• 沒有找到結果。

Phenethyl Isothiocyanate Inhibited Tumor Migration and Invasion via Suppressing Multiple Signal Transduction Pathways in Human Colon Cancer HT29 Cells

N/A
N/A
Protected

Academic year: 2021

Share "Phenethyl Isothiocyanate Inhibited Tumor Migration and Invasion via Suppressing Multiple Signal Transduction Pathways in Human Colon Cancer HT29 Cells"

Copied!
8
0
0

加載中.... (立即查看全文)

全文

(1)

pubs.acs.org/JAFC Published on Web 09/23/2010 © 2010 American Chemical Society DOI:10.1021/jf102384n

Phenethyl Isothiocyanate Inhibited Tumor Migration and

Invasion via Suppressing Multiple Signal Transduction

Pathways in Human Colon Cancer HT29 Cells

K

UANG

-C

HI

L

AI

,

†,‡

S

HU

-C

HUN

H

SU

,

§

C

HAO

-L

IN

K

UO

,

)

S

IU

-W

AN

I

P

,

^

J

AI

-S

ING

Y

ANG

,

^

Y

UAN

-M

AN

H

SU

,

#

H

UI

-Y

ING

H

UANG

,

^

S

HIN

-H

WAR

W

U

,

rAND

J

ING

-G

UNG

C

HUNG

*

,#,O

Department of Surgery, China Medical University Beigang Hospital, Yunlin, Taiwan,‡School of

Medicine, China Medical University, Taichung, Taiwan,§Department of Chemical Engineering,

Hsiuping Institute of Technology, Taichung, Taiwan, )School of Chinese Pharmaceutical Sciences and

Chinese Medicine Resources, China Medical University, Taichung, Taiwan,^Department of Nutrition,

Department of Pharmacology, China Medical University, Taichung, Taiwan, China Medical University,

Taichung, Taiwan,#Department of Biological Science and Technology, China Medical University, Taichung,

Taiwan,rDivision of Critical Care Medicine, Department of Internal Medicine, Changhua Christian Hospital,

Changhua, Taiwan, andODepartment of Biotechnology, Asia University, Wufeng, Taichung, Taiwan

Phenethyl isothiocyanate (PEITC), one of the major compounds from dietary cruciferous vegetables, has been found to have antitumor properties and therefore could generate special interest for the development of chemopreventive and/or chemotherapeutic agent for human cancers. In the primary studies, we found that PEITC induced cytotoxic effect (decreased the percentage of viable cells) in human colon cancer HT29 cells. Here, in this study, we are the first to report the antimetastatic effect of PEITC in HT29 human colon cancer cells. The results show that PEITC exhibited an inhibitory effect on the abilities of adhesion, migration, and invasion by Boyden chamber assay. Western blotting examination indicated that PEITC exerted an inhibitory effect on the SOS-1, PKC, ERK1/2 and Rho A for causing the inhibitions of MMP-2 and -9 then followed by the inhibition of invasion and migration of HT29 cells in vitro. PEITC also affected Ras, FAK, PI3K or inhibited GRB2, NF-κB, iNOS and COX-2 for causing the inhibition of cell proliferation in HT29 cells. Real-time PCR also showed that PEITC inhibited the gene expressions of MMP-2, -7, -9, FAK and Rho A after PEITC treatment for 48 h in HT29 cells. PEITC also inhibited the activities of AKT, ERK, JNK and PKC. Our results provide a new insight into the mechanisms and functions of PEITC which inhibit migration and invasion of HT29 human colon cancer cells. These results suggest that molecular targeting of NF-κB led to the inhibition of MMP-2, -7, and -9 and it might be a useful strategy for the inhibition of migration and invasion on human colon cancer.

KEYWORDS: PEITC; migration; invasion; MMP-2; MMP-9; human colon cancer HT29 cells

INTRODUCTION

Colon cancer is the second leading cause of human cancer death

in the US (1). In Taiwan, about 18.5 persons per 100 thousand die

annually from colon cancer, based on reports from the People’s

Health Bureau of Taiwan in year 2008. Currently, the treatment

of colon cancer includes surgery, radiation, chemotherapy, or

combination of radiotherapy with chemotherapy. However, the

mortality in colon cancer patients remains high. Epidemiologic

studies have demonstrated that dietary intake of cruciferous

vegetables may decrease the risk of various types of

malignan-cies (2) including colon cancer (3). The anticarcinogenic effect of

cruciferous vegetables is attributed to organic isothiocyanates

(ITCs) in edible cruciferous vegetables including broccoli (2).

Phenethyl ITC (PEITC) is one of the ITC family of compounds

which exhibits cancer chemopreventive activity (4). ITCs inhibit

cancer formation including lung, esophagus, mammary gland,

liver, small intestine and bladder (5).

It was reported that PEITC induces apoptosis in HT-29 cells in

a time and dose-dependent manner via the mitochondria caspase

cascade, and the activation of JNK (6). PEITC was shown to

inhibit cytochrome P450 (CYP) enzymes and to induce phase II

detoxification enzymes (7). Furthermore, PEITC was shown to

inhibit 4-(methylnitrosamino)-1-(3-pyridyl)-1-butone-induced

pul-monary neoplasia in rats and mice (8, 9) and azoxymethane-induced

colonic aberrant crypt foci formation in rats (10). However, there

is no available information to address the effects of PEITC on

invasion and migration of cancer cells.

It is well-documented that invasion and migration are

funda-mental properties of malignant cancer cells. The formation of

meta-static nodules of colon cancer involves multiprocessing cascades

such as cell adhesion, migration, and proteolysis of the extracellular

*Corresponding author. Tel:þ886 4 2205 3366, int 2161. Fax:

(2)

matrix (ECM). The matrix metalloproteinases (MMPs) (a family

of zinc-dependent endopeptidases) are deeply involved in the

invasion and metastasis of various tumor cells (11-13). About

24 kinds of MMPs have been identified. However, MMP-2

(gelatinase-A) and MMP-9 (gelatinase-B) are most associated

with tumor migration, invasion and metastasis for various human

cancers (14

-16). Therefore, agents from natural products which

can suppress the expressions of MMP-2 or -9 may be considered

worthy of development for anticolon cancer invasion and

metastasis.

Although many studies have shown that PEITC can be used

as an inducer of apoptosis (anticancer activities), there are no

reports to show that PEITC inhibited the migration and invasion

of colon cancer cells. Therefore, in the present study, we focused

on the effect of PEITC on the migration and invasion of HT29

human colon cancer cells in vitro.

MATERIALS AND METHODS

Chemicals and Reagents. Phenethyl isothiocyanates (PEITC), dimethyl sulfoxide (DMSO), propidium iodide, potassium phosphates, Triton X-100 and trypan blue were obtained from Sigma Chemical Co.

(St. Louis, MO). RPMI-1640 medium,L-glutamine, fetal bovine serum,

penicillin-streptomycin, and trypsin-EDTA were obtained from

Invitro-gen (Carlsbad, CA). Primary antibodies used for Western analysis were obtained as follows: antibodies for PI3K, PKC, Ras, GRB2, SOS1, P-ERK, ERK1/2, MMP-2, MMP-9, Rho A, FAK, iNOS, COX-2 and

NF-κB were purchased from Santa Cruz Biotechnology (Santa Cruz, CA)

and diluted in cell culture medium before use.

HT29 Cell Line. The HT29 human colon cancer cell line was purchased from the Food Industry Research and Development Institute (Hsinchu, Taiwan). Cells were cultured in 88% RPMI-1640 medium with

1.5 mML-glutamine supplemented with 10% fetal bovine serum (Gibco

BRL, Grand Island, NY), and 2% penicillin-streptomycin (100 units/mL

penicillin and 100μg/mL streptomycin) and were cultured in a humidified

atmosphere of 5% CO2and 95% air at 37C.

Effects of PEITC on the Percentage of Viable HT29 Cells. The

HT29 cells (2 105cells/well) were placed in 12-well plates and incubated

at 37C for 24 h before each well was cotreated with 0, 0.01, 0.25, 0.5, 1.0,

2.5, 5.0, 7.5, and 10μM PEITC for 24 h. 0.5% DMSO (solvent) was used

through the whole study. Cells were harvested by centrifugation before being used for determining cell viability, and the flow cytometric protocol was used, as previously described (17, 18).

Wound Healing Assay. HT-29 cells were grown on 6-well dish plates

to 100% confluent monolayer and then scratched to form a 100μm “wound”

using sterile pipet tips. The cells were then cultured in the presence or

absence of PEITC (0.01, 0.25μM) in serum-free media for 24 h. The

images were recorded at 24 and 48 h after scratch using an Olympus photomicroscope (19).

In Vitro Migration Assay. The migration of HT29 cells was also measured by chemotactic directional migration which was determined

using a 24-well Transwell insert. Briefly, 8μm pore filters (Millipore, MA)

were coated with 30μg of type Ι collagen (Millipore, MA) for 1 h. The

HT29 cells (104cells/0.4 mL of RPMI-1640) were plated in the upper

chamber with or without PEITC (0.01 or 0.25μM) and allowed to undergo

migration for 24/48 h. In the upper chamber, the nonmigrated cells were removed with a cotton swab and the filters were stained with 2% crystal violet. Migrated cells adherent to the underside of the filter were counted

and photographed under a light microscope at200 (20, 21). Each

treatment was assayed twice, and three independent experiments were performed.

In Vitro Invasion Assay. The invasion of HT29 cells was measured

using Matrigel-coated Transwell cell culture chambers (8μm pore size)

as described previously (21, 22). Cells were maintained in serum-free RPMI-1640 medium for 24 h before being trypsinized and resuspended in serum-free medium and placed in the upper chamber of the Transwell

insert (5 104cells/well) and treated with 0.5% DMSO or PEITC (0, 0.01,

or 0.25μM). RPMI-1640 medium containing 10% FBS was placed in

the lower chamber. Cells were incubated for 24 or 48 h in a humidified

atmosphere with 95% air and 5% CO2at 37C. Invasive cells were fixed

with 4% formaldehyde in PBS and stained with 2% crystal violet in 2% ethanol. The noninvasive cells in the upper chamber were removed by wiping with a cotton swab. The cells in the lower surface of the filter which penetrated through the Matrigel were counted under a light microscope

at200.

Western Blotting Analysis. HT29 cells were cultured in 6-well tissue culture plates and grown for 24 h. PEITC was added to cells at a final

concentration of 2.5μM, while DMSO (solvent) alone was added to

control cells. Cells were incubated with PEITC in 90% RPMI-1640

medium with 1% FBS at 37C for 0, 6, 12, 24, and 48 h. The cells were

then harvested and resuspended in ice-cold 50 mM potassium phosphate buffer (pH 7.4) containing 2 mM EDTA and 0.1% Triton X-100. The cells

were sonicated and centrifugated at 13000g for 10 min at 4C to remove

cell debris. The supernatant was collected and total protein concentra-tion of each sample was determined using a Bio-Rad protein assay kit (Hercules, CA) with bovine serum albumin (BSA) as the standard . SDS gel electrophoresis and Western blotting were conducted as described previously (23,24). Western blotting was performed to determine effects of PEITC on protein levels of PI3K, PKC, Ras, GRB2; SOS1, p-ERK,

ERK1/2, MMP-2, MMP-9, Rho A, FAK, iNOS, COX-2 and NF-κB p65.

Real-Time PCR of MMP-2, -7, and -9, FAK and RhoA. HT29 cells were cultured in 6-well plates and grown for 24 h. PEITC was added

to cells in each well for a final concentration of 2.5μM for 24 h. Cells were

then harvested and total RNA was extracted using the Qiagen RNeasy Mini Kit as described previously (21, 25). RNA samples were

reverse-transcribed at 42C with High Capacity cDNA Reverse Transcription Kit

for 30 min according to the protocol of the supplier (Applied Biosystems).

Quantitative PCR conditions were as follows: 2 min at 50C, 10 min at

95C, and 40 cycles of 15 s at 95 C; 1 min at 60 C using 1 μL of the cDNA

reverse-transcribed as described above, 2X SYBR Green PCR Master Mix (Applied Biosystems) and 200 nM forward and reverse primers as shown in Table 1. Applied Biosystems 7300 Real-Time PCR system was used for each assay in triplicate, and expression fold-changes were derived using the

comparative CTmethod.

AKT, ERK, JNK and PKC Activity Assay. The inhibitory activity

of PEITC (1000, 500, 250, 125, 62.50, 31.25, 15.63, 7.81, and 3.71μM in

DMSO) was measured in kinase assays. To measure AKT, ERK, JNK and PKC activity specifically, specific substrate peptide (AKT, ERK, JNK

and PKC substrates (Crosstide, MBP, ATF2 and Histone H1þ Lipid

Activator, respectively)) and 10μCi/μL of33P-ATP were mixed in a

Tris-HCl buffer (pH 7.5), 1.5 mM CaCl2; 16μg/mL calmodulin; 2 mM MnCl2

in Base Reaction Buffer (20 mM Hepes (pH 7.5), 10 mM MgCl2, 1 mM EGTA, 0.02% Brij35, 0.02 mg/mL BSA, 0.1 mM Na3VO4, 2 mM DTT,

1% DMSO). Human AKT, ERK, JNK and PKC protein samples (20μL)

were added to the reaction mix and incubated for 120 min at room temperature. Reactions were spotted onto P81 ion exchange paper. Filters were washed extensively in 0.1% phosphoric acid followed by count-ing (26, 27).

Statistical Analysis. Data are presented as the mean( SEM for the

indicated number of separate experiments. Statistical analyses of data were done by one-way ANOVA, and *P < 0.05 were considered significant.

Table 1. The DNA Sequence Was Evaluated Using the Primer Expressiona

primer name primer sequence homo MMP-2-F CCCCAGACAGGTGATCTTGAC homo MMP-2-R GCTTGCGAGGGAAGAAGTTG homo MMP-7-F GGATGGTAGCAGTCTAGGGATTAACT homo MMP-7-R AGGTTGGATACATCACTGCATTAGG homo FAK-F TGAATGGAACCTCGCAGTCA homo FAK-R TCCGCATGCCTTGCTTTT homo RhoA-F TCAAGCCGGAGGTCAACAAC homo RhoA-R ACGAGCTGCCCATAGCAGAA

homo ROCK1-F ATGAGTTTATTCCTACACTCTACCACTTTC homo ROCK1-R TAACATGGCATCTTCGACACTCTAG homo GAPDH-F ACACCCACTCCTCCACCTTT homo GAPDH-R TAGCCAAATTCGTTGTCATACC

aRNA samples were reverse-transcribed for 30 min at 42C with High Capacity

cDNA Reverse Transcription Kit according to the standard protocol of the supplier (Applied Biosystems). Each assay was run on an Applied Biosystems 7300 Real-Time PCR system at least twice to ensure reproducibility.

(3)

RESULTS

Effects of PEITC on the Percentage of Viable WEHI-3 Cells.

To verify the effect of PEITC on cell viability, HT29 cells were

exposed to different concentrations of PEITC for 24 h, and cells

were examined under microscope. They then were collected for

propidium iodine staining for viability analysis. The results are

present in Figure 1 and indicated that a significant loss of viability

was detected at 2.5, 1, and 5

μM PEITC in a dose-dependent

manner (Figure 1). Cell viability by PEITC was further confirmed

by trypan blue dye exclusion method. Based on the decreased

percentage of viable HT29 cells following PEITC treatment, we

investigated the functional effects of PEITC on cell migration and

invasion.

Effects of PEITC on Migration and Invasion of HT29 Cells.

HT29 cells have an ability to migrate a 24-well Transwell insert.

Treatment of PEITC for 24 and 48 h exhibited significant

inhibi-tion of cell migrainhibi-tion in a dose-dependent manner. PEITC also

inhibited cancer cell migration in the wound healing test at

concentrations of 0.01 and 0.25

μM (Figure 2A). Results from

migration assay are shown in Figures 2B and 2C, which indicate

that PEITC had a significant inhibitory effect on cell migration at

concentrations between 0.01 and 0.25

μM. Data in Figure 2C

Figure 1. Effect of PEITC on cell viability in human colon cancer HT29

cells. HT29 cells were incubated with various concentrations (0, 0.01, 0.25, 0.5, 1.0, 2.5, 5.0, 7.5, and 10.0μM) for 24 h. Cells were directly photographed (200) and then were harvested and stained with PI; then the percentage of viable HT29 cells was determined as described in Materials and Methods. A: Percentage of viable cells. B: The migration of cells. Data represents mean( SD of three experiments. *p < 0.05 compared with the untreated control (dose 0).

Figure 2. Effect of PEITC on migration and invasion of HT29 cells. HT29 cells were treated with various concentrations (0, 0.01, and 0.25μM) of PEITC for

24 and 48 h. (A) Cell motility was determined by wound healing assay after PEITC treatment for 24 and 48 h. (B) Cell migration was measured in a Boyden chamber for 12 and 24 h with polycarbonate filters (pore size, 8μm). (D) Cell invasion was measured in a Boyden chamber for 12 and 24 h; polycarbonate filters (pore size, 8μm) were precoated with Matrigel. Migration (C) and invasion (E) ability of HT29 cells were quantified by counting the number of cells that invaded the underside of the porous polycarbonate membrane under microscopy and represent the average of three experiments. *p < 0.05 compared with the untreated control (dose 0). *p < 0.05 compared with the untreated control (dose 0). Scale bar, 40 μm.

(4)

indicate that the inhibition was at 57-64% and 61-69% when

cells were incubated with PEITC for 24 and 48 h treatment,

respec-tively. HT29 cells have an ability to invade through

Matrigel-coated Transwell cell culture chambers. Treatment of PEITC for

24 and 48 h exhibited the significant inhibition of cell invasion in a

dose-dependent manner. Results from invasion assay are shown

in Figures 2D and 2E. Figure 2D shows that HT29 cells moved

from the upper chamber to the lower chamber in the absence

of PEITC (control group). However, the penetration of the

EHS-coated filter by HT29 cells was inhibited in the presence of

PEITC. The percentage inhibition at 0.01 was 18

-58%, and at

0.25

μM inhibition, it ranged from 29 to 54% (Figure 2E).

Effects of PEITC on Levels of Proteins Associated with

Migra-tion and Invasion in HT29 Cells. Results from Western blotting

assay are shown in Figure 3A

-D, which indicates that PEITC

reduced levels of PERK, FAK, ERK1/2 and JNK (Figure 3A),

GRB2, Rho A, RCK1, SOS1, pI3K and PKC (Figure 3B), iNOS,

NF-

κB p65 and COX-2 (Figure 3C), and MMP-2 and MMP-7

(Figure 3D), but increased protein levels of MEEK3 (Figure 3A)

in examined HT29 cells. These effects may lead to the inhibition

of migration and invasion of HT29 cells.

Effects of PEITC on MMP-2, MMP-7, MMP-9, FAK and Rho

A mRNA Expressions in HT29 Cells. To further investigate whether

or not PEITC affected migration- and invasion-associated gene

expression in HT29 cells, cells were treated with PEITC (2.5

μM)

for 0, 24, and 48 h. Total RNA was isolated from control and

PEITC treatment, and gene expressions were examined by

real-time PCR. The results are shown in Figure 4, and they indicate

that the expression levels of MMP-2, MMP-7 and MMP-9 were

inhibited during PEITC treatment for 48 h but only MMP-7 was

inhibited in 24 h treatment (Figure 4A). However, FAK and Rho

A mRNA were decreased at 48 h treatment, but it did not show in

24 h treatment of PEITC (Figure 4B).

Effects of PEITC on AKT, ERK, JNK and PKC Activities.

Results from Western blotting indicate that PEITC decreases the

protein levels of AKT, ERP, JNK and PKC, and we further

investigated whether PEITC also affected the activities of AKT,

ERK, JNK and PKC; the results are shown in Figure 5A-D.

Figure 3. Effects of PEITC on the protein levels of associated proteins for migration and invasion in HT29 cells. HT29 cells were treated with 2.5μM PEITC for

6, 12, 24 and 48 h. The total proteins were collected from each sample, and the protein levels (A, PERK, MKK3, FAK, ERK1/2 and p38; B, Ras, GRB2, Rho A, ROCK1 and SOS1; C, iNOS, NF-κB p65, COX-2 and uPA; D, MMP-2, MMP-7 and MMP-9) were measured by SDS-PAGE and Western blotting as described in Materials and Methods.

(5)

Figure 5 indicated that PEITC inhibited the activities of AKT,

ERK, JNK and PKC in a dose-dependent manner. However, the

initial inhibition concentrations were different such as AKT from

15.63 to 100

μM, ERK from 62.5 to 100 μM, JNK from 7.81 to

100

μM, and PKC from 3.71 to 100 μM of PEITC.

DISCUSSION

Tumor invasion requires degradation of basement membranes,

proteolysis of ECM, pseudopodial extension, and cell

migra-tion (28). A number of proteolytic enzymes, including MMPs and

serine proteinases, are involved in these tumor host interactions,

such as degradation of underlying basement membrane. Of these

basement membrane degrading enzymes, MMPs, especially

acti-vated forms of MMP-2 and MMP-9, are thought to play an

important role in its degradation because of their ability to cleave

the type IV collagen. MMPs are produced by cancer cells or

through the induction of surrounding stromal cells. Several studies

indicate that inhibition of MMP expressions or enzyme activities

can be used as early targets for preventing cancer metastasis

(29

-31). It is well-known that cell migration is a multicomplex

process which provides many molecular targets for the

develop-ment of therapeutic agents to inhibit cancer metastasis

Although PEITC was reported to possess anticancer potential

against several cancer cell lines (6-9), the role of PEITC against

the migration and invasion of HT29 cells and associated protein

levels and gene expressions is still unclear. Our results showed that

Figure 4. Effects of PEITC on MMP-2, MMP-7, MMP-9, FAK and Rho A

mRNA expression in HT29 cells. The total RNA was extracted from each treatment of PEITC (2.5μM) on HT29 cells for 0, 24, and 48 h, and RNA samples were reverse-transcribed with cDNA then for real-time PCR as described in Materials and Methods. The ratios of MMP-2, MMP-7 and MMP-9 (A), FAK and Rho A (B) mRNA/GAPDH are presented in panels A and B. Data represents mean ( SD of three experiments. *P < 0.05, ***P < 0.001 compared with the untreated control (dose 0).

Figure 5. Effects of PEITC on AKT, ERK, JNK and PKC activities. AKT,

ERK, JNK and PKC substrates (Crosstide, MBP, ATF2 and Histone H1þ Lipid Activator, respectively) in Base Reaction Buffer (20 mM Hepes (pH 7.5), 10 mM MgCl2, 1 mM EGTA, 0.02% Brij35, 0.02 mg/mL BSA, 0.1 mM Na3VO4, 2 mM DTT, 1% DMSO) with cofactors (1.5 mM CaCl2; 16μg/mL calmodulin; 2 mM MnCl2). Then kinase was added to the sub-strate solution and gently mixed and PEITC (1000, 500, 250, 125, 62.50, 31.25, 15.63, 7.81, and 3.71μM in DMSO) was added to the kinase reaction mixture. Then the33P-ATP (specific activity 0.01μCi/μL final) was added into the reaction mixture before being spotted onto P81 ion exchange paper. Washing of filters extensively in 0.1% phosphoric acid and counting were as described in Materials and Methods. Data represents mean( SD of three experiments. *P < 0.05 were considered significant.

(6)

PEITC induced cytotoxicity and inhibited the migration and

invasion in HT29 cells and that these effects are dose dependent

(Figure 1). Furthermore, we found that PEITC decreased the

migration and invasion associated protein levels such as PERK,

FAK, ERK1/2, JNK, p38 (Figure 3A, Ras, GrB2, Rho A,

ROCK1, SOS1, PI3K and PKC (Figure 3B, iNOS, NF-κB p65,

COX-2 and uPA (Figure 3C) MMP-2, MMP-7 and MMP-9

(Figure 3D) cells. PEITC also inhibited the activities of AKT,

ERK, JNK and PKC. Our results also showed that PEITC

suppressed MMP-9 gene expression via suppressing the PKCs/

MAPK and PI3K/AKT/NF-

κB cascades with consequent

sup-pression of colony formation, tumor migration and invasion by

human colon cancer HT29 cells. The activities of MMP-2 and

uPA have been shown to play a critical role in degrading the

basement membrane in cancer invasion and migration. We also

found that PEITC tremendously reduced MMP-2 activity in a

dose-dependent manner, whereas uPA activity was also inhibited

by PEITC (data not shown).

It was reported that MMP-2 overexpressed in highly metastatic

tumors, and that MMP-9 can be stimulated by TNF-

R (32) or a

growth factor such as VEGF, EGF and TGF-

β (33-35), or Ras

oncogene (36, 37) through activation of different intracellular

signaling pathways. It was also reported that the activation of

PKC led to the translocation of the protein to membranes and led

to control the expression of MMP-9 through modulating the

activation of transcription factors such as AP-1, NF-κB or Sp-1

through MAPK and PI3K signaling pathways (38

-40).

It was reported that the activation of NF-

κB is involved in the

induction of the MMP-9 gene associated with the invasion and

metastasis of tumor cells by different agents including TPA,

growth factors such as EGF, VEGF, platelet-derived growth

factor, transforming growth factor-b, and inflammatory

cyto-kines (32, 41). Therefore, in the present study, the regulation of

NF-

κB, and the downstream of the PI3K/Akt and MAPK

(ERK1/2, p38 and JNK) pathways, might be involved in PEITC

suppressed MMP-9 expression and invasion in HT29 cells. We

also found that HT29 cells were treated with PEITC which led to

decrease the protein levels of PI3K, Akt, MMP-2 and MMP-9.

It was reported that PI3K activation leads to activate the

downstream main target Akt which plays various important roles

in regulating cellular growth, differentiation, adhesion, the

inflam-matory reaction, and invasion (33, 42). We also found that

PEITC decreased the JNK and PKC levels (Figure 5). It was

reported that resveratrol suppresses MMP-9 expression in

TPA-induced human Ca Ski cells by blocking JNK and PKC

δ signal

transduction (43). So far, there is no report to show the receptor in

cells for PEITC. However, there may be other possible

mecha-nisms in which PEITC penetrates cells, probably to compete with

coenzymes or ATP to inhibit the activity of PKC.

Other factors also play an important role in migration and

invasion such as 52-kDa uPA which plays a major role in the

decomposition of basement membranes. This enzyme is highly

expressed in solid tumors. It was reported that the activation of

the uPA/uPAR/plasmin proteolytic network has been shown to

play key roles in tumor invasion and dissemination of various

malignancies (44, 45). The presence of uPA in tumor tissues has

been proposed as a potential prognostic factor, and the levels of

uPA and uPAR expression serve as prognostic markers in various

malignancies. However, high levels of expression are often

associated with a poor prognosis (46). We then examined whether

PEITC blocks the expressions of MMP-2, -7, and -9 and uPA

which are closely associated with tumor invasion, and the results

confirmed this hypothesis.

The present study provides proof that, through a molecular

mechanism, PEITC promotes a strong anti-invasive and

antimigration effect through downregulation of PKC and then

blocking MAPK and PI3K/Akt signaling pathways, NF-κB, and

uPA which then led to the inhibition of MMP-2 and MMP-9

(Figure 6). Therefore, we conclude that PEITC may have a

potential for inhibiting the migration and invasion of human colon

cancer in future.

ABBREVIATIONS USED

ERK, extracellular signal-regulated kinases; FAK, focal

adhe-sion kinase; JNK, c-Jun NH2-terminal kinase; MMPs, matrix

metalloproteinase; NF-κB, nuclear factor kappaB; PEITC,

phen-ethyl isothiocyanate; PKC, protein kinase C; RhoA, ras

homo-logue gene family, member A; GRB2, growth factor

receptor-bound protein 2; Cox-2, cyclooxygenase-2; INOS, inducible nitric

oxide synthase; PI3K, phosphoinositide 3-kinases; SOS1, son of

sevenless homologue 1; AP-1, activator protein 1; MAPK,

mitogen-activated protein kinase.

LITERATURE CITED

(1) Wingo, P. A.; Tong, T.; Bolden, S. Cancer statistics, 1995. Ca;Cancer

J. Clin. 1995, 45 (1), 8-30.

(2) Conaway, C. C.; Yang, Y. M.; Chung, F. L. Isothiocyanates as cancer chemopreventive agents: their biological activities and metabolism in rodents and humans. Curr. Drug Metab. 2002, 3 (3),

233-255.

(3) Potter, J. D. Nutrition and colorectal cancer. Cancer, Causes Control

1996, 7 (1), 127-146.

(4) Stoner, G. D.; Morrissey, D. T.; Heur, Y. H.; Daniel, E. M.; Galati, A. J.; Wagner, S. A. Inhibitory effects of phenethyl isothiocyanate on N-nitrosobenzylmethylamine carcinogenesis in the rat esophagus.

Cancer Res. 1991, 51 (8), 2063-2068.

(5) Zhang, Y.; Talalay, P. Anticarcinogenic activities of organic iso-thiocyanates: chemistry and mechanisms. Cancer Res. 1994, 54 (7 Suppl.),

1976s-1981s.

(6) Hu, R.; Kim, B. R.; Chen, C.; Hebbar, V.; Kong, A. N. The roles of JNK and apoptotic signaling pathways in PEITC-mediated responses in human HT-29 colon adenocarcinoma cells. Carcinogenesis 2003,

24(8), 1361-1367.

(7) Zhang, Y. Cancer-preventive isothiocyanates: measurement of human exposure and mechanism of action. Mutat. Res. 2004, 555

(1-2), 173-190.

(8) Wu, X.; Kassie, F.; Mersch-Sundermann, V. Induction of apoptosis in tumor cells by naturally occurring sulfur-containing compounds.

Mutat. Res. 2005, 589 (2), 81-102.

(9) Morse, M. A.; Amin, S. G.; Hecht, S. S.; Chung, F. L. Effects of aromatic isothiocyanates on tumorigenicity, O6-methylguanine formation, and metabolism of the tobacco-specific nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone in A/J mouse lung.

Cancer Res. 1989, 49 (11), 2894-2897.

(10) Zhang, Y.; Kensler, T. W.; Cho, C. G.; Posner, G. H.; Talalay, P. Anticarcinogenic activities of sulforaphane and structurally related

Figure 6. The proposed possible signal pathway of PEITC-inhibited

(7)

synthetic norbornyl isothiocyanates. Proc. Natl. Acad. Sci. U.S.A. 1994,

91(8), 3147-3150.

(11) Kilian, M.; Gregor, J. I.; Heukamp, I.; Hanel, M.; Ahlgrimm, M.; Schimke, I.; Kristiansen, G.; Ommer, A.; Walz, M. K.; Jacobi, C. A.;

Wenger, F. A. Matrix metalloproteinase inhibitor RO 28-2653

decreases liver metastasis by reduction of MMP-2 and MMP-9 concentration in BOP-induced ductal pancreatic cancer in Syrian Hamsters: inhibition of matrix metalloproteinases in pancreatic cancer.

Prostaglandins, Leukotrienes Essent. Fatty Acids 2006, 75 (6), 429-434.

(12) Mizutani, K.; Kofuji, K.; Shirouzu, K. The significance of MMP-1 and MMP-2 in peritoneal disseminated metastasis of gastric cancer. Surg. Today 2000, 30 (7), 614-621.

(13) Gullu, I. H.; Kurdoglu, M.; Akalin, I. The relation of gelatinase (MMP-2 and -9) expression with distant site metastasis and tumour aggressiveness in colorectal cancer. Br. J. Cancer 2000, 82 (1), 249. (14) Donadio, A. C.; Remedi, M. M.; Susperreguy, S.; Frede, S.;

Gilardoni, M. B.; Tang, Y.; Pellizas, C. G.; Yan, L. Extracellular matrix

metalloproteinase inducer (EMMPRIN) and matrix

metallo-proteinases (MMPs) as regulators of tumor-host interaction in a spontaneous metastasis model in rats. Histochem. Cell Biol. 2008, 130

(6), 1155-1164.

(15) Cortes-Reynosa, P.; Robledo, T.; Macias-Silva, M.; Wu, S. V.; Salazar, E. P. Src kinase regulates metalloproteinase-9 secretion induced by type IV collagen in MCF-7 human breast cancer cells.

Matrix Biol. 2008, 27 (3), 220-231.

(16) Okuducu, A. F.; Zils, U.; Michaelis, S. A.; Michaelides, S.; von Deimling, A. Ets-1 is up-regulated together with its target gene products matrix metalloproteinase-2 and matrix metalloproteinase-9 in atypical and anaplastic meningiomas. Histopathology 2006, 48 (7),

836-845.

(17) Ho, C. C.; Lin, S. Y.; Yang, J. S.; Liu, K. C.; Tang, Y. J.; Yang, M. D.; Chiang, J. H.; Lu, C. C.; Wu, C. L.; Chiu, T. H.; Chung, J. G. Gallic acid inhibits murine leukemia WEHI-3 cells in vivo and

promotes macrophage phagocytosis. In Vivo 2009, 23 (3), 409-413.

(18) Lin, J. P.; Yang, J. S.; Lu, C. C.; Chiang, J. H.; Wu, C. L.; Lin, J. J.; Lin, H. L.; Yang, M. D.; Liu, K. C.; Chiu, T. H.; Chung, J. G. Rutin inhibits the proliferation of murine leukemia WEHI-3 cells in vivo and promotes immune response in vivo. Leuk. Res. 2009, 33 (6),

823-828.

(19) Yun, J. W.; Lee, W. S.; Kim, M. J.; Lu, J. N.; Kang, M. H.; Kim, H. G.; Kim, D. C.; Choi, E. J.; Choi, J. Y.; Lee, Y. K.; Ryu, C. H.; Kim, G.; Choi, Y. H.; Park, O. J.; Shin, S. C. Characterization of a profile of the anthocyanins isolated from Vitis coignetiae Pulliat and their anti-invasive activity on HT-29 human colon cancer cells. Food

Chem. Toxicol. 2010, 48 (3), 903-909.

(20) Fishman, D. A.; Liu, Y.; Ellerbroek, S. M.; Stack, M. S. Lysophos-phatidic acid promotes matrix metalloproteinase (MMP) activation and MMP-dependent invasion in ovarian cancer cells. Cancer Res.

2001, 61 (7), 3194-3199.

(21) Chen, Y. Y.; Chiang, S. Y.; Lin, J. G.; Ma, Y. S.; Liao, C. L.; Weng, S. W.; Lai, T. Y.; Chung, J. G. Emodin, aloe-emodin and rhein inhibit migration and invasion in human tongue cancer SCC-4 cells through the inhibition of gene expression of matrix metalloproteinase-9.

Int. J. Oncol. 2010, 36 (5), 1113-1120.

(22) Lin, C. C.; Chen, J. T.; Yang, J. S.; Lu, H. F.; Hsu, S. C.; Tan, T. W.; Lin, Y. T.; Ma, Y. S.; Ip, S. W.; Wu, J. J.; Li, Y. C.; Chung, J. G. Danthron inhibits the migration and invasion of human brain glio-blastoma multiforme cells through the inhibition of mRNA expression of focal adhesion kinase, Rho kinases-1 and metalloproteinase-9.

Oncol. Rep. 2009, 22 (5), 1033-1037.

(23) Lu, C. C.; Yang, J. S.; Huang, A. C.; Hsia, T. C.; Chou, S. T.; Kuo, C. L.; Lu, H. F.; Lee, T. H.; Wood, W. G.; Chung, J. G. Chrysophanol induces necrosis through the production of ROS and alteration of ATP levels in J5 human liver cancer cells. Mol. Nutr.

Food Res. 2010, 54 (7), 967-976.

(24) Ji, B. C.; Hsu, W. H.; Yang, J. S.; Hsia, T. C.; Lu, C. C.; Chiang, J. H.; Yang, J. L.; Lin, C. H.; Lin, J. J.; Suen, L. J.; Gibson Wood, W.; Chung, J. G. Gallic acid induces apoptosis via caspase-3 and mitochondrion-dependent pathways in vitro and suppresses lung xenograft tumor growth in vivo. J. Agric. Food Chem. 2009, 57 (16),

7596-7604.

(25) Lai, K. C.; Huang, A. C.; Hsu, S. C.; Kuo, C. L.; Yang, J. S.; Wu, S. H.; Chung, J. G. Benzyl isothiocyanate (BITC) inhibits migration and invasion of human colon cancer HT29 cells by inhibiting matrix metalloproteinase-2/-9 and urokinase plasminogen (uPA) through PKC and MAPK signaling pathway. J. Agric. Food Chem. 2010, 58

(5), 2935-2942.

(26) Jones, P. F.; Jakubowicz, T.; Pitossi, F. J.; Maurer, F.; Hemmings, B. A. Molecular cloning and identification of a serine/threonine protein kinase of the second-messenger subfamily. Proc. Natl. Acad.

Sci. U.S.A. 1991, 88 (10), 4171-4175.

(27) Enomoto, A.; Murakami, H.; Asai, N.; Morone, N.; Watanabe, T.; Kawai, K.; Murakumo, Y.; Usukura, J.; Kaibuchi, K.; Takahashi, M. Akt/PKB regulates actin organization and cell motility via Girdin/

APE. Dev. Cell 2005, 9 (3), 389-402.

(28) Economou, M. A. Uveal melanoma and macular degeneration: molecular biology and potential therapeutic applications. Acta

Ophthalmol. 2008, 86 (8), 930-931.

(29) Guruvayoorappan, C.; Kuttan, G. Amentoflavone inhibits experi-mental tumor metastasis through a regulatory mechanism involving MMP-2, MMP-9, prolyl hydroxylase, lysyl oxidase, VEGF, ERK-1, ERK-2, STAT-1, nm23 and cytokines in lung tissues of C57BL/6

mice. Immunopharmacol. Immunotoxicol. 2008, 30 (4), 711-727.

(30) Waas, E. T.; Wobbes, T.; Lomme, R. M.; DeGroot, J.; Ruers, T.; Hendriks, T. Matrix metalloproteinase 2 and 9 activity in patients with colorectal cancer liver metastasis. Br. J. Surg. 2003, 90 (12),

1556-1564.

(31) Okada, N.; Ishida, H.; Murata, N.; Hashimoto, D.; Seyama, Y.; Kubota, S. Matrix metalloproteinase-2 and -9 in bile as a marker of liver metastasis in colorectal cancer. Biochem. Biophys. Res.

Commun. 2001, 288 (1), 212-216.

(32) Nee, L.; Tuite, N.; Ryan, M. P.; McMorrow, T. TNF-alpha and IL-1 beta-mediated regulation of MMP-9 and TIMP-1 in human glo-merular mesangial cells. Nephron. Exp. Nephrol. 2007, 107 (2),

e73-86.

(33) Hollborn, M.; Stathopoulos, C.; Steffen, A.; Wiedemann, P.; Kohen, L.; Bringmann, A. Positive feedback regulation between MMP-9 and VEGF in human RPE cells. Invest. Ophthalmol. Vis. Sci. 2007, 48 (9),

4360-4367.

(34) Cowden Dahl, K. D.; Symowicz, J.; Ning, Y.; Gutierrez, E.; Fishman, D. A.; Adley, B. P.; Stack, M. S.; Hudson, L. G. Matrix metallopro-teinase 9 is a mediator of epidermal growth factor-dependent e-cadherin loss in ovarian carcinoma cells. Cancer Res. 2008, 68

(12), 4606-4613.

(35) Zeisberg, M.; Maeshima, Y.; Mosterman, B.; Kalluri, R. Renal fibrosis. Extracellular matrix microenvironment regulates migratory behavior of activated tubular epithelial cells. Am. J. Pathol. 2002,

160(6), 2001-2008.

(36) Thant, A. A.; Sein, T. T.; Liu, E.; Machida, K.; Kikkawa, F.; Koike, T.; Seiki, M.; Matsuda, S.; Hamaguchi, M. Ras pathway is required for the activation of MMP-2 secretion and for the invasion of

src-transformed 3Y1. Oncogene 1999, 18 (47), 6555-6563.

(37) Moon, A.; Kim, M. S.; Kim, T. G.; Kim, S. H.; Kim, H. E.; Chen, Y. Q.; Kim, H. R. H-ras, but not N-ras, induces an invasive phenotype in human breast epithelial cells: a role for MMP-2 in the H-ras-induced invasive phenotype. Int. J. Cancer 2000, 85 (2),

176-181.

(38) Zhang, S.; Li, Z.; Wu, X.; Huang, Q.; Shen, H. M.; Ong, C. N. Methyl-3-indolylacetate inhibits cancer cell invasion by targeting the MEK1/2-ERK1/2 signaling pathway. Mol. Cancer Ther. 2006,

5(12), 3285-3293.

(39) Chung, T. W.; Lee, Y. C.; Kim, C. H. Hepatitis B viral HBx induces matrix metalloproteinase-9 gene expression through activation of ERK and PI-3K/AKT pathways: involvement of invasive potential.

FASEB J. 2004, 18 (10), 1123-1125.

(40) Chakraborti, S.; Mandal, M.; Das, S.; Mandal, A.; Chakraborti, T. Regulation of matrix metalloproteinases: an overview. Mol. Cell.

Biochem. 2003, 253 (1-2), 269-285.

(41) Simon, C.; Simon, M.; Vucelic, G.; Hicks, M. J.; Plinkert, P. K.; Koitschev, A.; Zenner, H. P. The p38 SAPK pathway regulates the expression of the MMP-9 collagenase via AP-1-dependent promoter

(8)

(42) Carpenter, C. L.; Cantley, L. C. Phosphoinositide kinases. Curr.

Opin. Cell Biol 1996, 8 (2), 153-158.

(43) Woo, J. H.; Lim, J. H.; Kim, Y. H.; Suh, S. I.; Min, D. S.; Chang, J. S.; Lee, Y. H.; Park, J. W.; Kwon, T. K. Resveratrol inhibits phorbol myristate acetate-induced matrix metalloproteinase-9 expression by inhibiting JNK and PKC delta signal transduction.

Oncogene 2004, 23 (10), 1845-1853.

(44) Andreasen, P. A.; Kjoller, L.; Christensen, L.; Duffy, M. J. The urokinase-type plasminogen activator system in cancer metastasis:

a review. Int. J. Cancer 1997, 72 (1), 1-22.

(45) Kwaan, H. C. The plasminogen-plasmin system in malignancy.

Cancer Metastasis Rev. 1992, 11 (3-4), 291-311.

(46) Duffy, M. J.; Maguire, T. M.; McDermott, E. W.; O’Higgins, N. Urokinase plasminogen activator: a prognostic marker in multiple

types of cancer. J. Surg. Oncol. 1999, 71 (2), 130-135.

Received for review June 21, 2010. Revised manuscript received August 31, 2010. Accepted September 5, 2010. This work was supported by Grant CMU98-ASIA-10 from China Medical University, Taichung, Taiwan.

數據

Table 1. The DNA Sequence Was Evaluated Using the Primer Expression a
Figure 2. Effect of PEITC on migration and invasion of HT29 cells. HT29 cells were treated with various concentrations (0, 0.01, and 0.25 μM) of PEITC for 24 and 48 h
Figure 3. Effects of PEITC on the protein levels of associated proteins for migration and invasion in HT29 cells
Figure 5. Effects of PEITC on AKT, ERK, JNK and PKC activities. AKT, ERK, JNK and PKC substrates (Crosstide, MBP, ATF2 and Histone H1 þ Lipid Activator, respectively) in Base Reaction Buffer (20 mM Hepes (pH 7.5), 10 mM MgCl 2 , 1 mM EGTA, 0.02% Brij35, 0.

參考文獻

相關文件

-- the tumor odontogenic epithelial cells usually formed small nests and thin strands that were positive for keratin and AE1 plus AE3. -- 5 cases showed mild to moderate

Giant cells are also seen in other diseases like giant cell granuloma of the jaws, traumatic bone cyst, aneurysmal bone cyst, and jaw tumor of

Our case highlights an enigmatic presentation of oral submucous fibrosis and its coexistence with oral cancer presenting with unusual neurological disturbance of the inferior

 Stain (-) because the main body of the tumor consisted of epithelioid or epithelial cells that contained few positive smooth muscle cells.  No clear ductal structures or

The strong immunoreactivity of pAKT and PI3K in some variants of ameloblastoma, especially the plexiform histological pattern, suggests that AKT/PI3K pathway may be

Additionally, we review the literature for cases of benign glomus tumor in the oral regions and offer data on the clinical and histopathologic features of this rare tumor.. CASE

Primordial odontogenic tumor (POT) is a benign mixed odontogenic tumor comprised of a loose connective tissue with a similar morphology with dental papilla and exhibiting in

Although DOI, based on its prognostic value on overall disease outcomes, has been incorporated into the current AJCC staging system such that it upstages an OTSCC from T1 to T2 stage