, L. E., DeAngelis, R. A., Ciliberto, G., Furth, E. E., Poli, V., and Taub, R. (1996) Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice. Science 274, 1379-1383
45. Sierra-Honigmann, M. R., Nath, A. K., Murakami, C., Garcia-Cardena, G., Papapetropoulos, A., Sessa, W. C., Madge, L. A., Schechner, J. S., Schwabb, M. B., Polverini, P. J., and Flores-Riveros, J. R. (1998) Biological action of leptin as an angiogenic factor. Science 281, 1683-1686
46. Vaisse, C., Halaas, J. L., Horvath, C. M., Darnell, J. E., Jr., Stoffel, M., and Friedman, J.
M. (1996) Leptin activation of Stat3 in the hypothalamus of wild-type and ob/ob mice but not db/db mice. Nat Genet 14, 95-97
47. Wang, H., Chen, R., and Xu, H. (1998) [Chemical constituents of radix Angelicae Sinensis]. Zhongguo Zhong Yao Za Zhi 23, 167-168, inside backcover
48. Abebe, W. (2002) Herbal medication: potential for adverse interactions with analgesic drugs. J Clin Pharm Ther 27, 391-401
49. Tsai, N. M., Lin, S. Z., Lee, C. C., Chen, S. P., Su, H. C., Chang, W. L., and Harn, H. J.
(2005) The antitumor effects of Angelica sinensis on malignant brain tumors in vitro and in vivo. Clin Cancer Res 11, 3475-3484
50. Tsai, N. M., Chen, Y. L., Lee, C. C., Lin, P. C., Cheng, Y. L., Chang, W. L., Lin, S. Z., and Harn, H. J. (2006) The natural compound n-butylidenephthalide derived from Angelica sinensis inhibits malignant brain tumor growth in vitro and in vivo. J Neurochem 99, 1251-1262
51. Teng, C. M., Chen, W. Y., Ko, W. C., and Ouyang, C. H. (1987) Antiplatelet effect of butylidenephthalide. Biochim Biophys Acta 924, 375-382
52. Ko, W. C., Sheu, J. R., Tzeng, S. H., and Chen, C. M. (1998) The selective antianginal
effect without changing blood pressure of butylidenephthalide in conscious rats. Planta Med 64, 229-232
53. Ko, W. C., Liao, C. C., Shih, C. H., Lei, C. B., and Chen, C. M. (2002) Relaxant effects of butylidenephthalide in isolated dog blood vessels. Planta Med 68, 1004-1009
54. Mimura, Y., Kobayashi, S., Naitoh, T., Kimura, I., and Kimura, M. (1995) The structure-activity relationship between synthetic butylidenephthalide derivatives regarding the competence and progression of inhibition in primary cultures proliferation of mouse aorta smooth muscle cells. Biol Pharm Bull 18, 1203-1206
55. Liu, S. P., Fu, R. H., Huang, Y. C., Chen, S. Y., Chien, Y. J., Hsu, C. Y., Tsai, C. H., Shyu, W. C., and Lin, S. Z. (2011) Induced pluripotent stem (iPS) cell research overview. Cell Transplant 20, 15-19
56. Lin, P. C., Chen, Y. L., Chiu, S. C., Yu, Y. L., Chen, S. P., Chien, M. H., Chen, K. Y., Chang, W. L., Lin, S. Z., Chiou, T. W., and Harn, H. J. (2008) Orphan nuclear receptor, Nurr-77 was a possible target gene of butylidenephthalide chemotherapy on glioblastoma multiform brain tumor. J Neurochem 106, 1017-1026
57. Chen, Y. L., Jian, M. H., Lin, C. C., Kang, J. C., Chen, S. P., Lin, P. C., Hung, P. J., Chen, J. R., Chang, W. L., Lin, S. Z., and Harn, H. J. (2008) The induction of orphan nuclear receptor Nur77 expression by n-butylenephthalide as pharmaceuticals on hepatocellular carcinoma cell therapy. Mol Pharmacol 74, 1046-1058
58. Heng, J. C., Feng, B., Han, J., Jiang, J., Kraus, P., Ng, J. H., Orlov, Y. L., Huss, M., Yang, L., Lufkin, T., Lim, B., and Ng, H. H. (2010) The nuclear receptor Nr5a2 can replace Oct4 in the reprogramming of murine somatic cells to pluripotent cells. Cell Stem Cell 6, 167-174
59. Mo, C., Chearwae, W., and Bright, J. J. (2010) PPARgamma regulates LIF-induced growth and self-renewal of mouse ES cells through Tyk2-Stat3 pathway. Cell Signal 22, 495-500
60. Yamanaka, S. (2009) A fresh look at iPS cells. Cell 137, 13-17
61. Esteban, M. A., Wang, T., Qin, B., Yang, J., Qin, D., Cai, J., Li, W., Weng, Z., Chen, J., Ni, S., Chen, K., Li, Y., Liu, X., Xu, J., Zhang, S., Li, F., He, W., Labuda, K., Song, Y., Peterbauer, A., Wolbank, S., Redl, H., Zhong, M., Cai, D., Zeng, L., and Pei, D. (2010) Vitamin C enhances the generation of mouse and human induced pluripotent stem cells.
Cell Stem Cell 6, 71-79
62. Burdon, T., Chambers, I., Stracey, C., Niwa, H., and Smith, A. (1999) Signaling mechanisms regulating self-renewal and differentiation of pluripotent embryonic stem cells. Cells Tissues Organs 165, 131-143
კ߄
߄ǵջਔۓໆᆫӝ䁙ೱᙹϸᔈׇӈំ߄
Primer Forward SequenceǺ(5’-3’) Reverse SequenceǺ(5’-3’) Taqman Probe
Sox2 AGGGCTGGACTGCGAACTG TTTGCACCCCTCCCAATTC c-Myc CATTCAAGCAGACGAGCA CGAGTTAGGTCAGTTTATGCAC
Klf4 CCTTTCAGTGCCAGAAGT ACTACGTGGGATTTAAAAGTGC Jak2 CAATGATAAACAAGGGCAAATGAT CTTGGCAATCTTCCGTTGCT Stat3 CCCCGTACCTGAAGACCAAGT CCGTTATTTCCAAACTGCATCA
EGF GAGTCTGCCTGCGGATGGT GCTGCAGGGAGGGAGACA EPO CCCCCACGCCTCATCTG TGCCTCCTTGGCCTCTAAGA
IL5 TCCCTGCTACTCTCCCCAAA CAACCTTCTCTCTCCCCAAGAA IL11 CATGCCACACCCCAAACAA CCCCTCACCCAGGTCTACTG LIF CCTACCTGCGTCTTACTCCATCA TGTTTTCCCCAAAGGCTCAA OSM CGGTCCACTACAACACCAGATG GCGATGGTATCCCCAGAGAA
͊-Actin GTGCGTGACATCAAAGAGAAGC TGGATGCCACAGGATTCCATAC
Taqman-Oct4 GAGGCTACAGGGACACCTTTC GTGCCAAAGTGGGGACCT Roche Universal Probes 6 Taqman-͊-Actin CTAAGGCCAACCGTGAAAAG ACCAGAGGCATACAGGGACA Roche Universal Probes 64
߄ΒǵճҔ KEGG ک Babelomics ၗϩᡉ߄ޑ୷ӢኧᏵᆶғނф
ૈϩᜪǶ
I: number of upregulated genes; D: number of downregulated genes.
კǵLIF ၸࢲϯ Jak/Stat3 signaling pathwaysǴፓ༸ಒझޑғނࢲ܄Ǵ კᘏڗԾЎക(62)Ƕ
კΒǵn-Butylidenephthalide ޑϯᏢ่ᄬ
კΟǵճҔ real-time PCR ୀෳ MEF cells ϩձೀ 18 ᅿόӕᐚࡋޑύᛰ բҔ 24 λਔࡕǴOct4 ک Sox2 ୷Ӣ߄ໆǶ
კѤǵճҔ MTT assay ϩ BP ჹ MEF cells ғߏૈΚޑቹៜǶMEF cells
ೀόӕᐚࡋޑ BP ϩձբҔ 24 ک 72 λਔǶӚಔ࣬ჹ֎Ӏॶޑѳ֡ॶᆶ
ྗৡǶ*P 0.05 versus control (DMSO*Ƕ
კϖǵճҔ real-time PCR ୀෳ MEF cells ೀόӕᐚࡋ BP բҔ 24 λਔࡕǴ Oct4, Sox2, c-Myc, Klf4୷Ӣ߄ໆǶ*P 0.05 versus control (DMSO*Ƕ!
კϤǵճҔ real-time PCR ୀෳ ES cells ೀόӕᐚࡋ BP բҔ 72 λਔࡕǴ Oct4, Sox2, c-Myc, Klf4୷Ӣ߄ໆǶ*P 0.05 versus control (LIF OUT).
(A) (B)
(C)
კΎǵ(A) ES cells ೀόӕᐚࡋ BP բҔ 72 λਔࡕǴճҔ alkaline phosphatase stainingϩ९ᕒკǶ(B) Οԛᐱҥჴᡍޑѳ֡ॶr SD Ƕ*P 0.05 versus LIF OUT. (C) ES cellsೀόӕᐚࡋޑBP բҔ72 λਔࡕǴalkaline phosphatase stainingܭ 40 ७ᡉ༾᜔კǶ
LIF OUT LIF BP 5
BP 40 BP 20
BP 10
(A) (B)
(C)
კΖǵ(A) iPS cells ೀόӕᐚࡋ BP բҔ 72 λਔࡕǴճҔ alkaline phosphatase stainingϩ९ᕒკǶ(B) Οԛᐱҥჴᡍޑѳ֡ॶr SDǶ*P 0.05 versus LIF OUT. (C) iPS cellsೀόӕᐚࡋޑ BP բҔ 72 λਔࡕǴalkaline phosphatase stainingܭ 40 ७ᡉ༾᜔კǶ
(A)
LIF OUT LIF BP 5 BP 10 BP 20 BP 40
Merge Merge Merge Merge Merge Merge
Nanog
DAPI DAPI DAPI DAPI DAPI DAPI
Nanog Nanog Nanog Nanog Nanog
100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm
100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm
100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm
(B)
LIF OUT LIF BP 5 BP 10 BP 20 BP 40
Merge Merge Merge Merge Merge Merge
SSEA1 SSEA1 SSEA1 SSEA1 SSEA1 SSEA1
DAPI DAPI DAPI DAPI DAPI DAPI
100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm
100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm
100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm
კΐǵ(A) ES cells ೀόӕᐚࡋ BP բҔ 72 λਔࡕǴӧᑻӀᡉ༾᜔Πᢀჸ Nanog-GFPޑ߄ໆǶ(B) ES cells ೀόӕᐚࡋ BP բҔ 72 λਔࡕǴӧᑻ Ӏᡉ༾᜔Πᢀჸ SSEA1 ޑ߄ໆǶ
(A)
LIF out LIF BP5
BP10 BP20 BP40
100ȫm 100ȫm 100ȫm
100ȫm 100ȫm 100ȫm
(B)
LIF OUT LIF BP 5 BP 10 BP 20 BP 40
Merge Merge Merge Merge Merge Merge
SSEA1 SSEA1 SSEA1 SSEA1 SSEA1 SSEA1
DAPI DAPI DAPI DAPI DAPI DAPI
100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm
100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm
100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm
კΜǵ(A) iPS cells ೀόӕᐚࡋ BP բҔ 72 λਔࡕǴӧᑻӀᡉ༾᜔Πᢀჸ Nanog-GFPޑ߄ໆǶ(B) iPS cells ೀόӕᐚࡋ BP բҔ 72 λਔࡕǴӧᑻ Ӏᡉ༾᜔Πᢀჸ SSEA1 ޑ߄ໆǶ
Ectoderm
DAPI
Merge Geta-4
Endoderm
Merge Ƞ-SMA
DAPI
Mesoderm
Merge Tuj-1 DAPI
50ȫm 50ȫm 50ȫm
50ȫm 50ȫm 50ȫm
50ȫm 50ȫm 50ȫm
კΜǵճҔ BP ڗж LIF Ꭶ ES cells Οжϐࡕ٬ϐԋ EB ϩϯғԋΟ खቫಒझǶ
კΜΒǵճҔ real-time PCR ୀෳ ES cells ೀόӕᐚࡋ BP բҔ 72 λਔࡕǴ Jak2ک Stat3 ୷Ӣ߄ໆǶ*P 0.05 versus LIF OUT.
(A)
(B)
კΜΟǵ(A) ES cells ೀόӕᐚࡋ BP բҔ 72 λਔࡕǴճҔ western blot ϩ Jak2 ک phosphorylation-Jak2 ೈқ፦߄ໆǶ(B) ES cells ೀόӕᐚࡋ BPբҔ 72 λਔࡕǴճҔ western blot ϩ Stat3 ک phosphorylation-Stat3 ೈ қ፦߄ໆǶ
კΜѤǵճҔ real-time PCR ୀෳ ES cells ೀόӕᐚࡋ BP բҔ 72 λਔࡕǴ LIF, EGF, IL5, IL11, EPO, OSM୷Ӣ߄ໆǶ*P 0.05 versus LIF OUT.
0 positive clonesीբკǶControlǺᙯ Oct4, Sox2, c-Myc, Klf4ǹBP (T)Ǻ ᙯࢉ Oct4, Sox2, c-Myc, Klf4 ӧᙯࢉၸำύу BPǴϐࡕᎦ߾όуǹBP (T+P)Ǻᙯࢉ Oct4, Sox2, c-Myc, Klf4 ӧᙯࢉၸำکϐࡕᎦࣣុу BPǶ