• 沒有找到結果。

ӭϡόႫکિެለ(polyunsaturated fatty acids, PUFAs)ࡪ n ጓဦس಍ǴਥᏵಃ

΋ঁᚈᗖ܌ӧޑՏ࿼ёஒόႫکિެለϩࣁѤᅿᜪࠠǴջ n-3ǵn-6ǵn-7 ک n-9 سӈǴՠڀԖख़ाғނᏢཀကޑࢂ n-3 ک n-6 PUFAsǶΓᜪคݤԾՉӝԋ n-3 ک

n-6όႫکિެለǴѸ໪வ१ނύޔௗឪڗǴӢԜΞ೏ᆀࣁѸሡિެለǴЀځࢂ

Į-ԛ٥ഞݨለ(n-Į-linolenic acid, ALA)ک٥ഞݨለ(n-6, linoleic acid, LA)

(SanGiovanni & Chew, 2005)ǶҞ߻ၨදၹޑ n-3 િެለԖ ALAǵEPA ک DHA Ο ᅿǴନΑ ALAǴEPA ک DHA ೯தӸӧܭుੇങݨύǶ

2-1. ่ᄬ

n-3ӭϡόႫکિެለ(n-3 PUFAs)ࢂх֖ኧঁа΢όႫکᗖޑિެለǴӢࣁ

ಃ΋ঁᚈᗖр౜ӧᅹ᜘ຯҘ୷ᆄޑಃΟঁᅹচη΢Ǵ܌аᆀϐࣁ n-3 િެለǴΨ

ћբȦ-3 િެለǶவკ 2.6 ύёа࣮ډǴDHA ԖϤঁᚈᗖǵΒΜΒঁᅹচηǶ

კ 2.6 DHA ่ᄬ(SanGiovanni & Chew, 2005)

2-2. ғғӝԋբҔ

Į-ԛ٥ഞݨለ Į-linolenic acid, ALA)ߡࢂ n-3 િެለޑڂࠠж߄ǴѬԖΟঁ

ᚈᗖǶALA ࢂჹΓᡏ଼நߚதख़ाޑ΋ᅿિެለǴՠΓᡏόૈ҅தӝԋǴӢԶ

೏ຎࣁࢂ΋ᅿѸሡિެለ(EFA)ǶALA ёа೸ၸѐႫک䁙(desaturase)کᅹ᜘ۯߏ 䁙(elongase)ޑ໽ϯբҔǴനࡕӝԋ EPA ک DHAǴ಍ᆀࣁ n-3 سӈિެለǶ

კ 2.7 ӭϡόႫکિެለޑғӝԋբҔ(De Caterina & Basta, 2001)

3. DHAޑޑғ౛բҔ/фૈ ݨ✊ᐚࡋǴ٠ૈׯ๓жᖴੱংဂޑ௃ݩ(Schmidt et al., 1992; Jiménez-Gómez et al., 2010)ǹ(3)ႣٛՈਵޑ׎ԋǴफ़եՈనᗹ࿨ࡋǴڀԖ׭ڋՈλ݈Ꮙ໣฻բҔǴឪ Ε፾྽Ꮚໆޑങݨё٬ TXA2 ѳᑽӛԖճБӛᙯᡂ(Umemura et al., 1995)ǹ(4)Ⴃ

ٛЈࡓό᏾ޑวғǴឪڗങݨёफ़եЈ᠌₽ԝޑ॥ᓀ(Bucher et al., 2002; Leaf et 2006)Ƕĸ٬ጢԋϩวғׯᡂǴቹៜጢࢬ୏܄(Chen et al., 2007; Chapkin et al., 2008)ǶĹቹៜಒझᐟનޑϩݜ(von Schacky, 2007)Ƕĺፓ௓୷Ӣޑ߄ၲǺPUFAs ёаޔௗ຾Εಒझਡᆶਡڙᡏ(nuclear receptor)܈ᙯᒵӢη่ӝǴ຾Զቹៜ೚ӭ

วݹ࣬ᜢ୷Ӣޑ߄౜ǹٯӵǺn®3 PUFAs ё׭ڋ NF-ț% ࢲ܄Ǵҗܭ NF-ț% ޔௗ

܈໔ௗፓ௓΋٤วݹϸᔈǴ෧Ͽᗹߕϩηޑғԋ(SanGiovanni & Chew, 2005;

Chen et al., 2005; Chapkinet al., 2009)ǹn®3 PUFAs Ψࢂ peroxisome proliferators activated receptors (PPARs)ޑԾฅଛՏη(ligands)ǴPPAR Ψ཮೸ၸቹៜ NF-ț% ၡ ৩Զ׭ڋวݹϸᔈ(Delerive et al., 2000, 2001; Moraes et al., 2006)ǴӢԜ n®3

PUFAsჹܭፓ࿯ NF-ț% ૻ৲ၡ৩תᄽ๱ख़ाޑفՅǶĻፓ௓ࢌ٤ሇનࢲ܄Ǻ൤

֖ n-3 PUFAs ϐങݨё೸ၸᇨวל਼ϯሇનϐ߄౜Ǵٰ׭ڋ ApoE ߹ନλႵЈ᠌

Ոᆅύ୏ેๆރฯϯඬϐ׎ԋ(Wang et al., 2004)Ƕ(7)ׯ๓ՈᆅϣҜಒझфૈ(De

Caterina et al., 2000; Brown & Hu, 2001)Ƕ

߄ 2.5 n-3 િެለफ़եЈՈᆅ੯ੰ॥ᓀޑёૈᐒڋ(Kris-Etherton et al., 2002)

߄ 2.6 n-3 િެለᆶᗹߕϩηϐᜢ߯(Brown & Hu, 2001)

ऍ୯Ј᠌Ꮲ཮(American Heart Association)ࡌ᝼ԋԃΓᔈ၀ឪڗ፾ໆങᜪǶࠖ

ՕᙴᏢଣᏢޣΨᇡࣁǴ؂ຼԿϿٿԛឪΕങԺǴӵǺᗴങǵߎᄳങǵ؅΍ങ฻ૈ

ߔЗँว܄₽ԝǴӢࣁങԺύޑόႫکિެለё෧ϿЈࡓό᏾ǵႣٛЈ᠌ੰൺ วǵۯ጗Ј᠌ੰ஻ಒझԴϯ(Kris-Etherton et al., 2002; Hu et al., 2002; Farzaneh-Far et al., 2010)Ƕ

Table 2.5

Table 2.6

߄ 2.7 n-3 િެለࡌ᝼ឪڗໆ(Kris-Etherton et al., 2002) Table 2.7

Ο

ΟǵՈ୷፦਼ϯ 䁙(Heme oxygenase, HO)

1. Ո୷፦਼ϯ䁙ϐϩᜪ

Ҟ߻ςޕՈ୷፦਼ϯ䁙(Heme oxygenase, HO)ԖΟᅿӕф౦ᄬ䁙Ǵϩձࣁಃ

΋ࠠՈ୷፦਼ϯ䁙(HO-1)Ǵϩηໆऊࣁ 32 kDaǹಃΒࠠՈ୷፦਼ϯ䁙(HO-2)Ǵϩ ηໆऊࣁ 36 kDaǹаϷಃΟࠠՈ୷፦਼ϯ 䁙(HO-3)Ǵϩηໆऊࣁ 33 kDa (Farombi

& Surh, 2006)ǶHO-1 ឦܭᇨᏤ߄౜ࠠޑሇનǴ཮ڙډ೚ӭόӕޑ߼ᐟӢન܌ᇨ วǴӵวݹϸᔈǵֽ೽લՈ(ischemia)ǵၸ਼ੱ(hyperoxia)ǵલ਼(hypoxia)ǵଯ዗

(hyperthermia)کࢌ٤ख़ߎឦ(ӵᙿǵልǵઈ) (Farombi & Surh, 2006; Idriss et al., 2008)฻ǶHO-1 ቶݱϩթܭ๠᠌ǵط᠌ϷᆛރϣҜس಍ύǹHO-2 ک HO-3 ߾ࢂ

࡭ុ߄౜ܭӚಔᙃಒझύǴӵတǵઓ࿶س಍ǵط᠌ǵ๠᠌ǵ⢀ΤаϷЈՈᆅಔᙃ

฻(Siow et al., 1999)ǶHO-2 ࢂғ౛ރᄊΠޑЬाӸӧࠠԄǴૈ೏๝΢ဏҜ፦ન܌

ፓ࿯(Raju et al., 1997)Ǵՠ HO-3 ࣁൂ΋ᙯᒵౢނǴځࢲ܄ᡉ๱եܭ HO-1 ک HO-2 (Hayashi et al., 2004)ǴҞ߻ჹܭ HO-3 ࣬ᜢޑࣴز٠όӭǴځӧғ౛΢܌תᄽޑ فՅۘ҂మཱǶHO-1 ᆶ HO-2 ޑữ୷ለׇӈԖ 43%ޑ࣬՟܄ǴԶ HO-3 ࢂ΋ᅿ ᆶ HO-2 ߚத߈՟ޑӕф䁙Ǵځữ୷ለׇӈᆶ HO-2 ऊԖ 90%ޑ࣬՟܄(Siow et al., 1999; Hayashi et al., 2004)Ƕ

ಃ΋ࠠՈ୷፦਼ϯ䁙(Heme oxygenase-1, HO-1)ࢂᡏϣख़ाޑל਼ϯሇનǶ

HO-1നԐӧ 1964 ԃҗ Wise ฻Γவಒझύஒځϩᚆ٠ว౜ѬёӧᡏѦஒՈ୷፦

(heme)ϩှౢғᖌᆘન(biliverdin)Ƕ1968 ԃ Tenhunen ฻ΓܭεႵط᠌ǵ๠ǵ๝ޑ

༾ಈᡏ(microsome)ύ᛾ჴΑՈ୷፦਼ϯ䁙ޑӸӧǶHO-1 ӧ҅தғ౛ރᄊΠѝԖ Ͽໆ߄ၲǴΓᜪ HO-1 ୷Ӣ(hmox-1)ՏܭࢉՅᡏ 22q12 Տ࿼Ǵ୷Ӣӄߏ 6.8 kb (Lavrovsky, 1993)ǴЬाёڙډ਼ϯᓸΚǵวݹᐟનǵख़ߎឦ฻ڈᐟǴ೸ၸፓ௓

antioxidant response element (ARE)Զᇨวځεໆ߄౜Ǵҗܭ HO-1 ёڙډ዗Ҷլ

ϸᔈࢲϯǴӢԜΞᆀࣁ዗Ҷլೈқ 32 (heat shock protein 32, Hsp32)Ǵࢂ΋ᅿϣྍ

܄ߥៈೈқ፦(Farombi & Surh, 2006)Ƕ

2. HO-1ϐϐғ౛فՅ

HO-1୷Ӣ೏ᇡࣁࢂ΋ᅿӢᔈᡏϣᕉნᡂϯޑ୷ӢǴΨࢂҞ߻ว౜ڙډനӭ

ӢનᇨᏤޑᓸΚϸᔈೈқǴHO-1 ୷Ӣ߄ၲޑፓ௓Ьाวғӧᙯᒵ໘ࢤ(Alam &

Cook, 2003)Ƕ೚ӭࣴزࡰрǴ྽ಔᙃ܈ಒझೀܭ਼ϯᓸΚ܈ཞ໾฻௃ݩਔǴ֡ё

ᇨᏤ HO-1 ߄౜Ǵ೭ࢂيᡏޑ΋ᅿٛፁ܄ϸᔈǴፓ௓ಔᙃ܈ಒझٰӢᔈғ౛ᡂϯ аᆢ࡭ځ୏ᄊѳᑽޑᜢᗖ(Gruber et al., 2010)ǶќԖЎ᝘ࡰрǴϺฅӸӧޑ෌ϯ ނ(ӵ quercetinǵresveratrolǵcurcumin ᆶ sulforaphane ฻)ҭ཮೸ၸፓ௓ HO-1 ߄

౜Ǵׯ๓ಒझϣޑ਼ϯᓸΚ(Balogun et al., 2003; Lin et al., 2004; Juan et al., 2005;

Farghali et al., 2009)Ƕ

HO-1ڀԖ࣬྽ӭޑғ౛բҔǴςޕԖ(1)לวݹǺቚу HO-1 ߄౜ς೏᛾ჴ

ᆶफ़եวݹϸᔈԖᜢ(Takahashi et al., 2007; Kim et al., 2007; Lee et al., 2009)Ǵ೸

ၸफ़եϣҜಒझϐᗹߕϩηᆶᖿϯނ፦ޑ߄౜Ǵޔௗ܈໔ௗ׭ڋวݹϸᔈ (Vachharajani et al., 2000; Soares et al., 2004; Lin et al., 2005; Yu et al., 2010)Ƕ೭ঁ

ཷۺё࿶җٿ໨ᒪ໺ว౜ٰև౜Ǵಃ΋ǺલЮ HO-1 ϐλႵ཮ቚуځวݹރݩ (Kapturczak et al., 2004; Tracz et al., 2007)ǴಃΒǺHO-1 લЮ஻ޣޑวݹੱރࢂ೷

ԋځԝΫޑচӢϐ΋(Kawashima et al., 2002; Koizumi, 2007)Ƕ(2)לಒझ঒ΫǺӧ λႵ߃жطಒझཞ໾ኳԄΠǴቚу HO-1 ߄౜Ԗշܭ׭ڋಒझ঒Ϋ(Zuckerbraun et al., 2003)Ƕ(3)לಒझቚғ(Morse & Choi, 2002)Ƕ(4)բࣁЈՈᆅ੯ੰݯᕍϐ኱ޑǺ HO-1ޑౢނ CO ёૈ೸ၸफ़ե p38 MAPK ᕗለϯ߄౜Ǵ٠׭ڋ calcineurin/NFAT

೼৩ޑࢲϯٰ෧ϿЈԼޥεޑวғ(Tongers et al., 2004)ǹIshikawa ฻Γ(2001)ว౜

ӧ୏ેๆރฯϯՈᆅύǴᇨᏤ HO-1 ཮׭ڋՈዀύિ፦ၸ਼ϯނޑғԋǴᇥܴଯ

િՈੱᇨᏤޑ HO-1 ჹ୏ેๆރฯϯޑ׎ԋڀԖߥៈբҔǴ٠ёૈ೸ၸቹៜ NO

೼৩ٰวචբҔǶ(5)ᗉխᏔ۔౽෌௨ѾϸᔈǺቚу HO-1 ࢲ܄ёٛЗЈՈᆅڙډ

ֽ೽લՈ/ӆឲࢬ(ischemia/reperfusion)ޑ໾্Ǵٯӵ HO-1 ёа೸ၸፓ࿯ NOS (nitric oxide synthase)߄౜Ϸࢲ܄ٰफ़եᑗֿੰεႵЈԼલՈӆឲࢬϐཞ໾

(L'Abbate et al., 2007; Abraham & Kappas, 2008)Ƕ(6)ፓ௓ಒझຼය(cell cycle)Ǻ HO-1཮׭ڋՈᆅѳྖԼಒझ(vascular smooth muscle cells, VSMC)ޑಒझຼයǴ

೷ԋಒझଶᅉӧ G1/S යǴӕਔΨ཮ፓ௓ cyclin kinase inhibitor p21Cip(Duckers et al., 2001)ǹӧ VSMC ύ CO ޑቚуǴ཮׭ڋ E2F-1 ޑғԋǴE2F-1 ӧಒझຼයύ תᄽፓ࿯ c-mycǵcyclin ک DNA polymerase ޑفՅ(Morita & Kourembanas, 1995)Ƕ(7)׭ڋᕎಒझߟ᠍کᙯ౽Ǻࣴز᛾ჴ HO-1 ૈ׭ڋ٢ᕎಒझߟ᠍کᙯ౽ ޑૈΚǴځբҔᐒᙯᆶ׭ڋ MMP-9 (Matrix metallo- proteinase-9)୷ӢࢲϯԖᜢ (Lin et al., 2008)Ƕ(8)ନΑ΢ॊғ౛фૈϐѦǴനڙډݙҞޑ߾ࢂځל਼ϯૈΚǴ ᙖҗፓ௓ HO-1 ߄౜ϷځжᖴౢނϐբҔǴᆢ࡭ᡏϣ਼ϯᗋচރᄊϐࡡۓǴफ़ե ಒझ਼ϯᓸΚکፓ࿯ӭᅿಒझߥៈբҔǴӧ೚ӭ੯ੰว৖ၸำύתᄽख़ाޑفՅ (Slebos et al., 2003; Hwang & Jeong, 2008; Lee et al., 2009)Ƕ

3. HO-1жжᖴౢނჹಒझޑߥៈբҔ

HO-1ӧ਼ϩη(O2)ǵNADPHǵಒझՅન P450 ᗋচ䁙(cytochrome P450 reductase)ޑୖᆶΠǴё໽ϯՈ୷፦(heme)फ़ှࣁᖌᆘન(biliverdin)ǵ΋਼ϯᅹ (carbon monoxide, CO)ǵෞᚆ៓(Fe2+)ǴࢂՈ୷፦жᖴၸำύޑೲ౗ज़ڋሇનǴѬ ቶݱϩթܭғނᡏϣӚᅿಔᙃکᏔ۔ǴԖ๱ख़ाޑғ౛фૈ(კ 2.8) (Farombi &

Surh, 2006)Ƕ೚ӭࣴزว౜ǴHO-1 Ϸځжᖴ࣬ᜢౢނёӅӕวචלวݹǵל਼

ϯǵ׭ڋಒझ঒Ϋکׯ๓ಔᙃ༾ൻᕉ฻բҔ(Ryter et al., 2007)ǶHO-1 жᖴ࣬ᜢౢ

ނޑғ౛фૈӵΠǺ

3-1. ᖌᆘન(biliverdin, BV)/ᖌआન(bilirubin, BR)

reductase)ޑբҔǴᙯᡂࣁᖌआન(bilirubin)Ƕ߈ԃޑࣴز᛾ჴǴBR ࢂ΋ᅿख़ाޑ ϣྍ܄ל਼ϯϩηǴԖமεޑל਼ϯૈΚǴૈԖਏӦమନ਼Ծҗ୷Ǵफ़ե਼ϯᓸ Κ(Baranano et al., 2002)ǹߥៈЈՈᆅխܭֽ೽લ਼ޑ໾্(Clark et al., 2000;

Ollinger et al., 2007)ǹ׭ڋ LPS ᇨวᗹߕϩηޑբҔǴफ़եวݹϸᔈ(Vachharajani et al., 2000)ǹӧа LPS ᇨวεႵҶլޑኳԄΠǴว౜ BV ёफ़եՈమ߻วݹಒझ ᐟનᐚࡋ(Sarady-Andrews et al., 2005)ǹBR Ψё೸ၸ׭ڋ E-selectin ک VCAM-1 ߄౜ٰफ़եϣҜಒझޑࢲϯբҔ(Soares et al., 2004)ǹќѦǴBV/BR ޑלวݹբ ҔёૈᆶѬॺᏤठ NF-ț% ѨࢲԖᜢ(Soares et al., 2004; Sarady-Andrews et al., 2005)Ƕ

3-2. ΋΋਼ϯᅹ(carbon monoxide, CO)

೚ӭࣴزࡰрǴϣྍ܄΋਼ϯᅹ(CO)ёբࣁ΋ᅿૻ৲໺ሀϩηǴࢲϯёྋ܄

ച㧿ለᕉϯ䁙(soluble guanylate cyclase, sGC)ǴsGC ཮຾΋؁ஒ GTP ࢲϯԶ׎ԋ ᕉᕗለച㧿(cGMP) (Morita et al., 1995)ǴᝩԶวචቶݱޑғ౛ፓ࿯фૈǴхࡴፓ

࿯Ոᆅ๤஭ǵЍ਻ᆅᘉ஭ǵ׭ڋՈλ݈Ꮙ໣ǵ෧ϿՈਵ׎ԋǵ෧ᇸલՈӆឲݙཞ

໾Ϸ׭ڋՈᆅѳྖԼಒझቚғ฻բҔ(Slebos et al., 2003; Piantadosi, 2008)Ϸᆢ࡭

༾Ոᆅൻᕉޑѳᑽ(Suematsu & Ishimura, 2000)ǶCO ೏ᇡࣁࢂॄೢ HO-1 ε೽ϩ לวݹբҔޑӢη(Ryter et al., 2006)ǺӧѮᏘಒझύǴCO ೸ၸፓ௓ p38 ٰ׭ڋ

߻วݹಒझᐟન TNF-Į ޑౢғ(Otterbein et al., 2000)ǹҭԖЎ᝘ࡰрǴCO ё೸ၸ MAPK೼৩(Otterbein et al., 2003)׭ڋᠼᆢ҆ಒझ(fibroblast)܈ϣҜಒझ

(endothelial cells)঒ΫǴಒझ঒Ϋ཮уቃวݹϸᔈǴЀځࢂ঒ΫޑՈᆅϣҜಒझ

3-3.៓ᚆη(Fe2+)/៓ೈқ(ferritin)

៓ೈқ(ferritin)ᆶ HO-1 ޑ߄౜ቚуڀԖ΋ठ܄(Balla et al., 2005)Ǵᗨฅۘ҂

ֹӄ᛾ჴ៓ೈқࢂցᆶ HO-1 ޑלวݹբҔ࣬ᜢǴՠࢂ៓ೈқޑዴࢂ΋ᅿԖਏޑ ל਼ϯϩη(Arosio et al., 2009)ǶΒሽ៓ࢂ΋ᅿ਼ܰϯޑߎឦᚆηǴ৒ܰЇଆวݹ ϸᔈǹԶ྽ HO-1 жᖴՈ୷፦ਔ཮ញрΒሽ៓ǴΒሽ៓΋ѿ೏ញрǴ཮೏៓ೈқ זೲӦௗԏǴቚу៓ᓯӸޑਏ౗ǴӢԜε൯Ӧज़ڋѬޑߦ਼ϯ/߻วݹૈΚǴа ᆢ࡭ಒझϣ៓ᚆηᐚࡋϐࡡۓǴࡺಒझϣ៓ೈқ֖ໆගଯਔёܢל਼ϯ໾্Ǵ٠

ౢғᓸΚፓ፾(stress adaptation)ၲډߥៈಒझϐբҔ(Balla et al., 2005)ǹਥᏵၗ਑

ᡉҢǴᇨว HO-1 ߄౜཮ቚу៓ೈқӝԋǴ׭ڋวݹϸᔈౢғ(Schaer et al., 2006)Ƕ

კ 2.8 HO-1 ϐբҔϷځжᖴౢނ(Farombi & Surh, 2006)

4. ፓ௓ HO-1 ୷Ӣ߄౜ϐૻ৲໺ሀၡ৩

ၸѐЎ᝘ࡰрǴୖᆶᇨᏤ HO-1 ୷Ӣ߄౜ϐૻ৲໺ሀၡ৩(signal transduction pathways)ǴЬाхࡴ MAPKs (mitogen-activated protein kinase)ǵPI3K

(phosphoinositide 3-kinase) /AktǵPKC ฻(Owuor & Kong, 2002; Lee & Johnson,

2004 ; Xu et al., 2006; Ryter et al., 2006; Paine et al., 2010)ǹԜѦǴϩ݋ HO-1 ୷Ӣ ޑ௴୏η(promoter)୔ୱǴว౜ڀԖ೚ӭख़ाᙯᒵӢηޑ่ӝՏ࿼Ǵхࡴ NF-E2 (nuclear factor-erythroid 2)ǵAP-1ǵNF-ț% ฻Ǵаፓ௓ HO-1 ޑ߄౜(კ 2.9) (Farombi

& Surh, 2006; Alam & Cook, 2007; Gruber et al., 2010)Ƕ

4-1.ᙯᒵӢη Nrf2

Nrf2 (nuclear factor erythroid 2-related factor 2)ࣁځख़ाፓ௓ޣϐ΋ǴӢ Nrf2

཮ᆶ࣬ᜢל਼ϯሇન୷Ӣ΢ޑ΋ࢤፓ௓ׇӈ Antioxidant Response Element (ARE)

่ӝǴࡺ೏᛾ჴᆶ HO-1 ޑ߄౜ԖஏϪᜢ߯(Xu et al., 2006; Kim et al., 2007;

Johnson et al., 2009)ǶNrf2 ឦܭ Cap’n’Collar / basic leucine zipper (CNC-bZIP)ᙯᒵ Ӣηৎ௼ޑ΋ঁԋ঩ǶӧؒԖڈᐟޑ௃ݩΠǴNrf2 ᙖҗᆶ Keap1 (Klech-like ECH-associated protein 1)่ӝǴ೏႖ᚆӧಒझ፦ύǹ΋ѿڙډࢲϯǴ೭ঁፄӝނ ஒ೏ґှǴ೏ញܫрޑ Nrf2 ளаᙯ౽຾ΕಒझਡϣǴ຾Զᆶ small Maf ৎ௼ޑԋ

঩(i.e., MafKǵMafGǵMafF)ಔӝԋ౦፦Βᆫᡏ(Motohashi et al., 2002, 2004;

Katsuoka et al., 2005)ǶନΑ small Maf ৎ௼ޑԋ঩ǴNrf2 Ψёૈᆶ c-Jun ܈ activating transcription factor 4 (ATF4)׎ԋ౦፦Βᆫᡏ(heterodimers)Ǵቚம ARE/EpRE (electrophile response element)-drivenൔᏤ୷Ӣࢲ܄Ǵߦ຾ HO-1 ޑᙯ ᒵ(Venugopal & Jaiswal, 1998; He et al., 2001; Mann et al., 2007)Ƕ

კ 2.9 ፓ௓ HO-1 ߄౜ϐૻ৲໺ሀၡ৩(Farombi & Surh, 2006)

4-2. ځځѬၡ৩(PI3K/AktǵMAPKsǵPKC)

ςԖ೚ӭࣴز௖૸ୖᆶNrf2ࢲϯޑૻ৲໺ሀၡ৩ǴٯӵPI3KکPKCё٬Nrf2 วғᕗለϯǴԶPI3K׭ڋᏊ(LY-294002)܈PKC׭ڋᏊ(Ro-32-0432)Ψёफ़եARE luciferaseൔᏤ୷Ӣޑࢲ܄ǹҗԜ௢ፕǴNrf2ϐࢲϯᆶPI3KکPKCޑࢲ܄Ԗᜢ(Lee

& Surh, 2005; Farombi & Surh, 2006; Keum et al., 2008)ǶԜѦǴMAPKsΨ೏᛾ჴ

ୖᆶNrf2ࢲϯբҔ(Kong et al., 2001; Lee & Johnson, 2004; Xu et al., 2006)ǶҞ߻ς ޕӭᅿڀԖғ౛ࢲ܄ޑ෌ϯނ(phytochemicals)Ǵӵ౦౷⋸ለ㸰ᜪ

(isothiocyanates)ǵЇԚ(indoles)ǵΒ౎Ч୷౷ϯނ(diallyl sulfides)ǵ໳✉ᜪϯӝނ (flavonoids)ᆶᖖ໳ન(curcuminoids)฻Ǵ೿Ԗߦ຾܈׭ڋNrf2่ӝԿ኱ޑ୷Ӣ promoter΢ޑբҔ(Jeong et al., 2006)ǶӧHepG2ಒझਲ਼ኳԄΠǴᇺ෍ન(capsaicin) ё೸ၸࢲϯPI3K/Aktૻ৲໺ሀၡ৩ǴቚуNrf2ᆶAREޑ่ӝǴ຾Զ҅ӛፓ௓HO-1

୷Ӣ߄౜(Joung et al., 2007)ǹCarnosolᇨวHO-1ޑ߄౜Ψ೏ᇡࣁᆶPI3Kૻ৲ၡ৩ Ԗᜢ(Martin et al., 2004)Ƕ

Figure 2.9

ᗨฅࡐӭޑ phytochemicals ೏᛾ჴёаᇨว HO-1 ߄౜ЪڀԖߥៈಒझբҔ (cytoprotection)ǴՠҞ߻ࣁЗǴDHA ᇨว HO-1 ߄౜ޑࣴز࣬ჹၨϿǶࣴزว౜

ങݨύख़ाԋϩ DHA ёᇨว BV-2 microglia ߄౜ HO-1 (Lu et al., 2010)Ǵځᐒڋ ёૈᆶ Akt ک ERK ԖᜢǶќѦǴDHA ё೸ၸ Nrf2-dependent ૻ৲໺ሀٰᇨว mouse peritoneal macrophages߄౜ HO-1Ǵ຾Զ׭ڋ LPS ᇨวޑวݹϸᔈ(Wang et

al., 2010)ǶGao ฻Γ(2007)ว౜ DHA ሡ࿶ၸ਼ϯբҔࡕ܌ౢғޑౢނωڀԖᇨว

Nrf2߄౜کࢲϯ ARE ׇӈޑբҔǴԶЪдॺ௢ෳ DHA ਼ϯౢނΨёૈ཮ᆶ

Keap1բҔ຾Զࢲϯ Nrf2Ƕ

ಃΟക ࣴزҞޑ

ਥᏵፁғ࿿ޑ಍ीǴЈՈᆅ੯ੰ΋ޔ՞ۚ୯ϣΜεԝӢޑ߻൳ӜǴ୏ેๆރ ฯϯࢂЈՈᆅ੯ੰޑ΋ᅿǶᖏ׉ᙴᏢ᛾ᏵᡉҢǴ୏ેๆރฯϯࢂ΋ᅿᄌ܄วݹ੯

ੰǴ཮೷ԋՈᆅϣᏛિެ୴ᑈϷᠼᆢඬ༧ޑ׎ԋǹԜѦǴࣴزว౜ಒझᗹߕϩη ޑғԋჹܭ୏ેๆރฯϯ੯ੰޑว৖תᄽख़ाޑفՅǴᗹߕϩηϐ΋ ICAM-1 ё

բࣁ΋ᅿวݹޑғ౛ࡰ኱ǴٰႣෳқՈౚӧϣҜಒझύޑᗹߕ௃׎ǶTNF-Į ࢂ΋

ᅿςޕޑ߻วݹಒझᐟનǴ཮೸ၸࢲϯᙯᒵӢη NF-ț% ٰڈᐟᗹߕϩηޑ߄౜Ǵ

܌аத೏ҔٰբࣁᇨวಒझౢғวݹϸᔈޑኳԄǶ

Αှ୏ેๆރฯϯޑ׎ԋ٠уаႣٛࢂҞ߻ႣٛᙴᏢޑख़ाፐᚒϐ΃Ǵ೚ӭ Ў᝘ࡰрങݨϷځख़ाࢲ܄ԋϩ DHA ڀԖלวݹբҔǴ٠Ъ཮೸ၸ೚ӭ೼৩ٰ

फ़եЈՈᆅ੯ੰޑวғ౗ǹԶ HO-1 ࢂᡏϣख़ाޑל਼ϯሇનǴЬा཮ڙډ਼ϯ ᓸΚǵวݹǵϯᏢނǵख़ߎឦ฻ڈᐟᇨวԶεໆ߄౜Ǵ೭ࢂ΋ᅿٛፁ܄ϸᔈǴፓ

௓ಔᙃ܈ಒझٰӢᔈғ౛ᡂϯаᆢ࡭ځ୏ᄊѳᑽޑᜢᗖǶҁჴᡍ࠻Ӄ߻ࣴزว౜

аऀЈጪϣ✊Ⴃೀ౛ HUVECs Ϸ EA.926 ಒझǴёа׭ڋ TNF-Į ܌ᇨวޑ ICAM-1 ߄౜(Chao et al., 2011)ǶӢԜҁჴᡍஒճҔ TNF-Į ᇨวϣҜಒझ EA.hy926 ౢғ

วݹϸᔈޑኳԄǴ௖૸ DHA ࢂցёаᙖҗቹៜ NF-ț% ૻ৲໺ሀၡ৩ٰ׭ڋ

TNF-Į ܌ᇨวޑ ICAM-1 ߄౜Ǵ٠Ъ௖૸ DHA ܌ᇨวޑ HO-1 ࢂցୖᆶ׭ڋว

ݹޑᐒڋǴ຾ԶၲډႣٛวݹ੯ੰޑфਏǶ

28

ჴჴ ᡍ ࢎ ᄬ

ಃΒ೽ҽ

Induction of Heme Oxygenase 1 and Inhibition of

7XPRU1HFURVLV)DFWRUĮ-Induced Intercellular Adhesion Molecule 1 Expression by Docosahexaenoic Acid in EA.hy926 Cells

1. Introduction

Fish oils, rich in long-chain n-3 polyunsaturated fatty acids (n-3 PUFAs), especially eicosapentanoic acid (EPA, 20:5) and docosahexanoic acid (DHA, 22:6), are well known for their anti-inÀDPPDWRU\ Mullen et al., 2010), immunoregulatory (Simopoulos, 2002), anti-aging (Jicha et al., 2010), and anti-tumor (Ghosh-Choudhury et al., 2009) properties. Additionally, EPA and DHA were shown to possess

anti-arrhythmic effect (Leaf et al., 2005). Epidemiological studies have provided evidence indicating that n-3 PUFAs supplementation regulates inflammation partially via improvement of endothelial functions (Brown & Hu, 2001). DHA was shown to significantly decrease the cytokine-induced adhesion molecule expression (Chen et al., 2003), diminish the adhesion of leukocytes to the activated endothelial cells (De Caterina et al., 2000; Mayer et al., 2002), and inhibit production of cytokines by endothelial cells (Novak et al., 2003; von Schacky, 2007). It has been demonstrated that treatment with n-3 PUFAs suppressed ICAM-1 and VCAM-1 expressions in TNF-Į,/-1, and VEGF-stimulated endothelial cells (Chen et al., 2005), with DHA being more potent than EPA (Weldon et al., 2007). It is reported that DHA affects several target genes via inhibition of the NF-kB activation (Chapkinet al., 2009;

Wang et al., 2011). Dietary intake of n-3 PUFAs is associated with a reduced risk of

atherosclerosis (Kris-Etherton et al., 2002; Paulo et al., 2008), and this is considered to play a pivotal role in the prevention of cardiovascular disease (CVD).

In recent years, it has been recognized that inflammation is a major contributing factor to many cardiovascular events (Blake, 2001). Atherosclerosis, a chronic inflammatory disease of the vasculature, is characterized by infiltration of leucocytes (Blankenberg et al., 2003), deposition of lipids and thickening of the vascular wall in response to cytokines (Ross, 1999; Lusis, 2000), and it increasingly threatens human health worldwide (Hansson & Libby, 2006). Leukocyte recruitment is a multistep process and this process is predominantly mediated by cellular adhesion molecules, such as intracellular adhesion molecule-1 (ICAM-1), vascular adhesion molecule-1 (VCAM-1) and selectins, which are expressed on the surface of epithelial and

endothelial cells in response to several inflammatory stimuli, including oxidized LDL, free radical species, lipopolysaccharide (LPS), and cytokines, such as tumor necrosis factor- alpha (TNF-Į LQWHUOHXNLQ-ȕ ,/-ȕ DQGLQWHUIHURQ-gamma (INF-Ȗ 

(Roebuck & Finnegan, 1999; Blankenberg et al., 2003). Studies have shown that TNF-ĮWKHSUR-inflammatory cytokine, is commonly found in atherosclerotic lesions and can induce expression of ICAM-1 and VCAM-1, which are critically dependent on the activation of nuclear factor-ț% 1)-ț%  Liu, 2005; Oh et al., 2010). NF-ț%LV

an important transcription factor regulating the expression of many inflammatory response genes such as adhesion molecules and cytokines (Luo et al., 2005). In quiescent cells, NF-ț%LVVHTXHVWHUHGLQWKHF\WRSODVPWKURXJKLWVLQWHUDFWLRQZLWKWKH

LQKLELWRU\NDSSD% ,ț% IDPLO\ 6XQ .DULQ ,QUHVSRQVHWRVWLPXODWLRQ

,ț%-ĮLVSKRVSKRU\ODWHGDW6HUDQGE\WKH,ț%NLQDVH ,.. FRPSOH[ 0D\  Ghosh, 1998; Karin & Delhase, 2000) and subsequently degraded by the

ATP-dependent 26S proteasome complex (Chen et al., 1995; Wertz & Dixit, 2010).

,ț%GHJUDGDWLRQIUHHV1)-ț%DQGDOORZV1)-ț%WUDQVORFDWLRn to the nucleus, where it FDQELQGWRWKHț%HOHPHQWRISURPRWHURIWDUJHWJHQHV 5DKPDQ& McFadden, 2011).

Heme oxygenase (HO)-1 is an inducible enzyme responsible for the rate-limiting step of heme degradation and produces carbon monoxide (CO), free iron and

biliverdin (BV), which is further converted into bilirubin (BR) via biliverdin reductase (Farombi & Surh, 2006; Abraham & Kappas, 2008). HO-1 can be triggered by a variety of stress-related cellular stimuli, including its substrate heme, heavy metals, oxidative stress, UV radiation, inflammatory cytokines, hypoxia, and

ischemia-reperfusion (Farombi & Surh, 2006; Idriss et al., 2008). The physiological relevance of the HO-1 expression has been reported in several pathological states such as atherosclerosis and inÀDPPDWLRQZKHUHLQLWFRQIHUVF\WRSURWHFWLRQ 0RULWD

Idriss et al., 2008; Lee et al., 2009; Paine et al., 2010; Kim et al., 2010). HO-1 induction reduces atherosclerotic lesion size in Watanabe heritable hyperlipidemic rabbits (Ishikawa et al., 2001a) and in LDL-receptor knockout mice (Ishikawa et al., 2001b). Moreover, transgenic mice deficient in HO-1 of an apolipoprotein E null background (Yet et al., 2003) exhibited accelerated and more advanced atherosclerotic lesion formation in response to a Western diet. Nevertheless, recent evidence suggests that by-products of HO-1, alone or in concert, mediate the protective effects of HO-1 (Kirkby & Adin, 2006; Ryter et al., 2006, 2007). Bilirubin is an endogenous radical scavenger with recently recognized antioxidant, anti-inflammatory, anti-proliferative properties (Ollinger et al., 2007). The release of free iron is rapidly sequestered into the iron storage protein, ferritin, leading to additional antioxidant and anti-apoptotic effects (Arosio et al., 2009). CO exerts several biological functions, including anti-apoptotic, anti-inflammatory, and vasodilatory effects (Kirkby & Adin, 2006;

level (Alam & Cook, 2003), and its inducibility by diverse inducers is linked to the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf-2) (Shan et al., 2006; Kim et al., 2007). Under basal conditions, Nrf2 is sequestered in the cytoplasm by binding to Kelch-like ECH-associated protein 1 (Keap1) (Itoh et al., 2004; Kaspar et al., 2009). When disrupted by electrophilic antioxidants, Nrf2 is released from Keap1 and translocates to the nucleus, dimerizes with Maf, and activates transcription of genes containing the antioxidant response element (ARE) sequences in the

promoter regions (Owuor & Kong, 2002; Katsuoka et al., 2005; Kobayashi &

Yamamoto, 2005; Kensler et al., 2007).

Although anti-inflammatory effect of DHA (n-3, 22:6) has been studied before, the molecular mechanism underlying DHA-mediated inhibition of TNF-Į-induced ICAM-1 expression in human vascular endothelial cells still remains unclear. The aim of this study was to evaluate the effect of DHA on the adhesion of monocytes to TNF-Į-activated endothelial cells which is mediated by adhesion molecules such as ICAM-1, as well as the molecular mechanisms underlying DHA inhibition of ICAM-1 expression.

2. Materials and Methods

2.1 Chemicals

Dulbecco’s modified Eagle medium (DMEM), RPMI 1640, RPMI-1640 (without phenol red), OPTI-MEM, and penicillin/streptomycin were from GIBCO/BRL (Grand Island, NY); 0.25% trypsin-EDTA was from BioWest (Miami, FL); fetal bovine serum (FBS) was from HyClone (Logan, UT); docosahexaenoic acid (DHA) was from Cayman Chemical (Ann Arbor, MI); 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), sodium bicarbonate, human tumor necrosis factor-alpha (TNF-Į DQGDQWL-ȕ-actin antibody were from Sigma-Aldrich (St. Louis, MO); Z-Leu-Leu-Leu-CHO (MG-132) was from Boston Biochem (Cambridge, MA);

2',7'-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein (BCECF-AM) was from Molecular Probes (Eugene, OR); H2DCFDA and TRIzol reagent were from Invitrogen (Carlsbad, CA); antibody against HO-1 was obtained from Calbiochem (Darmstadt, Germany); antibodies against Nrf2, IțBĮ, IKKĮ/IKKȕ-1.SKRVSKR-JNK, ERK, and p38 were from Santa Cruz Biotechnology (Santa Cruz, CA); antibodies against ICAM-1, phospho-IțBĮ (Ser32/36), phospho-IKKĮ(Ser180)/IKKȕ(Ser181), PARP, phospho-ERK, and phospho-p38 were from Cell Signaling Technology (Boston, MA);

antibody against p65 was from BD Bioscience (San Jose, CA).

2.2 Cell cultures

The human endothelial cell line EA.hy926 was a kind gift from Dr. T. S. Wang, Chung Shan Medical University, Taichung, Taiwan, and was cultured in DMEM supplemented with 3.7 g/L NaHCO3, 10% FBS, 100 units/mL penicillin, and 100 ȝJP/VWUHSWRP\FLQDWoC in a 5% CO2humidified incubator. Human leukemia

Research Center (BCRC, Hsinchu, Taiwan). The HL-60 cells were cultured in T-75 tissue culture flasks in RPMI-1640 medium supplemented with 10% FBS, 100 units/mL penicillin, and 100 mg/L streptomycin at 37oC in a 5% CO2humidified incubator.

2.3 Fatty acid preparation

DHA samples were prepared and complexed with fatty acid-free bovine serum albumin at a 6:1 molar ratio before addition to the culture medium. At the same time,

EXW\ODWHGK\GUR[\WROXHQHDQGȝ0Į-tocopheryl succinate were added to the culture medium to prevent lipid peroxidation.

2.4 Cell viability assay

Cell viability was assessed by the MTT assay. The MTT assay measures the ability of viable cells to reduce a yellow

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide to a purple formazan by mitochondrial succinate dehydrogenase. EA.hy926 cells were grown to 70-80% confluence and were then treated with different concentrations of DHA (0-10ȝ0 IRUKIROORZHGE\

incubation with 1 ng/mL TNF-Į for an additional 6 h. Finally, the medium was removed, and the cells were washed with PBS. The cells were then incubated with MTT (0.5 mg/mL) in DMEM medium at 37oC for an additional 3 h. The medium was removed, and 2-propanol was added to dissolve the formazan. After centrifugation at 14,000×g for 5 min, the supernatant of each sample was transferred to 96-well plates, and the absorbance was read at 570 nm in an ELISA reader. The absorbance in control group was regarded as 100% cell viability.

2.5 Nuclear extracts preparation

After each experiment, cells were washed twice with cold PBS and were then scraped from the dishes with 1,ȝ/RI3%6&HOOKRPRJHQDWHVZHUHFHQWULIXJHGDW

2,000×g for 5 min. The supernatant was discarded, and the cell pellet was allowed to VZHOORQLFHIRUPLQDIWHUWKHDGGLWLRQRIȝ/RIK\SRWRQLFEXIIHU P0

HEPES, 10 mM KCl, 1 mM MgCl2, 1 mM EDTA, 0.5 mM DTT, 0.5% NP-40, 4 ȝJP/OHXSHSWLQȝJP/DSURWLQLQDQGP0306) $IWHUFHQWULIXJDWLRQDW

6,000×g for 15 min, pellets containing crude nuclei were resuspended in 50 ȝ/RI

hypertonic buffer (10 mM HEPES, 400 mM KCl, 1 mM MgCl2, 0.2 mM EDTA, 0.5 P0'77ȝJP/OHXSHSWLQȝJP/DSURWLQLQP0306)DQGJO\FHURO  at 4oC for 30min. The samples were then centrifuged at 10,000×g for 15min. The supernatant containing the nuclear proteins was collected and stored at -80oC until the Western blotting and electrophoretic mobility shift assays.

2.6 Western blotting analysis

After each experiment, cells were washed twice with cold PBS and were KDUYHVWHGLQȝ/RIO\VLVEXIIHU P07ULV-HCl, pH 8, 0.1% Triton X-100, 320 mM sucrose, 5 mM EDTA, 1 mM PMSF, 1 mg/L leupeptin, 1 mg/L aprotinin, and 2 mM dithiothreitol). Cell homogenates were centrifuged at 14,000×g for 20 min at 4oC.

The resulting supernatant was used as a cellular protein for Western blotting analysis.

The total protein was analyzed by use of the Coomassie Plus protein assay reagent kit (Pierce Biotechnology, Rockford, IL). Equal amounts of cellular proteins were electrophoresed in a sodium dodecyl sulfate (SDS)-polyacrylamide gel, and proteins were then transferred to polyvinylidene fluoride membranes (Millipore, Billerica, MA). Nonspecific binding sites on the membranes were blocked with 5% nonfat milk

Membranes were probed with antibodies. The membranes were then probed with the secondary antibody labeled with horseradish peroxidase. The bands were visualized by using an enhanced chemiluminescence kit (PerkinElmer Life Science, Boston, MA) and scanned by a luminescent image analyzer (LAS-4000, FUJIFILM, Japan). The bands were quantitated with ImageGauge software (FUJIFILM).

2.7 RNA isolation and RT-PCR

Total RNA of EA.hy926 cells was extracted by using TRIzol reagent. After WUHDWPHQWFHOOVZHUHZDVKHGWZLFHZLWKFROG3%6DQGVFUDSHGZLWKȝ/Rf TRIzol UHDJHQW&HOOVDPSOHVZHUHPL[HGZLWKȝ/RIFKORURIRUPDQGFHQWULIXJHGDW

11,000×g for 15 min. The supernatant was collected and mixed with 250 ȝ/RI

isopropyl alcohol. After centrifuged at 11,000×g for 15 min, the supernatant was discarded and the cell pellet was stored in 70% ethanol or dissolved in deionized ZDWHUIRUTXDQWLILFDWLRQ:HXVHGȝJRIWRWDO51$IRUWKHV\QWKHVLVRIILUVW-strand cDNA by using Moloney murine leukemia virus reverse transcriptase (Promega) in a final volume of 2ȝ/FRQWDLQLQJQJRIROLJR-dT and 40 units of RNase inhibitor.

3&5ZDVFRQGXFWHGLQDWKHUPRF\FOHULQDUHDFWLRQYROXPHRIȝ/FRQWDLQLQJȝ/

RIF'1$%LR7DT3&5EXIIHUȝPRORIHDFKGHR[\ULERQXFOHRWLGHWULSKRVSKDWH

1.25 mmol/L MgCl2, and 1 unit of BioTaq DNA polymerase (BioLine).

Oligonucleotide primers of ICAM-1 (forward,

5’-TGAAGGCCACCCCAGAGGACAAC-3’; reverse,

5’-CCCATTATGACTGCGGCTGCTGCTACC-3’), HO-1 (forward, 5’-CTGAGTTCATGAGGAACTTTCAGAAG-3’; reverse,

5’-TGGTACAGGGAGGCCATCAC-3’), and glyceraldehyde-3-phosphate dehydrogenase (forward, 5’-CCATCACCATCTTCCAGGAG-3’; reverse, 5’-CCTGCTTCACCACCTTCTTG-3’) were designed on the basis of published

sequences (Meagher et al., 1994). Amplification of ICAM-1 and GAPDH were achieved when samples were heated to 95oC for 5 min and then immediately cycling 32 times through a 1-min denaturing step at 94oC, a 1-min annealing step at 56oC, and a 1-min elongation step at 72oC. Amplification of HO-1 and GAPDH were achieved when samples were heated to 95oC for 5 min and then immediately cycling 39 times through a 1-min denaturing step at 95oC, a 1-min annealing step at 55oC, and a 2-min elongation step at 72oC. The glyceraldehyde-3- phosphate dehydrogenase cDNA level was used as the internal standard. PCR products were resolved in a 1% agarose gel and were scanned by a Digital Image Analyzer (Alpha Innotech) and quantitated with ImageGauge software.

2.8 Electrophoretic mobility shift assay (EMSA)

EMSA was performed according to our previous study (Cheng et al., 2004). The LightShift Chemiluminescent EMSA Kit and synthetic biotin-labeled double-stranded NF-țB consensus oligonucleotides (forward, 5’-AGTTGAGGGGACTTTCCCAGGC -3’; reverse, 5’-GCCTGGGAAAGTCCCCTCAACT-3’) were used to measure the NF-țB nuclear protein-'1$ELQGLQJDFWLYLW\1XFOHDUH[WUDFW ȝJ SRO\ G,-dC), and biotin-labeled double-stranded NF-țB oligonucleotides were mixed with the ELQGLQJEXIIHU WRDILQDOYROXPHRIȝ/ DQGZHUHLQFXEDWHGDWoC for 30 min. In addition, the unlabeled and mutant double-stranded NF-țB oligonucleotides

(5’-AGTTGAGGCGACTTTCCCAGGC-3’) were used to confirm the protein binding specificity, respectively. These oligonucleotide primers were synthesized by MDBio Inc. (Taipei, Taiwan). The nuclear protein-DNA complex was separated by

electrophoresis on a 6% TBE-polyacrylamide gel and then were transferred to

Hybond-N+nylon membranes (Amersham Pharmacia Biotech, Inc., Pisscataway, NJ).

streptavidin-horseradish peroxidase, and the nuclear protein-DNA bands were developed with Chemiluminescent Substrate (Pierce Biotechnology, Rockford, IL).

The bands were scanned by a luminescent image analyzer.

2.9 Plasmids, transfection, and luciferase assay

A p2xARE/Luc fragment containing tandem repeats of double-stranded

oligonucleotides spanning the Nrf2 binding site, 5’-TGACTCAGCA-3’, as described by Kataoka et al. (2001) was introduced into the pGL3 promoter plasmid. The ICAM-1 promoter-luciferase construct (pIC339, -339 to 0) was a gift from Dr. P. T.

van der Saag (Hubrecht Laboratory, Utrecht, The Netherlands). pIC339 contains NF-țB (-187/-178), AP-1 (-84/-279), AP-1 (-48/-41), and Sp1 (-59/-53, -206/-201) binding sites (van de Stolpe et al., 1994). All subsequent transfection experiments were performed by using nanofection reagent (PAA, Pasching, Austria) according to the manufacturer’s instructions. EA.hy926 cells were transiently transfected with 0.4 ȝJRIS,&RUpGL3 SODVPLGDQGȝJRIȕ-JDODFWRVLGDVHSODVPLGE\XVLQJȝ/

of nanofectin in OPTI-MEM medium for 8 h. After transfection, cells were changed to DMEM medium and treated with DHA for 16 h before being challenged with TNF-ĮIRUDQDGGLWLRQDOK&HOOVZHUHWKHQZDVKHGWZLFHZLWKFROG3%6 scraped with lysis buffer, and centrifuged at 14,000×g for 3 min. The supernatant was collected IRUWKHPHDVXUHPHQWRIOXFLIHUDVHDQGȕ-galactosidase activities by using a Luciferase Assay Kit (Promega, Madison, WI) according to the manufacturer’s instructions, and the luciferase activity was measured by a microplate luminometer (TROPIX TR- 717, Applied Biosystems). The luciferase activity of each sample was FRUUHFWHGRQWKHEDVLVRIȕ-galactosidase activity, which was measured at 420 nm with O-nitrophenyl-beta-D-galactopyranoside as a substrate.

2.10 RNA interference by small interfering RNA of HO-1 and Nrf2

Predesigned small interfering RNA (siRNA) against human HO-1, Nrf2, and non-targeting control-pool siRNA were purchased from Dharmacon Inc. (Lafayette, CO). EA.hy926 cells were transfected with HO-1 and Nrf2 siRNA SMARTpool by using DharmaFECT1 transfection reagent (Thermo) according to the manufacturer’s instructions. The four siRNAs against the human HO-1 gene are (1)

AUGCUGAGUUCAUGAGGAA, (2) ACACUCAGCUUUCUGGUGG, (3)

CAGUUGCUGGUAGGGCUUUA, and (4) AGAUUGAGCGCAACAAGGA. The 4 siRNAs against the human Nrf2 gene are (1) UAAAGUGGCUGCUCAGAAU, (2) GAGUUACAGUGUCUUAAUA, (3) UGGAGUAAGUCGAGAAGUA, and (4) CACCUUAUAUCUCGAAGUU. Non-targeting siRNA construct (NC) was used as negative control. Specific silencing was confirmed by at least three independent Western blotting assays with cellular extracts 8 h after transfection.

2.11 Peroxide measurement

Detection of intracellular oxidative states was performed by using the probe 2,7-dichlorofluorescin diacetate (H2DCF-DA) (Molecular Probes Inc., Eugene, OR) (Bae et al., 1997). Briefly, cells were grown to 60-70% confluence and then

serum-starved in DMEM supplemented with 0.5% (v/v) FBS for an additional 2 days.

The cells were then stabilized in serum-free DMEM without phenol red for at least 30 min before exposure to DHA or TNF-Į for the indicated time periods. Cells were then incubated for 10 min with the ROS-sensitive fluorophore H2DCF-'$ ȝ0 

Cells were immediately observed under a laser-scanning Confocal microscope (Leica TCS SP2). DCF fluorescence was excited at 488 nm using an argon laser, and the evoked emission was filtered with a 515-nm long pass filter.

2.12 Monocyte adhesion assay

EA.hy926 cells in 12-well plates were allowed to grow to 80% confluence and were then pretreated with DQGȝ0'+$IRUKfollowed by incubation with 1 ng/mL TNF-Į for an additional 6 h. The human monocytic HL-60 cells cultured in RPMI-PHGLXPZLWK)%6ZHUHODEHOHGZLWKȝM 2,7-bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM). At the end of the DHA and TNF-Įtreatment, a total of 1×106BCECF-AM-labeled HL-60 cells were added to each well, and the cells were co-incubated with EA.hy926 cells at 37oC for 30 min.

The wells were washed and filled with cell culture medium, and the plates were sealed, inverted, and centrifuged at 100×g for 5 min to remove nonadherent HL-60 cells. Bound HL-60 cells were lysed in a 1% SDS solution, and the fluorescence intensity was determined in a fluoroscan ELISA plate reader (FLX800, Bio-Tek, Winooski, VT) with an excitation wavelength of 480 nm and an emission wavelength of 520 nm. A control study showed that fluorescence is a linear function of HL-60 cell density in the range of 3,000-80,000 cells/well. The results are reported on the basis of the standard curve obtained.

2.13 Statistical analysis

Data were analyzed by using analysis of variance (SAS Institute, Cary, NC). The significance of the difference among mean values was determined by one-way analysis of variance followed by Tukey’s test and the difference between mean values was determined by student’s t-test; P values <0.05 were taken to be statistically significant.

3. Results

3.1 Cell viability

The MTT assay was used to test whether the concentration of DHA used in the presence of TNF-Į caused cell damage. As shown in Fig. 1, there were no adverse

The MTT assay was used to test whether the concentration of DHA used in the presence of TNF-Į caused cell damage. As shown in Fig. 1, there were no adverse

相關文件