PART I THE APPLICATION AND MECHANISMS TO TREAT
II. MATERIAL AND METHOD
Human neuroblastoma SK-N-SH cells were cultured in growth medium with DMEM (Dulbecco's Modified Eagle Medium) and 10%
FBS (fetal bovine serum, GIBCO) in the humidified atmosphere with 5%
CO2 at 37 °C. In ΔC-TBP-polyQ experiments, 2 104 cells/well in 12-well plate were seeded and induced with doxycycline for 4 days. Both ΔC-TBP-polyQ cells and Httex1-polyQ cells will be treated OC-13 (5, 10 or 20 μM) or vehicle control DMSO 0.2% for 12 to 48 h for all in this study.
2. Plasmid and transfection
The hemagglutinin-tagged full-length TBP/Q36 and Q79 cDNA inserts in the pGEM-T Easy (Promega Corporation, Fitchburg, WI, USA) and pcDNA5/FRT/TO (Thermo Fisher Scientific, Waltham, MA, USA) vectors were generated similar to previously described [36]. To manufacture C-terminus-deleted ΔC-TBP/Q79-EGFP construct, the EcoRI (in the multiple cloning sites (MCS) of pGEM-T Easy)-RsaI fragment containing N-terminus ΔC-TBP/Q79 (203 amino acids) was cut from the cloned TBP/Q79 cDNA and fused in-frame with the EGFP gene between the EcoRI and RsaI sites in the MCS of the pEGFP-N1 vector (Clontech, Mountain View, CA, USA). The Kozak sequence of the EGFP gene was removed by polymerase chain reaction using the site-directed primer
CGGGCCCGGGATCCACCGGTCGCCΔGTGAGCAAGGGCGAGGA
22
GCTG (Δ = ACCATG). The deleted Kozak sequence was confirmed by DNA sequencing [37].
In experiments for ΔC-TBP-polyQ, the stable cell lines were
established by transfection with
C-TBP/Q36 or
C-TBP/Q79 construct
and selected by Blasticidin (20 μg/mL) (Sigma-Aldrich, St Louis, MO) for 24 h in 60-mm dish plate. EGFP-conjugated ΔC-TBP-polyQ was expressed by doxycycline (20 μg/mL, Invitrogen) for four days in stable cell lines.The two Httex1 constructs, Httex1-polyQ-GFP (Httex1-Q25 and
Httex1-Q97) containing 25 and 97 glutamine repeats, respectively, were
obtained from Professor W. J. Park, Global Research Laboratory,Gwangju Institute of Science and Technology, Gwangju, Korea. Cells were seeded at 1 105 cells/well in 12-well for transfection with 1μg plasmid and 1 μl of T-Pro non-liposome Transfection II reagent (Ji Feng Biotechnology). The cell models for Huntington’s disease were
established by transfecting cells with Httex1-polyQ-GFP (Q25 and Q97) plasmid for 24 h. The transfected cells were incubated for 12 h in
growth medium followed by OC-13 treatment.
3. Reagents
The synthetic chemical compounds, OC-13 was dissolved in DMSO (stock is 10 mM in 4 ⁰C).The chemicals used included autophagy
inhibitor 3-MA (Sigma), DMSO (Sigma), DAPI (Sigma), Tet-On system
23
inducer doxycycline (Clontech), Blasticidin (Invitrogen), the acidic
vesicular dye LysoTracker (Invitrogen), RIPA (150mM NaCl, 50mM Tris-HCl pH8.0, 25 mM EDTA, protease inhibitors, 0.1% SDS, and 1%
tritonX-100), blotting buffer (25 mM Tris, 192 mM glycine, 20%
methanol), ECL (GE), PBS-T (3.2 mM Na2HPO4, 0.5 mM KH2PO4, 1.3 mM KCl, 135 mM NaCl, 0.05% Tween-20, pH 7.4).
Compound OC-13 was synthesized by adding sodium azide (2.2 mmol), 1,3-bis(ethynyloxy)benzene (1.1 mmol), and CuSO4·5H2O (10 mol%) to the solution of the 5-(iodomethyl)-3-naphthyloxazolidin-2-one (2.0 mmol) in dimethyl sulfoxide (DMSO; 2 mL). The mixture was stirred at 80°C until the starting material was consumed as indicated by thin layer chromatography (5 h). After cooling the reaction mixture, crushed ice was added and the resulting precipitate filtered, washed with excess of water and dried to obtain the desired triazole. The crude product was further purified by re-crystalizing in methanol. When no precipitate was observed, the triazole was isolated after extraction with ethyl acetate.
The chemical OC-13 was provided by professor Yao Ching-Fa, Department of Chemistry, National Taiwan Normal University.
The composite mass spectrum of OC-13
A white solid; melting point (mp):193°C–195°C. 1H NMR (400 MHz, CDCl3): δ 7.90, (s, 2H), 7.84–7.80 (m, 4H), 7.49 (s, 6H), 7.43 (t, J=7.8 Hz, 2H), 7.22–7.41 (m, 3H), 6.16 (t, J=9.8 Hz, 3H), 5.20–5.14 (m, 6H), 4.76 (d, J=3.5 Hz, 4H), 4.15 (t, J=9.1 Hz, 2H), 3.93–3.91 (m, 2H);
24
13C NMR (100 MHz, CDCl3): 159.4, 155.8, 144.5, 134.4, 132.9, 130.2, 129.6, 129.0, 128.6, 127.2, 126.6, 125.6, 124.9, 124.8, 122.0, 107.8, 102.2, 71.4, 61.6, 52.2, 50.5. High resolution mass spectrometry
(electrospray ionization) m/zcalculated for C40H34N8O6 M+ 722.2601,
4. FACScalibur analysis
After treatment, the cells were stained with 100 nM LysoTracker for 15 min in growth medium under 37℃ and 5% CO2. In flow cytometric assay, the LysoTracker stained cells were washed with PBS twice, trypsinized and measured by FACScalibur (BD) with FL3 intensity
detection at 670 nm. FL3 intensity mean were acquired and analyzed with CellQuest (BD) software [38].
5. Immunoblotting
After treatment, cells in 6-cm petri dish have washed with PBS and lysed with RIPA and stocked in a -20℃ refrigerator. Equal amounts of sample protein were loaded in SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis, 8-12%) and transferred to
nitrocellulose membrane with blotting buffer. Incubation with primary antibodies included anti-GFP (abomics, M0007), GAPDH (Genetex, GTX100118), Akt (Genetex, GTX128415), phospho-Akt (Genetex, GTX128414), phospho-P70S6K (Cell signaling, 9205), phospho-JNK (SCT, 4668), JNK (Santa Cruz, sc-572), LC3 (MBL, PM036) for 24 h.
The membrane was further probed with secondary antibody
(peroxidase-25
conjugate anti-mouse or anti-rabbit IgG) at 1:5,000 for 1 h and detected with ECL. The densitometry of protein was quantitated by Multi Gauge (FUJIFILM).
Filter trap assay
Collection of 200 μg total protein was adjusted the final volume to 1 ml with PBS and 1% SDS. Nitrocellulose membranes pre-wet in PBS with 1% SDS. The samples were allowed to flow through the membrane by suction in blotting apparatus and washed with wash buffer 1 ml (PBS + 2% SDS). Aggregation protein in membrane was detected by
immunoblotting.
6. Quantification of aggregation dots
Cell nucleus were stained with Hoechst 33342 (10 μg/mL) in growth medium. Fluorescence images was detected by Live-Cell Imaging
microscopy (Leica). The numbers of aggregation dot cells per 500 GFP positive cells in fluorescence image were counted.
7. Confocal microscopy detection
Cells were seeded in 12-well and treated with drug of different concentrations. The slides or tissue were washed with PBS twice and fixed with 4% paraformaldehyde in PBS for 15 min at room temperature.
The slidesor tissue were incubated with 1:500 dilution of primary antibody against LC3 at 4 C overnight. The secondary antibodies (TRITC or FITC-conjugate anti-mouse or anti-rabbit IgG) to detect
26
primary antibody were used at 1:500 dilution in 4 C overnight. Antibody was diluted in PBS-T. The slides were mounted with 90% glycerol in PBS. Images were collected by Leica TCS SP2 and analyzed by Leica confocal software.
8. Statistical analysis
The statistical significance of these data will be compared between two groups followed by student’s t-test and multiple
comparisons were performed with one-way ANOVA or two-way ANOVA followed. The P value of less than 0.05 is considered significantly
different.