• 沒有找到結果。

खज༸ಒझ(Embryonic stem celltǴᙁᆀ ES cells)ǴٰԾܭথ٢୏ނ៶ख ϣޑϣखቫಒझǴڀԖคज़ғߏૈΚ٠ЪёаϩϯࣁҺՖΟखቫύޑಒझ (1-3)Ƕҗܭखज༸ಒझӕਔڀԖԾך׳ཥکϩϯԋӭᅿಒझᜪࠠޑૈΚǴ ჹܭᖏ׉ޑಒझᕍݤǴᏱԖѮεޑወΚ(4)ǶӢԜǴΓॺයࡑखज༸ಒझё аҔܭΑှ҂ޕޑੰ౛ᐒᙯǴཥᛰ໒วύᑔᒧԖਏ܄کӼӄ܄ޑࡰ኱Ǵа Ϸݯᕍک௓ڋӚᅿ੯ੰ(3, 5)ǴٯӵǺମᡎ౽෌[hematopoietic stem cells (HSCs)]ᔈҔܭқՈੰǵՈ϶ੰک೦Ոǹ໔፦༸ಒझ[Mesenchymal stem cells (MSCs)]ᔈҔܭલՈ܈ཞ໾ک຾ՉԖਏޑՈᆅӆғǴঅൺڙཞ୔ୱ(6)Ƕӧа

߻ޑࣴزύǴखज༸ಒझёаϩϯԋӭЃữઓ࿶ϡ຾Չಒझݯᕍ(7)ǶՠࢂǴ खज༸ಒझҔܭಒझݯᕍԖٿঁεୢᚒǺ΋Бय़Ѹሡय़ᖏউ౛ၰቺݾ᝼ޑ

ୢᚒǴќ΋Бय़߾ࢂ஻ޣ౽෌ࡕౢғխࣝ௨ѾޑୢᚒǴᏤठखज༸ಒझޑ ᔈҔڙډߔᛖǶ

ᇨᏤࠠӭૈ༸ಒझ(Induced pluripotent stem cellsǴᙁᆀ iPS cells) ࢂࣴز

༸ಒझݯᕍ࣬྽ख़ाޑཥᑉሦୱǶiPS cells ࢂஒ Oct4, Sox2, c-Myc ک Klf4 ೭Ѥঁ୷Ӣᙯࢉ຾ΕԴႵ܈Γᜪޑᠼᆢ҆ಒझ܌ғԋ(3, 8)ǶiPS ᆶ ES cells ޑ੝܄ߚத࣬՟Ǵό໻ࢂቚ෗ૈΚǵಒझࠠᄊǵ୷Ӣ߄౜ǵಒझ߄य़לচǵ

ᆄಈ䁙ࢲ܄ǴᗋԖ୷Ӣ΢ፓ௓Ҙ୷ϯޑ AP genetic site ೿࣬྽΋ठǶiPS cells 1.1.2 Leukemia Inhibitory Factor (LIF) ک Jak2-Stat3 signaling pathway

ᗨฅٰԾόӕ୏ނޑखज༸ಒझ੝܄کᆢ࡭཮Ԗ܌όӕǴԴႵޑखज༸

ಒझ୻ᎦਔǴሡा೸ၸқՈౚቚғ׭ڋӢη(Leukemia inhibitory factorǴᙁ ᆀ LIF)ٰᆢ࡭खज༸ಒझޑԾך׳ཥૈΚ(11-13)ǶLIF ࢂឦܭ IL-6 ৎ௼ޑ

΋঩ǴѬёаᇨᏤԴႵखज༸ಒझғߏǴ٠Ъ׭ڋԴႵखज༸ಒझϩϯ (14-16)ǶLIF ߾ࢂ೸ၸᆶ LIF receptor ک gp130 [IL-6 ৎ௼ޑӅӕڙᡏ(IL-6, IL-11, CNTF, OSMک LIF)] (17-21)ፄӝނ่ӝǴࢲϯ Janus kinase (Jak)ک signal transducer and activator of transcription (Stat)ǴԶ٬खज༸ಒझёаᆢ࡭

Ծך׳ཥૈΚکӭૈ܄Ȑკ΋ȑ(22-24)Ƕ

Jak (Janus Kinases)ޑৎ௼ԋ঩х֖ Jak1ǵJak2ǵJak3ǵTYK2 (Tyrosine Kinase 2)ǴѬॺՏܭಒझጢϣୁ٠ߕ๱ܭڙᏔ΢ǴࣣឦܭߚڙᏔೈқᐟ䁙 (nonreceptor protein kinases)Ǵϩηໆϟܭ 120~135 KDa ϐ໔ǹJaks ֖Ύঁᐟ 䁙୔ୱ(JH domains 1~7)ǴՠѝԖ C ᆄޑ JH1 domain ڀഢ໽ϯࢲ܄ǴԶ N

ᆄϐ JH6 domain ک JH7 domain ᆶڙᏔϐ໔ࣣԖҬϕբҔ(25)Ƕ

ӧ Jak ޑৎ௼ԋ঩ύǴJak2 ܭҁጇፕЎ္תᄽ΋ঁख़ाޑفՅǹJak2

ࢂୖᆶܭ cytokine receptor signaling ύႀữለᐟ䁙ৎ௼ޑ΋঩Ǵᙖҗ IL-6 ৎ

௼ޑ cytokines ೸ၸ gp130 ܈ځдଯ߄౜ޑ LIFR ٰӅӕࢲϯ Jak2 (26-29)Ǵ

຾Զ٬ Stat3 ࢲϯǴᆢ࡭༸ಒझޑԾך׳ཥૈΚکӭૈ܄Ƕ

Stats (signal transducer and activator of transcription) ೸ၸJak2ۚύϟᏤ٬

ځႀữለූ୷೏ᕗለϯǴ׎ԋΒᆫᡏࢲϯǴ٠ᙯၮډಒझਡϣаᇨᏤ੝౦

܄ޑ୷Ӣಔ(30, 31)Ƕӧথ٢ᜪ୏ނύǴStatsԿҞ߻ࣁЗςԖΎঁৎ௼ԋ঩

೏ዴᇡрٰǴϩձࢂStat1ǵStat2ǵStat3ǵStat4ǵStat5aǵStat5bǵStat6Ǵځ ϩηໆϟܭ75~95 KDaϐ໔ǹԶStatsڀԖѤঁӅӕߥ੮୔ୱǴх֖ΑSH2 domainǵLinker domainǵDNA binding domainǵCoiled-coil domainǴ೭Ѥঁ

୔ୱᆢ࡭ΑStatsޑ୷ҁ่ᄬکфૈǴԿܭځCᆄޑTAD(transcriptional activation domain)߾ڀԖ௴୏୷Ӣᙯᒵϐфૈ(32, 33)Ƕ

ӧStatsޑΎঁৎ௼ԋ঩ύǴStat3ࢂgp130ૻ৲໺ሀޑനЬाፓ࿯ޣ(31,

1.1.3 n-Butylidenephthalide (BP) ࣬ᜢғނࢲ܄ϐࣴز

Angelica sinensis ࣁゾ׎ࣽ෌ނឦܭӭԃғ૛ҁ෌ނǴࢂךॺ΋૓߫ᆀ ޑ྽ᘜǴ྽ᘜਥ೽ёΕᛰǴࢂനதҔޑύᛰϐ΋Ƕ྽ᘜӧ໺಍ύ૛ᛰ္ё

྽բ΋૓ံࠔǴӧᖏ׉ύёҔܭံՈࢲՈǵፓ࿶ЗภǴዎဉ೯ߡ (47)ǹӧ ऍ୯ΨᔈҔܭᖏ׉΢൳ঁ஁ࣽੱރ (48)ǶҞ߻Ǵςவ྽ᘜਥ೽ϩᚆளډϤ ᅿϯӝނǺ(E)-liguistilide, (Z)-ligustilide, (Z)-n-butylidenephthalide, palmitic acid, beta-sitosterol ک ferulic acid (47)Ǵځύ n-Butylidenephthalide (კΒ)ࣁന Ьाಔԋԋϩ(ຬၸ 30%)Ƕ

ӧа߻ޑࣴزύǴว౜ BP Ԗᡉ๱ޑלဍዦբҔǴόፕӧᡏϣ܈ᡏѦࣣ

ς᛾ჴ BP ёаᏤठൾ܄ဍዦғߏଶᅉǴ٠Ъ೸ၸ p53-dependent ک -independentޑૻ৲೼৩຾Չࢥఠᐒڋ٬ဍዦಒझ঒Ϋ(49, 50)Ƕ

BPԖ൳ᅿᛰҔޑ੝܄ǴٯӵǺ೸ၸ׭ڋ cyclo-oxygenase ၲډלՈλ݈

ޑբҔ(51)ǹ෧጗Ј็ภޑੱރ(52, 53)ǶԜѦǴஒ BP ޑ่ᄬу΢ hydroxyl

LIFǴ٠Ъගଯౢғ iPS cells ޑਏ౗ǶӢԜǴҁጇፕЎ຾Չ΋سӈޑჴᡍǴ

᛾ჴவ Angelica sinensis ਥ೽๧ڗрٰޑપϯӝނ BPǴёа೸ၸࢲϯ Jak2/Stat3ૻ৲໺ሀ೼৩Ǵٰᆢ࡭ ES cells ک iPS cells ޑӭૈ܄کԾך׳ཥ

ૈΚǴ٠Ъ᛾ჴ๏ϒ BP ёаቚуౢғ iPS cells ޑਏ౗Ƕ

ಃΒക ׷਑ᆶБݤ

2.1 ಒझ୻Ꭶ

2.1.1 ԴႵखजᠼᆢ҆ಒझ (Mouse Embryoic Fibroblasts)

Mouse Embryoic Fibroblasts (MEF)ࢂڗԾܭ C57BL / 6 ࠔس 13.5 Ϻޑज ႵǶஒ MEF ୻Ꭶܭ֖Ԗ 10% FBSǴ1% penicillin-Streptomycin (Invitrogen)Ǵ 1% NEAA (Invitrogen)ǴаϷ 1% L-glutamine ޑ DMEM (Invitrogen) ୻Ꭶన ύǴ٠ܫ࿼ӧ 37ɗǵ5% CO2ϐ୻ᎦጃϣғߏǴ؂ٿϺඤ΋ԛ୻ᎦనǶ྽ಒ DMEM୻ᎦనǴуΕӣྕޑ stem cell ୻Ꭶన [42.5mL 1% L-glutamine ޑ

DMEM (Invitrogen) + 7.5mL Hyclon FBS (Thermo) + 0.5mL NEAA (Invitrogen) + 91l -mercaptoethanol (Invitrogen) + 5l leukemia inhibitory factor (Millipore) ] ǴܫԿ 37ɗǵ5% CO2ϐ୻Ꭶጃϣ୻Ꭶ 1 λਔǴӆஒ stem cells୻Ꭶܭ֖Ԗ feeder cells ϐ୻ᎦҝϣǴ٠ܫ࿼ӧ 37ɗǵ5 % CO2ϐ୻Ꭶ ጃϣғߏǴܭٿϺࡕඤಃ΋ԛ୻Ꭶనϐࡕሡ؂Ϻ׳ඤ୻ᎦనǴаዴߥಒझ ғߏ܌ሡϐᎦϩкىǶ

2.2 ಒझӸࢲෳ၂ (MTT Assay)

3- (4,5-dimethyl-thiazol-2-yl) -2,5-diphenyl tetrazolium bromide (Sigma)ᙁ ᆀ MTTǴࣁ໳ՅНྋ܄ޑ tetrazolium saltǴtetrazolium bromide ࿶җࢲಒझ ಈጕᡏύϐณࣕለѐణ䁙 (mitrchondrial succinate dehydrogenases) жᖴᗋ চౢғόྋܭНޑ๋Յ؈ᐘނ formazanǴуΕ Isopropaonal ஒϐྋှǶѝԖ ࢲಒझϣϐಈጕᡏωӸӧڀԖࢲ܄ޑณࣕለѐణ䁙ǴӢԜёբࣁಒझ࿶ᛰ ނೀ౛ࡕӸࢲ౗ޑࡰ኱Ƕჴᡍ؁ᡯǺᝩж୻ᎦࡕޑಒझǴ࿶ၸಒझीኧǴ ٩؂ঁ well 5×103ޑଆۈಒझኧҞ୻Ꭶܭ 96-well ޑ culture plate ύǴ24 λ ਔࡕ౽ନচ୻ᎦనǴуΕ֖Ԗςޕόӕᐚࡋ N-Butylidenephthalide (BP) ޑ ཥᗲ୻ᎦనǴ࿶ၸόӕਔ໔ᗺ୻ᎦࡕǴܭ؂ঁ well ύϩձуΕ 10l ޑ MTT ྋన(0.5mg/mL)Ǵܫ࿼ӧ 37 ɗǵ5% CO2ϐ୻ᎦጃϣբҔ 2~4 λਔࡕǴ౽ ନӄ೽୻ᎦనǴӆ؂ঁ well ϩձуΕ 100l ޑ IsopropaonalǴа 570nm ෳۓ ځ֎ӀॶǶஒуԖᛰނྋᏊ (DMSO) ޑಔձբࣁჹྣಔǴ٠аჴᡍಔϐ֎

Ӏॶঁձନаჹྣಔϐ֎ӀॶǴբკीᆉрಒझ࣬ჹӸࢲ౗Ƕ

2.3 RNAޑ๧ڗϷ cDNA ޑᇙഢ

ಒझ୻ᎦԿ 7~8 ϩᅈਔǴ౽ନ୻ᎦనǴуΕ 1mL TRIzol (Invitrogen)Ǵ

࠻ྕ୻Ꭶ 5 ϩដǴճҔڊ׿ஒಒझӄ೽ڊΠǴӆஒ֖Ԗಒझޑ TRIzol ౽Կ 1.5mL tubeύǴкϩஒಒझѺઇࡕǴܭ tube ύуΕ 0.2mL ChloroformǴ΢Π འਗ 15 ࣾǴ࠻ྕ୻Ꭶ 2~3 ϩដǴ ᚆЈ (12000gǴ15 ϩដǴ4ɗ)ࡕǴஒ΢

మన౽Կќ΋ཥޑ 1.5mL tube ύǴӆуΕ 0.5mL Isopropyl-alcoholǴкϩష ӝࡕǴ࠻ྕ୻Ꭶ 10 ϩដǴᚆЈ (12000gǴ10 ϩដǴ4ɗ) ࡕǴ౽ନ΢మనǴ outǵ0.5l SSIII (Invitrogen)] Ъ࿼ܭ 50ɗϸᔈ 30~60 ϩដࡕǴӆ࿼ܭ 75ɗ ϸᔈ 15 ϩដࡕǴspin down ٠ᓯӸܭ-80ɗӇጃǶ

2.4 ջਔᆫӝ䁙ೱᙹϸᔈ (Real-time Polymerase Chain Reaction)

ךॺճҔ real-time PCR ٰୀෳ Oct4, Sox2, c-Myc, Klf4, Jak2, Stat3, LIF, EGF, IL5, IL11, EPOک OSM ೭٤୷Ӣޑ߄౜ໆǶჴᡍ؁ᡯǺڗ 4l ีញၸ

ޑ cDNA ϩձуΕԿ 96-well ϸᔈዬύǴௗ๱ϩձуΕ 6l ϸᔈྋన [0.5l 6M Forward Primer (߄΋) + 0.5l 6M Reverse Primer (߄΋) + 5l SYBR Green PCR Master mix (Roche)]Ǵ ࿶ ֡ Ϭ ష ӝ Ϸ spin down ࡕ ܫ Ε StepOnePlus Real-Time PCR System (Applied Biosystems) ޑሺᏔύ࿶ 95ɗ 10ϩដǴӆ຾Չ 40 ঁൻᕉයǺ95ɗ 15 ࣾǴ60ɗ 60 ࣾǶ่״ࡕǴႣෳޑ cycle threshold (CT)ॶޔௗճҔ EXCEL πբ߄ٰ຾Չϩ݋Ƕ

2.5 ᡵ܄ᕗለ䁙ࢉՅ (Alkaline Phosphatase Staining)

ஒ iPS cells ܈ ES cells ୻Ꭶܭ 6-well ޑ culture plate ύǴ࿶ 48 λਔࡕ౽ ନচ୻ᎦనǴуΕ֖Ԗςޕόӕᐚࡋ N-Butylidenephthalide (BP) ޑཥᗲ୻

ᎦనǴ࿶ၸόӕਔ໔ᗺ୻ᎦࡕǴஒ୻Ꭶన౽ନǴӆуΕ PBS ੆ዎమࢱಒझ ࡕ౽ନǴख़ፄమࢱ 2 ԛǶ྽౽ନ୻Ꭶዬϣ PBS ࡕǴϩձஒ 1mL 80% ethanol уΕ୻ᎦዬϣǴ٠ܫ࿼ܭ 4ɗڰۓ 2~24 λਔǶௗ๱ஒ୻Ꭶዬϣ 80% ethanol

౽ନǴ٠а Distilled Water ੆ዎమࢱಒझࡕ౽ନǴӆуΕ Distilled WaterǴܭ

࠻ྕ੆ݰ 2~3 ϩដࡕ౽ନǴӆа 100mM Tris-HCl buffer (pH 8.2~8.5) ܭ࠻ྕ

ύ੆ݰ 5 ϩដࡕ౽ନࡕǴ٬Ҕ Leukocyte Alkaline Phosphatase kit (Vector) ࢉ Յऊ 20~30 ϩដǴ౽ନ Alkaline Phoshatase Substrate working solutionǴа 100mM Tris-HCl buffer (pH 8.2~8.5) ੆ዎమࢱࡕǴᢀჸܡྣǶ྽҂ϩϯޑख ज༸ಒझڀԖଯໆ alkaline phosphatase ϐࢲ܄཮և౜आՅϸᔈǴςϩϯޑख ज༸ಒझ߾ alkaline phosphatase ࢲ܄եǴआՅϸᔈ১ࣗԿคՅǶ

2.6 խࣝᑻӀࢉՅ (Immunofluence stain)

ஒ iPS cells ܈ ES cells ୻Ꭶܭ 24-well ޑ culture plate ύǴ࿶ 48 λਔࡕ

౽ନচ୻ᎦనǴуΕ֖Ԗςޕόӕᐚࡋ BP ޑཥᗲ୻ᎦనǴ࿶ၸόӕਔ໔ᗺ

୻ᎦࡕǴஒ୻Ꭶన౽ନǴӆуΕ PBS ੆ዎమࢱಒझࡕ౽ନǴௗ๱уΕ 4%

paraformaldehydeܭ࠻ྕΠڰۓ 10 ϩដࡕǴ౽ନ 4% paraformaldehydeǴճ Ҕ 0.1% Tween-20 / 1X PBS ੆ዎమࢱ 3 ԛǴ؂ԛ 10 ϩដǴӆуΕ 0.3%

Triton-X 100 / 1X PBSܭ࠻ྕΠբҔ 30 ϩដஒಒझጢѺࢰаճࢉᏊ຾ΕǶ ӆճҔ 0.1% Tween-20 / 1X PBS ੆ዎమࢱ 3 ԛࡕǴуΕ 5% FBS / 1X PBS ܭ

࠻ྕΠ຾Չ blocking 2 λਔǴ຾Զᆶ 1:100 ีញࡕޑ΋ԛלᡏ[Nanog (Novus)ǵSSEA1 (Millipore)]ӧ࠻ྕΠբҔ over nightǶճҔ 0.1% Tween-20 / 1X PBS੆ዎమࢱ 5 ϩដࡕǴуΕ 1:500 ีញޑΒԛלᡏӧ࠻ྕΠᗉӀϸᔈ 1λਔࡕǴӆа 0.1% Tween-20 / 1X PBS మࢱ 10 ϩដǴ࿶֖Ԗ DAPI ࢉᏊ ޑ UltraCruz™ Mounting Medium ࠾ТࡕǴջёճҔॹҥᑻӀᡉ༾᜔ᢀჸǶ 2.7 ख ज ౚ ޑ ׎ ԋ ک ϩ ϯ (Embryoid body (EB) formation and

differentiation)

ஒES cellsճҔ֖ԖBPޑ୻Ꭶన୻ᎦΟжϐࡕǴҔEB formation medium [DMEM (GIBCO BRL)బу20% fetal bovine serum (FBS) (GIBCO BRL), 1mM -mercaptoethan (GIBCO BRL), 1% L-glutamin (GIBCO BRL), 1% insulin-transferin-selenium-Gsupplement (ITSG)(GIBCO BRL), 1%

Plate (Costar)Ǵ୻Ꭶऊ2~3ϺࡕǴES cellsߡёа׎ԋEBǶӆஒ EBҔ differentiation medium [DMEMబу20% fetal bovine serum (FBS)(GIBCO BRL), 1% L-glutamine (GIBCO BRL), 1% non-essential amino acids (NEAA)(GIBCO BRL), 1% penicillin and streptomycin (p/s)(GIBCO BRL), 1mM -mercaptoethanol (GIBCO BRL)]୻ᎦԿ٣Ӄςcoating Gelactinޑ 24-wellύǴ؂ঁwellऊ୻Ꭶ5~6ᗭޑEBǴ୻Ꭶऊ3ϺǴ٬EBёаϩϯԋΟঁ Tris-HCl (pH 7.5)Ǵ1mM EDTAǴ 0.5M NaClǴ1mM beta-MercaptoethanolǴ 1% NP40Ǵ1% GlycerolǴ1% Protein Kinase inhibitor] բҔ 30 ϩដǴ؂ 5 ϩ ដ Vortex ΋ԛǴ٬ಒझྋှనкϩషӝǴӆа 4ɗᚆЈ(13,000rpmǴ20 ϩដ)Ƕ ᚆЈࡕǴڗ΢మనԿཥޑ 1.5ml ༾ໆᚆЈᆅǶೈқ፦ᐚࡋޑෳۓ߾ࢂ٬Ҕ

“Bio-Rad Protein Assay”Ƕа BSA ྽኱ྗࠔǴଛᇙόӕᐚࡋ኱ྗࠔ (ఊࡋᐚ ࡋǺ0ǵ0.25ǵ0.5ǵ0.75ǵ1ǵ1.25Pg/Pl)Ǵஒีញޑኬࠔೈқ፦ྋనᆶ኱ྗ

ࠔӚڗр 10l ࿼ܭཥޑ 1.5ml ༾ໆᚆЈᆅύǴ٠ϩձуΕ 490l ޑ 1 ७

plateύǴ٠аݢߏ 595nm ෳۓځ֎ӀॶǴ٠ਥᏵ֎Ӏॶբр኱ྗԔጕǴа R2>0.99ޑ኱ྗԔጕωϒаीᆉԶෳໆрೈқ፦ᐚࡋǶਥᏵኬࠔೈқ፦ྋన ޑᐚࡋόӕǴуΕಒझྋှ጗ፂనϷ Laemmli sample buffer [2% SDSǴ50mM Tris-HCl (pH 6.8)Ǵ0.2mg/mL Bromphenol BlueǴ0.1M DTTǴ10% GlycerolǴ 7.5mL H2O]Ǵനಖଛᇙԋ؂ 30l ྋనύ֖Ԗ 40g ೈқ፦ޑ loading sampleǴ ӆаଳԄу዗ᏔǴ຾Չу዗Ǵ100ɗǴ10 ϩដǴஒኬࠔᓯӸܭ-80ɗӇጃύ ഢҔǶ

2.9 ౷ለΜΒ✊໊—ᆫЧ౎ㄽữᏉጤᡏႝݚȐSDS-PAGEȑ

SDS-PAGE (SDS-polyacrylamide gel eletrophoresis)຾Չ߻Ӄஒྋܭ sample bufferޑኬࠔܭ 100ɗύу዗ 3 ϩដǶҁჴᡍ࠻܌٬Ҕޑႝݚ೛ഢࣁ Bio-Rad SystemǶ२Ӄע glass plate sandwiches း࿼ӳǴځԛଛᇙ running gel (8%) Ϸ 5% stacking gelǶӆஒ፾ໆޑ 8% running gel [4mL 1.5M Tris-HCl (pH 8.8)Ǵ0.2mL 10% SDSǴ4mL 40% acrylamideǴ0.2mL 10% ammonium persulfate (APS)Ǵ0.012mL TEMEǴ10.6mL H2O ] ݙΕпኲǴǶݙΕၲ፾ໆଯࡋޑ running gelࡕǴӧ΢य़ᇸᇸᙟ΢΋ቫΒԛᇃᚖНǶࡑ running gel ᏉڰࡕǴ

౽ନ΢ቫНǴஒ comb කӧ running gel ΢БǴฅࡕݙΕ፾ໆ 5% stacking gel [1.5mL 0.5M Tris-HCl (pH 6.8)Ǵ0.06mL 10% SDSǴ0.75mL 40% acrylamideǴ 0.06mL 10% APSǴ0.006mL TEMEDǴ3.6mL H2O]Ƕ྽ stacking gel Ꮙ่ࡕǴ ஒႝݚ೛ഢးӳǴ٠౽ѐ combǶуΕ running buffer (0.025M TrisǴ0.192 M

glycineǴ3.5 mM SDS)ࡕջёஒ 30Pl ኬࠔݙΕϾࢰϣǶӧ 4ɗ຾ՉႝݚǴԶ

ႝᓸϩձࣁǺstacking gel ਔڰۓӧ 50 ҷ੝ǹ฻ډኬࠔາԿ running gel ࡕڰ ۓӧ 110 ҷ੝Ǵޔډኬࠔၲ࣒ዟ҃ᆄ፾྽Տ࿼Ƕ

2.10 ՋБᏀᗺݤȐWestern Blotting Analysisȑ

ҁჴᡍБݤЬाࢂ٩Ᏽ“ECL Western Blotting Protocols”Ƕஒಒझྋှނ

܌ڗளޑ΢మన଺ೈқ፦ۓໆϩ݋Ƕௗ๱ڗኬࠔ຾Չ΢ॊޑ SDS-PAGEǶ ڗ΋஭ᆶటᙯᅄೈқ፦ጤελ፾ӝޑ PVDF membrane (polyvinylidene difluoride membrane)Ǵஒځ੆ݰܭ 100% methanol ዎᔸǴаࢲϯ PVDF membraneǴӆஒ PVDF membrane ੆ݰܭᙯᅄ጗ፂన [25 mM TrisǴ192 mM glycineǴ20% (v/v) methanolǴpH 8.3] ύǴӆڗ 2 ஭ filter paper ک 2 ஭ Blotting Pad੆ݰܭᙯᅄ጗ፂనύǶӧॄཱུ݈΢ܫ 1 ஭ Blotting Pad ک filter paperǴ ӆע gel ܫ΢Ǵϐࡕӆܫ΢ PVDF membraneǴௗ๱ӆᇂ΢ 1 ஭ filter paper ک Blotting PadǴӆᇂ΢ཱུ݈҅ǴܫΕᙯᅄኲϣǶӧᙯᅄ጗ፂనύаڰۓӼ

ԛ 10 ϩដǶϐࡕуΕа PBS-T 1:1000 ีញϐ߃ભלᡏ(primary antibody)

[phospho-Jak2 (cell signaling)ǵJak2 (cell signaling) ǵphospho-Stat3 (cell signaling)ǵStat3 (BD)]Ǵܭ࠻ྕΠ٬ځ֡ϬբҔ 2 λਔ(ҭё 4ɗ႖ڹϸᔈ)Ƕ ߃ભלᡏ่ӝࡕǴӆа PBS-T ጗ፂనమࢱ PVDF membrane 30 ϩដǶௗ๱

уΕ Horseradish Peroxidase ܌่ӝޑΒભלᡏ(mouse 1:10000; rabbit 1:5000)Ǵܭ࠻ྕΠբҔ 1 λਔǶᒿࡕҥջа PBS-T ጗ፂనؑࢱ PVDF membrane 1 λਔǶࢱృޑ PVDF membrane നࡕуΕ ECL հӀགᔈᏊ (Amershan International, England) բҔ 3 ϩដࡕǴа೸ܴ׫ቹТᇂӧ PVDF membrane΢Ǵ٠ᇴو਻ݰǴஒ೸ܴ׫ቹТᙟᇂӳޑ PVDF membrane ѳܫ ܭ X ӀТьպύǴ٠ܭས܊ϣᓸΕଯགࡋۭТȐhyperfilm-MPȑ(Amershan International, Sweden)ǴаᡉቹᏊکۓቹᏊᡉႽǶۭТؑࢱࡕǴӆаஏࡋϩ

݋೬ᡏϩ݋ᡉቹӧۭТ΢ޑ bands மࡋǴ຾ԶΑှࡑෳೈқ፦ޑխࣝࢲ܄

߄౜Ƕ

2.11 DNA ༾ତӈϩ݋(DNA Microarray Analysis)

MEF cells࿶җ 10g/ml ک 40g/ml ޑ BP ೀ౛ 24 λਔࡕǴ๧ڗр total RNAǴӆஒځϩձ኱ۓܫ৔ጕӕՏન (Cy3)Ƕ٩Ᏽᇙ೷ቷ୘ޑ protocol ஒኬ ࠔᆶ Agilent Mouse G3 Whole Genome Oligo 8×60K Microarray (Agilent) ຾ ՉᚇҬǶArrays ޑ௟ඔࢂճҔ Microarray Scanner System (Agilent)ǶኧᏵޑ ϩ݋ࢂճҔ GeneSpring GX ೬ᡏ (Agilent)Ƕ

2.12 iPS cellsғԋਏ౗ޑෳۓ

ךॺճҔڗԾ Pou5f1-GFP ԴႵ(The Jackson Lab)ޑ MEF cells ٰୀෳ

iPS cellsғԋޑਏ౗ǶᙁൂٰᇥǴճҔওဎౢஒखजڗрǴ٠Ъஒखजޑᓐǵ ϣ᠌ǵѤަک׀ЃѐନଳృǹಔᙃǴճҔ୊Θ୊࿗Ǵӧᙯ౽ډ֖ Trypsin ޑ ၂ᆅύ੃ϯϩှǶMEF cells ୻ᎦԿى୼ໆਔǴךॺճҔӅӕᙯࢉ

pcDNA-Oct4Ǵ pcDNA-Sox2Ǵ pcDNA-c-Myc ک pcDNA-Klf4 ډ Pou5f1-GFP MEF cellsύǴ؂ٿϺᙯࢉ΋ԛ(ᕴӅѤԛ)Ǵჴᡍಔӧᙯࢉϐࡕ๏ϒ 20g/ml BPǶӧಃΐϺஒԜಒझ୻Ꭶܭ feeder cells ΢Ǵ٠࡭ុᢀჸ GFP ໚܄ޑ clones ک؂Ϻ׳ඤ୻ᎦనǶӧԜჴᡍύ BP ೀ౛ϩࣁٿಔǺ΋ಔࢂ࡭ុೀ౛ 20μg/ml ޑ BP (BP(T+P))ǹќ΋ಔ߾ࢂѝԖ iPS cells ୻Ꭶన(BP(T))Ƕ

2.13 ಍ीϩ݋

࣬ᜢኧᏵϐ໔ৡ౦߾٬Ҕ one-way ANOVA ϩ݋ᔠۓǶӆճҔ Tukey HSD٣ࡕᔠۓݤϩ݋Ǵऩ p<0.05 ߾߄Ң಍ी΢Ԗᡉ๱ৡ౦Ƕ

ಃΟക ࣴز่݀

MEF cells ࿶җόӕᐚࡋޑ BP ೀ౛ (5g/mlǵ10g/mlǵ20g/mlǵ 40g/mlǵ80g/mlǵ160g/mlǵ320g/mlǵ640g/ml)Ǵϩձӧ 24 λਔǵ72 λਔճҔ MTT assay ޑБԄᔠෳ BP ჹ MEF cells ғߏૈΚޑቹៜǶკѤᡉ Ң࿶ BP ೀ౛ࡕǴ24 λਔک 72 λਔࣣᡉҢ 80g/mlǵ160g/mlǵ320g/mlǵ 640g/mlޑೀ౛ᐚࡋ཮ቹៜ MEF cells Ӹࢲ౗Πफ़ǴӢԜךॺᒧ᏷ӧቹៜᐚ ࡋϐΠޑ 5g/mlǵ10g/mlǵ20g/mlǵ40g/ml ຾ՉௗΠٰޑჴᡍǶ

3.3 BPჹ Oct4ǵSox2ǵc-Myc ک Klf4 ୷Ӣ߄౜ໆޑቹៜ

ࣁΑෳ၂ BP ёаҔٰғԋ iPS cells ٠Ъᆢ࡭༸ಒझޑӭૈ܄೭ঁଷ ᇥǴךॺஒ MEF cells ࿶җ 5g/mlǵ10g/mlǵ20g/mlǵ40g/ml ޑ BP ೀ౛

բҔ 24 λਔࡕǴୀෳ Oct4, Sox2, c-Myc ک Klf4 ୷Ӣ߄౜ໆǶკϖᡉҢ MEF

10g/mlǵ20g/mlǵ40g/ml ޑ BP ೀ౛ࡕǴAP ໚܄ޑ୔ୱዴჴК഍܄ჹྣ

ಔ LIF OUT ቚу೚ӭǶฅԶǴES cells ࿶ 5g/ml ޑ BP ೀ౛ࡕǴAP ໚܄ޑ

୔ୱࠅؒԖКჹྣಔ LIF OUT ӭǶკΎ C ᡉҢܭᡉ༾᜔ᢀჸΠǴว౜่݀

ᆶ΢ॊ่݀࣬ӕǶҗ೭٤ኧᏵᡉҢǴӧ ES cells ୻ᎦύǴBP ԖૈΚᆢ࡭ ES cellsޑԾך׳ཥૈΚکӭૈ܄Ƕ࣬ӕޑ่݀ǴკΖ AǵB ᡉҢ iPS cells ϩ ձ࿶ 10g/mlǵ20g/mlǵ40g/ml ޑ BP ೀ౛ࡕǴAP ໚܄ޑ୔ୱዴჴК഍

܄ჹྣಔ LIF OUT ቚу೚ӭǶฅԶǴiPS cells ࿶ 5g/ml ޑ BP ೀ౛ࡕǴAP

໚܄ޑ୔ୱࠅؒԖКჹྣಔ LIF OUT ӭǶკΖ C ᡉҢܭᡉ༾᜔ᢀჸΠǴว

౜่݀ᆶ΢ॊ่݀࣬ӕǶҗ೭٤ኧᏵᡉҢǴӧ iPS cells ୻ᎦύǴBP ΨԖૈ

Κᆢ࡭ iPS cells ޑԾך׳ཥૈΚکӭૈ܄Ƕ

ԜѦǴךॺΨճҔځдޑ༸ಒझ኱૶ٰ᛾ܴ೭΋ঁଷᇥǶךॺӧ ES cells

୻ᎦਔǴϩձҔ 5g/mlǵ10g/mlǵ20g/mlǵ40g/ml ޑ BP ڗж LIFǶך ॺճҔխࣝᑻӀࢉՅǴᢀჸ Nanog ک SSEA-1 ޑᑻӀ߄౜ໆǴ᛾ჴ BP ࢂց Ψёа٬ ES cells ᆢ࡭Ծך׳ཥૈΚکӭૈ܄Ƕკΐ A ᡉҢ ES cells ϩձ࿶

10g/mlǵ20g/mlǵ40g/ml ޑ BP ೀ౛ࡕǴNanog ޑ߄౜ໆዴჴК഍܄ჹ

ྣಔ LIF OUT ቚу೚ӭǴԶ ES cells ࿶ 5g/ml ޑ BP ೀ౛ࡕǴNanog ޑ߄

౜ໆࠅؒԖКჹྣಔ LIF OUT ӭǶךॺճҔќ΋ঁ༸ಒझ኱૶ SSEA-1 ٰ ᢀჸࢂցԖ࣬ӕޑ่݀Ǵҗკΐ B ᡉҢޑ่݀ᆶ Nanog ߄౜ໆޑ่݀΋ठǶ

ךॺ٬ҔޑԴႵ iPS cells ࢂٰԾ Nanog-GFP ୷Ӣᙯ෗Ⴕ(8)Ǵ܌аךॺ Ψᙖҗᢀჸ Nanog-GFP ޑ߄౜ໆٰ᛾ჴǶკΜ A ᡉҢޑ่݀ᆶ ES cells ޑ Nanog ߄౜ໆ࣬಄Ǵ࿶җ BP 10g/mlǵ20g/mlǵ40g/ml ዴჴК഍܄ჹྣ

ಔ LIF OUT ቚу೚ӭǶკΜ B ᡉҢᆶ ES cells ޑ SSEA-1 ߄౜ໆΨ࣬྽΋ pathwaysǵECM-receptor interaction ک Jak-Stat signaling pathwaysǶୖԵ೚ӭ යтளޕ Jak-Stat signaling pathways ᆶ stem cells നࣁ࣬ᜢǴӢԜךॺᒧ᏷

Jak-Stat signaling pathways଺຾΋؁௖૸Ƕ

3.6 BPჹ Jak2 ک Stat3 ୷Ӣ߄౜ϐቹៜ

ӧ༸ಒझ࣬ᜢ Jak-Stat signaling pathways ύǴJak2 ک Stat3 ࢂᆢ࡭༸ಒ झӭૈ܄ޑനЬाፓ࿯ϐ୷ӢǶךॺஒ ES cells ࿶җ 5g/mlǵ10g/mlǵ 20g/mlǵ40g/ml ޑ BP ೀ౛բҔ 72 λਔࡕǴճҔ real time PCR ୀෳ Jak2 ک Stat3 ୷Ӣޑ߄౜௃׎ǶკΜΒᡉҢ ES cells ࿶җ BP ೀ౛ࡕǴว౜ BP 10g/mlޑᐚࡋ٬ Jak2 ک Stat3 ϐ୷Ӣቚуਏ݀നࣁᡉ๱Ƕ

3.7 BPჹ Jak2 ک Stat3 ೈқ፦߄౜ϐቹៜ

ךॺୀෳΑ Jak2 ک Stat3 ୷Ӣޑ߄౜௃׎Ǵว౜ BP Ψ཮ቹៜ Jak2 ک Stat3 ୷Ӣ߄౜ໆቚуǶ຾΋؁ǴךॺճҔՋБᏀᗺݤϩ݋ǴES cells ࿶җ 5g/mlǵ10g/mlǵ20g/mlǵ40g/ml ޑ BP ೀ౛բҔ 72 λਔࡕǴJak2 ک Stat3

ೈқ፦߄౜௃׎Ƕ(კΜΟ A) ES cells ࿶җ BP ೀ౛բҔ 72 λਔǴJak2 ک phosphorylation-Jak2ޑೈқ፦߄౜ໆᆶ഍܄ჹྣಔ LIF OUT КၨԖܴᡉቚ уǶკΜΟ B ᡉҢ࣬ӕޑ่݀ǴES cells ࿶җ BP ೀ౛բҔ 72 λਔǴStat3 ک phosphorylation-Stat3 ೈқ፦߄౜ໆᆶ഍܄ჹྣಔ LIF OUT КၨΨԖܴᡉ ቚуǶ

3.8 BPჹ cytokine ޑ୷Ӣ߄౜ϐቹៜ

җ΢ॊޑኧᏵᡉҢǴ༸ಒझ࿶җ BP ೀ౛ࡕǴёаࢲϯ Jak2-Stat3 signaling pathwaysǶࣁΑ൨פ BP ࢂ೸ၸব΋ঁ cytokineǴ຾Զࢲϯ Jak2-Stat3 signaling pathwaysǴךॺճҔ real time PCR ٰϩ݋ፓ௓ Jak2-Stat3 signaling

pathways ޑ΢ෞ cytokine ϐ୷Ӣ߄౜ໆǶკΜѤᡉҢஒ ES cells ࿶җ 5g/mlǵ10g/mlǵ20g/mlǵ40g/ml ޑ BP ೀ౛բҔ 72 λਔࡕǴୀෳ LIF, EGF, IL5, IL11, EPO ک OSM ୷Ӣޑ߄౜ໆǶว౜ ES cells ࿶җ 10g/ml ޑ BPೀ౛բҔ 72 λਔࡕǴLIF, EGF, IL5, IL11, EPO ک OSM ୷Ӣޑ߄౜ໆᆶ

഍܄ჹྣಔ LIF OUT ࣬КዴჴԖᡉ๱ޑቚуǶ 3.9 BPჹ iPS cells ғԋϐቹៜ

җа΢ޑኧᏵᡉҢǴBP ёаቚу Oct4 ک Sox2 ୷Ӣ߄౜ໆǴԶЪёа ᆢ࡭༸ಒझޑԾך׳ཥૈΚکӭૈ܄ǶӢԜǴךॺճҔ MEF cells ᙯࢉ Oct4, Sox2, c-Myc, Klf4Ѥঁ୷ӢǴӕਔуΕ BP ၂კቚуౢғ iPS cells ޑਏ౗Ƕ ךॺ٬ҔޑԴႵ MEF cells ࢂٰԾ Oct4-GFP ୷Ӣᙯ෗ႵǴ܌аךॺΨᙖҗ ᢀჸ Oct4-GFP ޑ߄౜ໆٰ᛾ჴǶკΜϖᡉҢ MEF cells ࿶ 20g/ml BP ೀ౛

ࡕǴOct4-GFP ޑ߄౜ໆዴჴК഍܄ჹྣಔቚу೚ӭǴԶ BP(T+P) (seeding ࡕ࡭ុу BP)ѝԖӧಃϤϺ Oct4-GFP ޑ߄౜ໆК BP(T) (seeding ࡕό࡭ុ

у BP)ᡉ๱Ǵ೭Ψཀښ๱ǴӧᙯࢉޑၸำύуΕ BP ೀ౛཮ቚу iPS cells ғ ԋޑਏ౗Ƕ

ಃѤക ૸ፕ

༸ಒझёа຾ՉԾך׳ཥکϩϯԋӭᅿಒझᜪࠠǴ٠ЪᔈҔܭӭᅿᖏ׉

ݯᕍ(55)Ƕךॺૈ຾ՉᡏѦ୻Ꭶޑ܌Ԗ༸ಒझύǴES cells ڀԖӭૈ܄کϩ ϯԋΟঁЬाखቫಒझޑ੝܄Ǵ೭٤ख़ाޑ੝܄ёаౢғ଼நޑಒझҔܭ ᖏ׉ݯᕍǶӧ 2006 ԃǴВҁޑ Takahashi ი໗ᙖҗᙯࢉ Oct4, Sox2, c-Myc ک Klf4 ೭Ѥঁ୷Ӣ຾Εᡏಒझౢғ iPS cells (8)ǴԜ iPS cells ёаլܺ ES cells ܌य़ᖏޑٿঁख़ाϐୢᚒǺխࣝ௨ѾϸᔈکᙴᕍၰቺǴӧ҂ٰѬ཮ԋ ࣁ΋໨ߚதख़ाޑಒझݯᕍϐמೌǶՠࢂǴES ک iPS cells ޑ୻ᎦѸ໪ᙖҗ LIFٰࢲϯ Jak-Stat pathwayǴԶᆢ࡭ځӭૈ܄(39)ǶԜѦǴiPS cells ғԋਏ

౗ߚதեࢂҞ߻ iPS cells מೌޑനεज़ڋǶӧҁࣴزύǴךॺว౜΋ঁપ

Ψࢂ BP ٬Ҕܭ༸ಒझޑ२ԛࣴزǶ

ٰ୻Ꭶ ES celltǴว౜ BP Ψёаᡣ Oct4, Sox2, c-Myc ک Klf4 ୷Ӣ߄౜ܴ

ᡉቚу(კϤ)Ƕ٠Ъ٬Ҕ BP ٰ୻Ꭶ ES ک iPS cellsǴךॺҔΑ൳ঁ༸ಒझ኱

૶Ǵх֖ AP ࢉՅǵNanog ک SSEA1Ǵٰዴۓ BP ёаڗж LIF ٰ୻Ꭶ ES ک iPS cellsǴЀځࢂ 10 ک 20 g/ml (კΎǵΖǵΐǵΜ)Ǵ೭ঁኧᏵᆶ Oct4 ک Sox2 ୷Ӣ߄౜ޑኧᏵ΋ठǶԜѦǴךॺճҔ 10 g/ml ޑ BP ڗж LIF ٰ

୻Ꭶ ES ک iPS cellsǴ࿶ၸΟж୻ᎦࡕǴճҔ embryoid body (EB)׎ԋ೭ঁ

מೌ(3, 8)Ǵٰෳ၂༸ಒझޑӭૈ܄Ǵ೭ঁኧᏵࡰрǴBP ёаڗж LIF ٰ୻

Ꭶ ES ک iPS cellsǶ

ࣁΑࣴز BP ೀ౛ࡕځբҔޑᐒڋǴךॺճҔ microarray ϩ݋פр BP Ьाፓ࿯ޑ೼৩Ƕ߻ΟӜޑ೼৩ǺPPAR signaling pathwayǵ ECM-receptor interaction ک Jak-Stat signaling pathway (߄Β)Ƕӧ 2010 ԃǴMo et al.ࣴزᡉ Ң PPAR ፓ࿯ LIF ೸ၸ Tyk2-Stat3 ೼৩ǴᇨᏤԴႵޑखज༸ಒझғߏᆶԾ ך׳ཥ(59)ǶךॺୀෳΑ ES cells ࿶ BP ೀ౛ࡕ PPAR ޑ୷Ӣ߄౜Ǵว౜

PPAR ୷Ӣ߄౜ᆶ௓ڋಔ࣬К٠ؒԖৡ౦ǴਥᏵ೭ঁচӢǴךॺஒ๱ख़ܭ Jak-Stat signaling pathway Ƕ ך ॺ ዴ ᇡ ༸ ಒ झ ࿶ BP ೀ ౛ ࡕ Ǵ phosphorylation-Jak2 ک phosphorylation-Stat3 ޑೈқ፦߄౜ቚу(კΜΟ)Ƕ LIFޑૻ৲೸ၸ Jak ࢲϯΑ࣬ᜢޑૻ৲໺ሀǴ٠Ъࢲϯ Stat3 (39)Ǵჹܭ ES cells ޑԾך׳ཥૈΚ LIF ࢂתᄽ΋ঁόё܈લޑفՅ(31)ǶךॺޑኧᏵࡰ

рǴ࿶ BP ೀ౛ёаࢲϯ Jak2 ک Stat3 ٬ ES cells ᆢ࡭Ծך׳ཥૈΚǶԜѦǴ

Jak-Stat signaling pathwayёа೸ၸ LIF, EGF, EPO, IL5, IL11 ک OSM (17-21) ύǴԖ΋ঁλϩη[valproic acid (VPA)]ёаҔٰගଯ iPS cells ޑғԋਏ౗

(10)ǶVPA ٠ό཮ቚу Oct4 ک Sox2 ޑ୷Ӣ߄౜ǴՠࢂѬ཮ቚуੰࢥ൪Ε

ךॺዴۓΑ BP ೸ၸፓ࿯ୖᆶܭ Jak2-Stat3 signaling pathways ύޑಒझ ᐟનǴቚу Jak2 ک Stat3 ޑೈқ፦߄౜Ǵᡣ༸ಒझᆢ࡭ӭૈ܄کԾך׳ཥ

ૈΚǹԜѦǴBP ޑೀ౛ࡕёаቚу iPS cells ғԋޑਏ౗Ƕஒٰ BP ёаว

৖ԋࣁ଼ந१ࠔǴҔٰࢲϯ༸ಒझǴԶЪӧ҂ٰ BP ёаҔܭׯ๓ iPS cell ғԋϐਏ౗Ƕ

ୖԵЎ᝘

1. Evans, M. J., and Kaufman, M. H. (1981) Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154-156

2. Martin, G. R. (1981) Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A 78, 7634-7638

3. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861-872

4. Marson, A., Levine, S. S., Cole, M. F., Frampton, G. M., Brambrink, T., Johnstone, S., Guenther, M. G., Johnston, W. K., Wernig, M., Newman, J., Calabrese, J. M., Dennis, L.

M., Volkert, T. L., Gupta, S., Love, J., Hannett, N., Sharp, P. A., Bartel, D. P., Jaenisch, R., and Young, R. A. (2008) Connecting microRNA genes to the core transcriptional regulatory circuitry of embryonic stem cells. Cell 134, 521-533

5. Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A., Swiergiel, J. J., Marshall, V. S., and Jones, J. M. (1998) Embryonic stem cell lines derived from human blastocysts. Science 282, 1145-1147

6. Liu, S. P., Fu, R. H., Yu, H. H., Li, K. W., Tsai, C. H., Shyu, W. C., and Lin, S. Z. (2009) MicroRNAs regulation modulated self-renewal and lineage differentiation of stem cells.

Cell Transplant 18, 1039-1045

7. Kim, D. S., Kim, J. Y., Kang, M., Cho, M. S., and Kim, D. W. (2007) Derivation of functional dopamine neurons from embryonic stem cells. Cell Transplant 16, 117-123 8. Takahashi, K., and Yamanaka, S. (2006) Induction of pluripotent stem cells from mouse

embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676

9. Ezashi, T., Das, P., and Roberts, R. M. (2005) Low O2 tensions and the prevention of differentiation of hES cells. Proc Natl Acad Sci U S A 102, 4783-4788

10. Huangfu, D., Osafune, K., Maehr, R., Guo, W., Eijkelenboom, A., Chen, S., Muhlestein, W., and Melton, D. A. (2008) Induction of pluripotent stem cells from primary human fibroblasts with only Oct4 and Sox2. Nat Biotechnol 26, 1269-1275

11. Kawase, E., Suemori, H., Takahashi, N., Okazaki, K., Hashimoto, K., and Nakatsuji, N.

(1994) Strain difference in establishment of mouse embryonic stem (ES) cell lines. Int J Dev Biol 38, 385-390

12. Ichikawa, Y. (1970) Further studies on the differentiation of a cell line of myeloid leukemia. J Cell Physiol 76, 175-184

13. Smith, A. G. (1992) Mouse embryo stem cells: their identification, propagation and manipulation. Semin Cell Biol 3, 385-399

14. Williams, R. L., Hilton, D. J., Pease, S., Willson, T. A., Stewart, C. L., Gearing, D. P.,

Wagner, E. F., Metcalf, D., Nicola, N. A., and Gough, N. M. (1988) Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells. Nature 336, 684-687

15. Moreau, J. F., Donaldson, D. D., Bennett, F., Witek-Giannotti, J., Clark, S. C., and Wong, G. G. (1988) Leukaemia inhibitory factor is identical to the myeloid growth factor human interleukin for DA cells. Nature 336, 690-692

16. Smith, A. G., Heath, J. K., Donaldson, D. D., Wong, G. G., Moreau, J., Stahl, M., and Rogers, D. (1988) Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336, 688-690

17. Metcalf, D. (1991) The leukemia inhibitory factor (LIF). Int J Cell Cloning 9, 95-108 18. Ip, N. Y., Nye, S. H., Boulton, T. G., Davis, S., Taga, T., Li, Y., Birren, S. J., Yasukawa,

K., Kishimoto, T., Anderson, D. J., and et al. (1992) CNTF and LIF act on neuronal cells via shared signaling pathways that involve the IL-6 signal transducing receptor component gp130. Cell 69, 1121-1132

19. Wijdenes, J., Heinrich, P. C., Muller-Newen, G., Roche, C., Gu, Z. J., Clement, C., and Klein, B. (1995) Interleukin-6 signal transducer gp130 has specific binding sites for different cytokines as determined by antagonistic and agonistic anti-gp130 monoclonal antibodies. Eur J Immunol 25, 3474-3481

20. Gearing, D. P., Thut, C. J., VandeBos, T., Gimpel, S. D., Delaney, P. B., King, J., Price, V., Cosman, D., and Beckmann, M. P. (1991) Leukemia inhibitory factor receptor is structurally related to the IL-6 signal transducer, gp130. EMBO J 10, 2839-2848

21. Guschin, D., Rogers, N., Briscoe, J., Witthuhn, B., Watling, D., Horn, F., Pellegrini, S., Yasukawa, K., Heinrich, P., Stark, G. R., and et al. (1995) A major role for the protein tyrosine kinase JAK1 in the JAK/STAT signal transduction pathway in response to interleukin-6. EMBO J 14, 1421-1429

22. Matsuda, T., Nakamura, T., Nakao, K., Arai, T., Katsuki, M., Heike, T., and Yokota, T.

(1999) STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells. EMBO J 18, 4261-4269

23. Sumi, T., Fujimoto, Y., Nakatsuji, N., and Suemori, H. (2004) STAT3 is dispensable for maintenance of self-renewal in nonhuman primate embryonic stem cells. Stem Cells 22, 861-872

24. Burdon, T., Stracey, C., Chambers, I., Nichols, J., and Smith, A. (1999) Suppression of SHP-2 and ERK signalling promotes self-renewal of mouse embryonic stem cells. Dev Biol 210, 30-43

25. Gual, P., Baron, V., Lequoy, V., and Van Obberghen, E. (1998) Interaction of Janus kinases JAK-1 and JAK-2 with the insulin receptor and the insulin-like growth factor-1 receptor. Endocrinology 139, 884-893

26. Andus, T., Geiger, T., Hirano, T., Kishimoto, T., and Heinrich, P. C. (1988) Action of

recombinant human interleukin 6, interleukin 1 beta and tumor necrosis factor alpha on the mRNA induction of acute-phase proteins. Eur J Immunol 18, 739-746

27. Narazaki, M., Witthuhn, B. A., Yoshida, K., Silvennoinen, O., Yasukawa, K., Ihle, J. N., Kishimoto, T., and Taga, T. (1994) Activation of JAK2 kinase mediated by the interleukin 6 signal transducer gp130. Proc Natl Acad Sci U S A 91, 2285-2289

28. Stahl, N., Boulton, T. G., Farruggella, T., Ip, N. Y., Davis, S., Witthuhn, B. A., Quelle, F.

W., Silvennoinen, O., Barbieri, G., Pellegrini, S., and et al. (1994) Association and activation of Jak-Tyk kinases by CNTF-LIF-OSM-IL-6 beta receptor components.

Science 263, 92-95

29. Parganas, E., Wang, D., Stravopodis, D., Topham, D. J., Marine, J. C., Teglund, S., Vanin, E. F., Bodner, S., Colamonici, O. R., van Deursen, J. M., Grosveld, G., and Ihle, J. N. (1998) Jak2 is essential for signaling through a variety of cytokine receptors. Cell 93, 385-395

30. Darnell, J. E., Jr. (1997) STATs and gene regulation. Science 277, 1630-1635

31. Raz, R., Lee, C. K., Cannizzaro, L. A., d'Eustachio, P., and Levy, D. E. (1999) Essential role of STAT3 for embryonic stem cell pluripotency. Proc Natl Acad Sci U S A 96, 2846-2851

32. Schindler, C. (1999) Cytokines and JAK-STAT signaling. Exp Cell Res 253, 7-14 33. Bromberg, J., and Darnell, J. E., Jr. (2000) The role of STATs in transcriptional control

and their impact on cellular function. Oncogene 19, 2468-2473

34. Raz, R., Durbin, J. E., and Levy, D. E. (1994) Acute phase response factor and additional members of the interferon-stimulated gene factor 3 family integrate diverse signals from cytokines, interferons, and growth factors. J Biol Chem 269, 24391-24395 35. Zhong, Z., Wen, Z., and Darnell, J. E., Jr. (1994) Stat3: a STAT family member

activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science 264, 95-98

36. Akira, S., Nishio, Y., Inoue, M., Wang, X. J., Wei, S., Matsusaka, T., Yoshida, K., Sudo, T., Naruto, M., and Kishimoto, T. (1994) Molecular cloning of APRF, a novel IFN-stimulated gene factor 3 p91-related transcription factor involved in the gp130-mediated signaling pathway. Cell 77, 63-71

37. Lutticken, C., Wegenka, U. M., Yuan, J., Buschmann, J., Schindler, C., Ziemiecki, A., Harpur, A. G., Wilks, A. F., Yasukawa, K., Taga, T., and et al. (1994) Association of transcription factor APRF and protein kinase Jak1 with the interleukin-6 signal transducer gp130. Science 263, 89-92

38. Wegenka, U. M., Buschmann, J., Lutticken, C., Heinrich, P. C., and Horn, F. (1993) Acute-phase response factor, a nuclear factor binding to acute-phase response elements, is rapidly activated by interleukin-6 at the posttranslational level. Mol Cell Biol 13, 276-288

39. Niwa, H., Burdon, T., Chambers, I., and Smith, A. (1998) Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev 12, 2048-2060 40. Boeuf, H., Hauss, C., Graeve, F. D., Baran, N., and Kedinger, C. (1997) Leukemia

inhibitory factor-dependent transcriptional activation in embryonic stem cells. J Cell Biol 138, 1207-1217

41. Minami, M., Inoue, M., Wei, S., Takeda, K., Matsumoto, M., Kishimoto, T., and Akira, S. (1996) STAT3 activation is a critical step in gp130-mediated terminal differentiation and growth arrest of a myeloid cell line. Proc Natl Acad Sci U S A 93, 3963-3966 42. Nakajima, K., Yamanaka, Y., Nakae, K., Kojima, H., Ichiba, M., Kiuchi, N., Kitaoka, T.,

Fukada, T., Hibi, M., and Hirano, T. (1996) A central role for Stat3 in IL-6-induced regulation of growth and differentiation in M1 leukemia cells. EMBO J 15, 3651-3658 43. Yamanaka, Y., Nakajima, K., Fukada, T., Hibi, M., and Hirano, T. (1996)

Differentiation and growth arrest signals are generated through the cytoplasmic region of gp130 that is essential for Stat3 activation. EMBO J 15, 1557-1565

44. Cressman, D. E., Greenbaum, L. E., DeAngelis, R. A., Ciliberto, G., Furth, E. E., Poli, V., and Taub, R. (1996) Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice. Science 274, 1379-1383

45. Sierra-Honigmann, M. R., Nath, A. K., Murakami, C., Garcia-Cardena, G., Papapetropoulos, A., Sessa, W. C., Madge, L. A., Schechner, J. S., Schwabb, M. B., Polverini, P. J., and Flores-Riveros, J. R. (1998) Biological action of leptin as an angiogenic factor. Science 281, 1683-1686

46. Vaisse, C., Halaas, J. L., Horvath, C. M., Darnell, J. E., Jr., Stoffel, M., and Friedman, J.

M. (1996) Leptin activation of Stat3 in the hypothalamus of wild-type and ob/ob mice but not db/db mice. Nat Genet 14, 95-97

47. Wang, H., Chen, R., and Xu, H. (1998) [Chemical constituents of radix Angelicae Sinensis]. Zhongguo Zhong Yao Za Zhi 23, 167-168, inside backcover

48. Abebe, W. (2002) Herbal medication: potential for adverse interactions with analgesic drugs. J Clin Pharm Ther 27, 391-401

49. Tsai, N. M., Lin, S. Z., Lee, C. C., Chen, S. P., Su, H. C., Chang, W. L., and Harn, H. J.

(2005) The antitumor effects of Angelica sinensis on malignant brain tumors in vitro and in vivo. Clin Cancer Res 11, 3475-3484

50. Tsai, N. M., Chen, Y. L., Lee, C. C., Lin, P. C., Cheng, Y. L., Chang, W. L., Lin, S. Z., and Harn, H. J. (2006) The natural compound n-butylidenephthalide derived from Angelica sinensis inhibits malignant brain tumor growth in vitro and in vivo. J Neurochem 99, 1251-1262

51. Teng, C. M., Chen, W. Y., Ko, W. C., and Ouyang, C. H. (1987) Antiplatelet effect of butylidenephthalide. Biochim Biophys Acta 924, 375-382

52. Ko, W. C., Sheu, J. R., Tzeng, S. H., and Chen, C. M. (1998) The selective antianginal

effect without changing blood pressure of butylidenephthalide in conscious rats. Planta Med 64, 229-232

53. Ko, W. C., Liao, C. C., Shih, C. H., Lei, C. B., and Chen, C. M. (2002) Relaxant effects of butylidenephthalide in isolated dog blood vessels. Planta Med 68, 1004-1009

54. Mimura, Y., Kobayashi, S., Naitoh, T., Kimura, I., and Kimura, M. (1995) The structure-activity relationship between synthetic butylidenephthalide derivatives regarding the competence and progression of inhibition in primary cultures proliferation of mouse aorta smooth muscle cells. Biol Pharm Bull 18, 1203-1206

55. Liu, S. P., Fu, R. H., Huang, Y. C., Chen, S. Y., Chien, Y. J., Hsu, C. Y., Tsai, C. H., Shyu, W. C., and Lin, S. Z. (2011) Induced pluripotent stem (iPS) cell research overview. Cell Transplant 20, 15-19

56. Lin, P. C., Chen, Y. L., Chiu, S. C., Yu, Y. L., Chen, S. P., Chien, M. H., Chen, K. Y., Chang, W. L., Lin, S. Z., Chiou, T. W., and Harn, H. J. (2008) Orphan nuclear receptor, Nurr-77 was a possible target gene of butylidenephthalide chemotherapy on glioblastoma multiform brain tumor. J Neurochem 106, 1017-1026

57. Chen, Y. L., Jian, M. H., Lin, C. C., Kang, J. C., Chen, S. P., Lin, P. C., Hung, P. J., Chen, J. R., Chang, W. L., Lin, S. Z., and Harn, H. J. (2008) The induction of orphan nuclear receptor Nur77 expression by n-butylenephthalide as pharmaceuticals on hepatocellular carcinoma cell therapy. Mol Pharmacol 74, 1046-1058

58. Heng, J. C., Feng, B., Han, J., Jiang, J., Kraus, P., Ng, J. H., Orlov, Y. L., Huss, M., Yang, L., Lufkin, T., Lim, B., and Ng, H. H. (2010) The nuclear receptor Nr5a2 can replace Oct4 in the reprogramming of murine somatic cells to pluripotent cells. Cell Stem Cell 6, 167-174

59. Mo, C., Chearwae, W., and Bright, J. J. (2010) PPARgamma regulates LIF-induced growth and self-renewal of mouse ES cells through Tyk2-Stat3 pathway. Cell Signal 22, 495-500

60. Yamanaka, S. (2009) A fresh look at iPS cells. Cell 137, 13-17

61. Esteban, M. A., Wang, T., Qin, B., Yang, J., Qin, D., Cai, J., Li, W., Weng, Z., Chen, J., Ni, S., Chen, K., Li, Y., Liu, X., Xu, J., Zhang, S., Li, F., He, W., Labuda, K., Song, Y., Peterbauer, A., Wolbank, S., Redl, H., Zhong, M., Cai, D., Zeng, L., and Pei, D. (2010) Vitamin C enhances the generation of mouse and human induced pluripotent stem cells.

Cell Stem Cell 6, 71-79

62. Burdon, T., Chambers, I., Stracey, C., Niwa, H., and Smith, A. (1999) Signaling mechanisms regulating self-renewal and differentiation of pluripotent embryonic stem cells. Cells Tissues Organs 165, 131-143

კ߄

߄΋ǵջਔۓໆᆫӝ䁙ೱᙹϸᔈׇӈ΋ំ߄

Primer Forward SequenceǺ(5’-3’) Reverse SequenceǺ(5’-3’) Taqman Probe

Sox2 AGGGCTGGACTGCGAACTG TTTGCACCCCTCCCAATTC c-Myc CATTCAAGCAGACGAGCA CGAGTTAGGTCAGTTTATGCAC

Klf4 CCTTTCAGTGCCAGAAGT ACTACGTGGGATTTAAAAGTGC Jak2 CAATGATAAACAAGGGCAAATGAT CTTGGCAATCTTCCGTTGCT Stat3 CCCCGTACCTGAAGACCAAGT CCGTTATTTCCAAACTGCATCA

EGF GAGTCTGCCTGCGGATGGT GCTGCAGGGAGGGAGACA EPO CCCCCACGCCTCATCTG TGCCTCCTTGGCCTCTAAGA

IL5 TCCCTGCTACTCTCCCCAAA CAACCTTCTCTCTCCCCAAGAA IL11 CATGCCACACCCCAAACAA CCCCTCACCCAGGTCTACTG LIF CCTACCTGCGTCTTACTCCATCA TGTTTTCCCCAAAGGCTCAA OSM CGGTCCACTACAACACCAGATG GCGATGGTATCCCCAGAGAA

͊-Actin GTGCGTGACATCAAAGAGAAGC TGGATGCCACAGGATTCCATAC

Taqman-Oct4 GAGGCTACAGGGACACCTTTC GTGCCAAAGTGGGGACCT Roche Universal Probes 6 Taqman-͊-Actin CTAAGGCCAACCGTGAAAAG ACCAGAGGCATACAGGGACA Roche Universal Probes 64

߄ΒǵճҔ KEGG ک Babelomics ၗ਑৤ϩ݋ᡉ๱߄౜ޑ୷ӢኧᏵᆶғނф

ૈϩᜪǶ

I: number of upregulated genes; D: number of downregulated genes.

კ΋ǵLIF ೸ၸࢲϯ Jak/Stat3 signaling pathwaysǴፓ௓༸ಒझޑғނࢲ܄Ǵ კᘏڗԾЎക(62)Ƕ

კΒǵn-Butylidenephthalide ޑϯᏢ่ᄬ

კΟǵճҔ real-time PCR ୀෳ MEF cells ϩձೀ౛ 18 ᅿόӕᐚࡋޑύ૛ᛰ բҔ 24 λਔࡕǴOct4 ک Sox2 ୷Ӣ߄౜ໆǶ

კѤǵճҔ MTT assay ϩ݋ BP ჹ MEF cells ғߏૈΚޑቹៜǶMEF cells

ೀ౛όӕᐚࡋޑ BP ϩձբҔ 24 ک 72 λਔǶӚಔ࣬ჹ֎Ӏॶޑѳ֡ॶᆶ኱

ྗৡǶ*P  0.05 versus control (DMSO*Ƕ

კϖǵճҔ real-time PCR ୀෳ MEF cells ೀ౛όӕᐚࡋ BP բҔ 24 λਔࡕǴ Oct4, Sox2, c-Myc, Klf4୷Ӣ߄౜ໆǶ*P  0.05 versus control (DMSO*Ƕ!

კϤǵճҔ real-time PCR ୀෳ ES cells ೀ౛όӕᐚࡋ BP բҔ 72 λਔࡕǴ Oct4, Sox2, c-Myc, Klf4୷Ӣ߄౜ໆǶ*P  0.05 versus control (LIF OUT).

(A) (B)

(C)

კΎǵ(A) ES cells ೀ౛όӕᐚࡋ BP բҔ 72 λਔࡕǴճҔ alkaline phosphatase stainingϩ݋९ᕒკǶ(B) Οԛᐱҥჴᡍޑѳ֡ॶr SD Ƕ*P  0.05 versus LIF OUT. (C) ES cellsೀ౛όӕᐚࡋޑBP բҔ72 λਔࡕǴalkaline phosphatase stainingܭ 40 ७ᡉ༾᜔კǶ

LIF OUT LIF BP 5

BP 40 BP 20

BP 10

(A) (B)

(C)

კΖǵ(A) iPS cells ೀ౛όӕᐚࡋ BP բҔ 72 λਔࡕǴճҔ alkaline phosphatase stainingϩ݋९ᕒკǶ(B) Οԛᐱҥჴᡍޑѳ֡ॶr SDǶ*P  0.05 versus LIF OUT. (C) iPS cellsೀ౛όӕᐚࡋޑ BP բҔ 72 λਔࡕǴalkaline phosphatase stainingܭ 40 ७ᡉ༾᜔კǶ

(A)

LIF OUT LIF BP 5 BP 10 BP 20 BP 40

Merge Merge Merge Merge Merge Merge

Nanog

DAPI DAPI DAPI DAPI DAPI DAPI

Nanog Nanog Nanog Nanog Nanog

100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm

100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm

100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm

(B)

LIF OUT LIF BP 5 BP 10 BP 20 BP 40

Merge Merge Merge Merge Merge Merge

SSEA1 SSEA1 SSEA1 SSEA1 SSEA1 SSEA1

DAPI DAPI DAPI DAPI DAPI DAPI

100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm

100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm

100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm

კΐǵ(A) ES cells ೀ౛όӕᐚࡋ BP բҔ 72 λਔࡕǴӧᑻӀᡉ༾᜔Πᢀჸ Nanog-GFPޑ߄౜ໆǶ(B) ES cells ೀ౛όӕᐚࡋ BP բҔ 72 λਔࡕǴӧᑻ Ӏᡉ༾᜔Πᢀჸ SSEA1 ޑ߄౜ໆǶ

(A)

LIF out LIF BP5

BP10 BP20 BP40

100ȫm 100ȫm 100ȫm

100ȫm 100ȫm 100ȫm

(B)

LIF OUT LIF BP 5 BP 10 BP 20 BP 40

Merge Merge Merge Merge Merge Merge

SSEA1 SSEA1 SSEA1 SSEA1 SSEA1 SSEA1

DAPI DAPI DAPI DAPI DAPI DAPI

100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm

100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm

100ȫm 100ȫm 100ȫm 100ȫm 100ȫm 100ȫm

კΜǵ(A) iPS cells ೀ౛όӕᐚࡋ BP բҔ 72 λਔࡕǴӧᑻӀᡉ༾᜔Πᢀჸ Nanog-GFPޑ߄౜ໆǶ(B) iPS cells ೀ౛όӕᐚࡋ BP բҔ 72 λਔࡕǴӧᑻ Ӏᡉ༾᜔Πᢀჸ SSEA1 ޑ߄౜ໆǶ

Ectoderm

DAPI

Merge Geta-4

Endoderm

Merge Ƞ-SMA

DAPI

Mesoderm

Merge Tuj-1 DAPI

50ȫm 50ȫm 50ȫm

50ȫm 50ȫm 50ȫm

50ȫm 50ȫm 50ȫm

კΜ΋ǵճҔ BP ڗж LIF ୻Ꭶ ES cells Οжϐࡕ٬ϐ׎ԋ EB ϩϯғԋΟ खቫಒझǶ

კΜΒǵճҔ real-time PCR ୀෳ ES cells ೀ౛όӕᐚࡋ BP բҔ 72 λਔࡕǴ Jak2ک Stat3 ୷Ӣ߄౜ໆǶ*P  0.05 versus LIF OUT.

(A)

(B)

კΜΟǵ(A) ES cells ೀ౛όӕᐚࡋ BP բҔ 72 λਔࡕǴճҔ western blot ϩ݋ Jak2 ک phosphorylation-Jak2 ೈқ፦߄౜ໆǶ(B) ES cells ೀ౛όӕᐚࡋ BPբҔ 72 λਔࡕǴճҔ western blot ϩ݋ Stat3 ک phosphorylation-Stat3 ೈ қ፦߄౜ໆǶ

კΜѤǵճҔ real-time PCR ୀෳ ES cells ೀ౛όӕᐚࡋ BP բҔ 72 λਔࡕǴ LIF, EGF, IL5, IL11, EPO, OSM୷Ӣ߄౜ໆǶ*P  0.05 versus LIF OUT.

0 positive clones಍ीբკǶControlǺᙯ෗ Oct4, Sox2, c-Myc, Klf4ǹBP (T)Ǻ ᙯࢉ Oct4, Sox2, c-Myc, Klf4 ӧᙯࢉၸำύу BPǴϐࡕ୻Ꭶ߾όуǹBP (T+P)Ǻᙯࢉ Oct4, Sox2, c-Myc, Klf4 ӧᙯࢉၸำکϐࡕ୻Ꭶࣣ࡭ុу BPǶ

相關文件