Antitumor effects of emodin on LS1034 human colon cancer cells in vitro and in vivo: Roles of apoptotic cell death and LS1034 tumor xenografts model.

(1)

Antitumor effects of emodin on LS1034 human colon cancer cells in vitro and

in vivo: Roles of apoptotic cell death and LS1034 tumor xenografts model

Yi-Shih Ma

a,b

_{, Shu-Wen Weng}

a,c

_{, Meng-Wei Lin}

d

_{, Chi-Cheng Lu}

e

_{, Jo-Hua Chiang}

e

_{, Jai-Sing Yang}

f

Kuang-Chi Lai

g,h

, Jing-Pin Lin

i

, Nou-Ying Tang

i

, Jaung-Geng Lin

a,

⇑

, Jing-Gung Chung

d,i,

⇑

a

Graduate Institute of Chinese Medicine, China Medical University, Taichung 404, Taiwan

b_{Department of Chinese Medicine, Changhua Hospital, Department of Health, Executive Yuan, Changhua 513, Taiwan} c

Department of Chinese Medicine, Taichung Hospital, Department of Health, Executive Yuan, Taichung 403, Taiwan

d

Department of Biological Science and Technology, China Medical University, Taichung 404, Taiwan

e

Department of Life Sciences, National Chung Hsing University, Taichung 402, Taiwan

f

Department of Pharmacology, China Medical University, Taichung 404, Taiwan

g

School of Medicine, China Medical University, Taichung 404, Taiwan

h_{Department of Surgery, China Medical University Beigang Hospital, Yunlin 651, Taiwan} i_{Department of Biotechnology, Asia University, Taichung 413, Taiwan}

a r t i c l e

i n f o

Article history:

Received 26 August 2011 Accepted 24 January 2012 Available online 1 February 2012 Keywords:

Emodin

Human colon cancer LS1034 cells Apoptosis

Caspases activation Xenograft tumor

a b s t r a c t

Emodin, an active natural anthraquinone derivative, is found in the roots and rhizomes of numerous Chi-nese medicinal herbs and exhibits anticancer effects on many types of human cancer cell lines. The aim of this study investigated that emodin induced apoptosis of human colon cancer cells (LS1034) in vitro and inhibited tumor nude mice xenografts bearing LS1034 in vivo. In in vitro study, emodin induced cell mor-phological changes, decreased the percentage of viability, induced G2/M phase arrest and increased ROS and Ca2+_{productions as well as loss of mitochondrial membrane potential (}

_DW

m) in LS1034 cells. Emodin-triggered apoptosis was also conﬁrmed by DAPI staining and these effects are concentration-dependent. Western blot analysis indicated that the protein levels of cytochrome c, caspase-9 and the ratio of Bax/Bcl-2 were increased in LS1034 cells after emodin exposure. Emodin induced the productions of ROS and Ca2+_{release, and altered anti- and pro-apoptotic proteins, leading to mitochondrial} dysfunc-tion and activadysfunc-tions of caspase-9 and caspase-3 for causing cell apoptosis. In in vivo study, emodin effectively suppressed tumor growth in tumor nude mice xenografts bearing LS1034. Overall, the potent in vitro and in vivo antitumor activities of emodin suggest that it might be developed for treatment of colon cancer in the future.

1. Introduction

Cancer is the major cause of death worldwide (

Benson, 2007;

Slattery et al., 1998

). In Taiwan, based on the reports in 2009 from

the Department of Health, ROC (Taiwan) indicated that 19.6

individuals per 100,000 die annually from colorectal cancer. For

males and females, colon/rectum is the third leading sites among

all the primary sites in Taiwan. Numerous evidences have been

shown that colon cancer is largely associated with high-fat diet

and causatively linked to the increased production of colonic bile

acids (

Chiu et al., 2003; Imray et al., 1992; Markowitz et al.,

2002

). The current treatment modalities are inadequate; therefore,

the best strategy for chemotherapeutic agents is largely dependent

on their ability to trigger cell programmed death (apoptosis) in

tu-mor cells; therefore, novel inducers of apoptosis provide a new

therapeutic approach for anti-cancer design.

It is well known that apoptosis is a highly regulated molecular

mechanism for leading cells undergo programmed cell death and

through the extrinsic and the intrinsic pathways (

Degterev et al.,

2003; Ziegler and Kung, 2008

), and endoplasmic reticulum (ER)

stress (

Nakagawa and Yuan, 2000

). The extrinsic pathway is

Abbreviations: DWm, mitochondrial membrane potential; AIF,

apoptosis-induc-ing factor; Bax, Bcl-2-associated X protein; Bcl-2, B-cell lymphoma 2; DAPI, 4,6-diamidino-2-phenylindole dihydrochloride; DMSO, dimethyl sulfoxide; Endo G, endonuclease G; DCFH-DA, 20_,70_{-dichloroﬂuorescin diacetate; PI, propidium iodide.}

⇑

Corresponding authors. Address: Graduate Institute of Chinese Medicine, China Medical University, No. 91, Hsueh-Shih Road, Taichung 40402, Taiwan. Tel.: +886 422053366x3311; fax: +886 22035192 (J.-G. Lin); Department of Biological Science and Technology, China Medical University, No. 91, Hsueh-Shih Road, Taichung 40402, Taiwan. Tel.: +886 422053366x2161; fax: +886 422053764 (J.G. Chung).

E-mail addresses:[email protected](J.-G. Lin),[email protected] (J.-G. Chung).

Contents lists available at

SciVerse ScienceDirect

Food and Chemical Toxicology

(2)

triggered by the interaction between speciﬁc ligands and surface

receptors of cells (

Klein et al., 2005

), the intrinsic pathway is

trig-gered by various stimuli (DNA damage, cellular distress, hypoxia

and cytotoxic agents), which act inside the cell (

Degterev et al.,

2003

).

Emodin (1,3,8-trihydroxy-6-methyl-anthraquinone), one of

ma-jor anthraquinone isolated from the root of Rheum palmatum L., has

been shown present pharmacological function including

anti-inﬂammatory (

Chang et al., 1996

), hepatoprotective (

Ding et al.,

2008

), and anticancer activity (

Yim et al., 1999

). In anticancer

func-tion, numerous studies have indicated that emodin inhibits cell

growth in many types of human cancer cell lines (

Chen et al.,

2002; Jing et al., 2002; Lai et al., 2009; Shieh et al., 2004; Srinivas

et al., 2003; Zhang et al., 1998

). Emodin has been demonstrated

to regulate many gene expression associated with cell proliferation,

cell apoptosis, oncogenesis, DNA repair and cancer cell invasion and

metastasis (

Cha et al., 2005; Huang et al., 2006; Kwak et al., 2006;

Lu et al., 2009; Muto et al., 2007; Shieh et al., 2004

). Emodin is a

strong reactive oxygen species-producing agent (

Jing et al., 2006

)

and induction of DNA damage (

Wang et al., 2006

). Our previous

studies also showed that emodin affected the expression of

cyto-kines and functions of leukocytes from Sprague–Dawley rats (

Yu

et al., 2006

), and it induced apoptosis of human tongue squamous

cancer SCC-4 cells through reactive oxygen species and

mitochon-dria-dependent pathways (

Lin et al., 2009

). We also found that

emodin has cytotoxic and protective effects in rat C6 glioma cells

through the inductions of Mdr1a and nuclear factor kappa B

expres-sion (

Kuo et al., 2009

). There is no available information to show

emodin induced apoptosis in human colon cancer cells in vitro

and in vivo. Therefore, in the present study, we investigated the

effects of emodin on the LS1034 human colon cancer cells in vitro

and in vivo. Results indicated that emodin induced apoptosis in

LS1034 cells in vitro and suppressed tumor nude mice xenografts

bearing LS1034 in vivo.

2. Materials and methods 2.1. Chemicals and reagents

Emodin, propidium iodide (PI), Triton X-100, dimethyl sulfoxide (DMSO), N-ace-tylcysteine (NAC) and trypan blue were obtained from Sigma–Aldrich Corp. (St. Louis, MO, USA). RPMI 1640 medium, fetal bovine serum (FBS),L-glutamine penicil-lin-strptomycin and Trypsin–EDTA were obtained from Gibco/Life Technologies (Carlsbad, California, USA). Caspase-3, -8, -9 activity assay kits were bought from OncoImmunin, Inc. (Gaithersburg, MD, USA). Caspase-3 inhibitor (Z-DEVD-FMK) and caspase-9 inhibitor (Z-LEHD-FMK) were purchased from R&D systems (Minne-apolis, MN, USA). The antibodies for caspase-9 and cytochrome c were purchased from Cell Signaling Technology (Irvine, CA, USA) and these for Bax, Bcl-2, AIF, b-ac-tin and complex IV were obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Secondary antibodies conjugated with horseradish peroxidase (HRP) were bought from GE Healthcare (Piscataway, NJ, USA).

2.2. Cell culture

The human colon adenocarcinoma cell line (LS1034) was obtained from the Food Industry Research and Development Institute (Hsinchu, Taiwan). Cells were placed into 75 cm2

tissue culture ﬂasks and grown at 37 °C under a humidiﬁed 5% CO2atmosphere in RPMI 1640 medium with 2 mM L-glutamine, 10% FBS, 100 Units/ml penicillin and 100

l

mg/ml streptomycin.

2.3. In vitro anticancer efﬁcacy study

2.3.1. Cell morphological changes and viability of LS1034 cells by ﬂow cytometry LS1034 cells were seeded in 12-well plates at a density of 2 105_{cells/well for}

24 h. Cells were treated with various concentrations (0, 5, 10, 20, 30 and 50

l

M) of emodin, while only adding 1% DMSO (solvent) for the control regimen and grown at 37 °C, 5% CO2and 95% air for 24 or 48 h. For morphological changes examination,

cells after emodin treatment were examined and photographed under a phase con-trast microscope at 200 magniﬁcation. For cell viability, cells were harvested, washed twice with phosphate-buffered saline (PBS), and re-suspended in PBS con-taining PI (5

l

g/ml) as described elsewhere (Chiang et al., 2011; Lu et al., 2010). Cells were then determined the percentage of viability by a PI exclusion method

and analyzed with a ﬂow cytometer (Becton–Dickinson, FACSCalibur, San Jose, CA, USA) equipped with an argon ion laser for excitation at 488 nm wavelength as cited previously (Lu et al., 2010). Also, cells were pretreated with a ROS scavenger (NAC, 10 mM) for 2 h and then exposed to emodin for 24 h (Lu et al., 2010). After treatment, cells were collected and measured the viability as described above. 2.3.2. Determinations for DNA content and sub-G1 (apoptotic cells) populations

Approximately 2 105

cells/well of LS1034 cells in 12-well plates with 0, 10, 20, 30, 40 and 50

l

M of emodin were incubated for 24 and 48 h. The cells were trypanized then harvested by centrifugation, washed with PBS and then were ﬁxed in 70% ethanol at 20 °C overnight. Cells then were re-suspended in PBS containing 40

l

g/ml PI and 0.1 mg/ml RNase A and 0.1% Triton X-100 in a dark room for 30 min at 37 °C, and analyzed by ﬂow cytometry. Then the cell cycle distribution and sub-G1 group (apoptosis) were determined as described previously (Huang et al., 2009). 2.3.3. DAPI (4,6-diamidino-2-phenylindole dihydrochloride) staining for apoptotic cells

LS1034 cells at a density of 1 105

cells/well were plated in 6-well plates for 24 h and exposed to emodin (0, 10, 20, 30, 40 and 50

l

M) for 24 h before cells from each treatment were isolated for DAPI staining as described previously (Chiang et al., 2011; Lu et al., 2010). After staining, the cells were examined and photo-graphed by using a ﬂuorescence microscope.

2.3.4. Measurements of intracellular reactive oxygen species (ROS), the levels of mitochondrial membrane potential (DWm) and Ca2+generation by ﬂow cytometry

Approximately 2 105

cells/well of LS1034 cells were placed in 12-well plates and then were treated with or without 30

l

M emodin for 1, 3, 6 12 or 24 h to mea-sure the changes of ROS, DWmand Ca2+levels. The cells were harvested, and then

were re-suspended in 500

l

l of DCFH-DA (Molecular Probes/Life Technologies, Eu-gene, OR, USA) (10

l

M) for ROS, 500

l

l of rhodamine 123 (1

l

g/ml) (Molecular Probes) for DWm and 500

l

l for Fluo-3/AM (2.5

l

g /ml, Molecular Probes) for

Ca2+_{. Cells then were incubated at 37 °C for 30 min and analyzed by ﬂow cytometry}

as previously described (Chiang et al., 2011; Ferlini and Scambia, 2007; Huang et al., 2009; Lu et al., 2010).

2.3.5. Caspase-3 and -9 activities were assayed by ﬂow cytometry and speciﬁc caspase inhibitors pretreatment

Approximately 2 105

cells/well of LS1034 cells seeded in 12-well plates after pretreatment with or without both of the caspase-3 inhibitor (Z-DEVD-FMK) and caspase-9 inhibitor (Z-LEHD-FMK) for 2 h were incubated with emodin at the ﬁnal concentration of 30

l

M for 0, 24 and 48 h. At the end of incubation, all cells from each treatment were trypsinized and then were centrifuged, collected and washed twice with PBS. All samples were re-suspended in 50

l

l of 10

l

M substrate solution (PhiPhiLux-G1D1for caspase-3 and CaspaLux9-M1D2for caspase-9) (OncoImmunin,

Inc.) before being incubated at 37 °C for 60 min. All samples were washed twice by PBS and analyzed by ﬂow cytometry as previously described (Chiang et al., 2011; Huang et al., 2009). Cell viability was determined in emodin-treated LS1034 cells before exposure to both speciﬁc inhibitors as described elsewhere (Lu et al., 2010). 2.3.6. Protein preparation and Western blotting for examinations of the protein levels associated with apoptosis of LS1034 cells

Approximately 5 105

cells/well of LS1034 cells were placed in 12-well plates and then were exposed to 30

l

M emodin for 0, 6, 12, 18 or 24 h. At the end of incu-bation, cells were trypanized, harvested and were lysed in the PRO-PREPTM

protein extraction solution (iNtRON Biotechnology, Seongnam, Gyeonggi-Do, Korea). For protein determination of each sample, the cell lysates (40

l

g of each) were sepa-rated by SDS–PAGE on a polyacrylamide gel followed by electrotransfer onto a PVDF membrane (Immobilon-P; Millipore, Bedford, MA, USA). The blots were then incu-bated with primary antibodies (1:1000 dilutions in blocking buffer) overnight at 4 °C. After being washed, secondary antibodies-conjugated with horseradish perox-idase (HRP) were applied at a dilution of 1:20,000 in blocking buffer for 1 h at room temperature. HRP-conjugated goat anti-rabbit or anti-mouse IgG (GE Healthcare, Piscataway, NJ, USA) was used as a secondary antibody for enhanced chemilumi-nescence (ECL Kit, Millipore, Billerica, MA, USA) as described previously (Huang et al., 2009; Wu et al., 2010). The protein levels of cytosolic and mitochondrial cyto-chrome c were carried out according to the manufacturer’s protocol (Mitochondria/ Cytosol Fractionation Kit, BioVision, Inc., Mountain View, CA, USA). Western blot-ting for examining the effects of emodin on the levels of Bax, Bcl-2, AIF, caspase-9, cytochrome c, b-actin and Complex IV were performed for emodin-treated LS1034 cells in vitro (Chiang et al., 2011; Yang et al., 2009). Relative abundance of each band was measured and evaluated by NIH ImageJ software.

2.3.7. RNA preparation and real-time polymerase chain reaction (PCR) Approximately 1 106

cells/well of LS1034 cells were seeded in 6-well plates, and then were treated with 30

l

M emodin for 24 and 48 h. At the end of incubation, cells were trypanized, harvested and washed twice with PBS. The total RNA from each treatment was extracted from the LS1034 cells after co-treatment with 30

l

M emodin for 24 and 48 h by using a Qiagen Neasy Mini Kit (Qiagen, Inc., Valencia, CA, USA) as described previously (Chiang et al., 2011; Yu et al., 2011). High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA)

(3)

was used for reverse transcription at 42 °C with 30 min and then add SYBR Green PCR Master Mix was added, Finally, Applied Biosystems 7300 Real-Time PCR system was performed to analyze the products by CTmethod (Ji et al., 2009). The DNA

se-quence of primers evaluated by using the Primer Express Software was described in Table 1.

2.4. In vivo antitumor efﬁcacy study 2.4.1. BALB/c nu/nu mice

Thirty male athymic BALB/c nu/nu mice at the age of 6–8 weeks were obtained from the National Laboratory Animal Center (Taipei, Taiwan) and the animals were maintained in the Laboratory Animal Center of China Medical University and taken care as the institutional guidelines (Afﬁdavit of Approval of Animal Use Protocol, No. 97-25-N) of Institutional Animal Care and Use Committee (IACUC) of China Medical University (Taichung, Taiwan).

2.4.2. Animals’ treatment The LS1034 cells (6 106

cells/mouse) were subcutaneously injected into the ﬂanks of BALB/c nu/nu mice. After tumor cell inoculation, the tumor size from each animal was measured using calipers every 3 days and calculated as previously re-ports as V = L W2_{/2 (where V is the volume, L is the length and W is the width)}

with the ﬁnal measurement taken for 39 days. When the tumor volume in each ani-mal was close to 200 mm3

, then emodin treatment was started. Animals in each group were intraperitoneally injected with vehicle (1% DMSO) only, ﬂuorouracil (5-FU) and emodin, respectively, once every 3 days at the volume of 50

l

l. The whole experimental protocol was summarized inFig. 7A. These animals with tu-mors were randomly divided into 3 groups. Each group contains 10 animals. Group I is the control group that was treated with vehicle (1% DMSO) only. Group II: each animal was treated with 5-FU (33 mg/kg) (Cusack et al., 2006). Group III: each ani-mal was treated with emodin (40 mg/kg) (Cha et al., 2005; Chun-Guang et al., 2010; Huang et al., 2008). At the end of the experiment (39th day after cell inoculation), all animals from each group were anaesthetized by CO2and sacriﬁced. Tumors from

each mouse were removed, measured and weighed individually as described previ-ously (Ho et al., 2009; Su et al., 2010). Relative tumor weight (g) and inhibition rate (%) were calculated and data are expressed as mean ± S.D. (n = 10).

2.5. Statistical analysis

The difference between the emodin-treated and control groups were analyzed by Student’s t-test, a probability of p < 0.05 being considered signiﬁcant. In-vivo study, data are presented the mean ± SD (n = 10) and a value of p less than 0.05 indi-cates signiﬁcantly different between the treated groups and analyzed by using one-way ANOVA followed by Dunnett’s test.

3. Results

3.1. In vitro antitumor efﬁcacy study

3.1.1. Effects of emodin on cell morphological changes and viability in

LS1034 cells

Increasing the concentration of emodin and/or time of

incuba-tion led to increase the cell morphological changes, including cell

shrinkage and blebbing (

Fig. 1

A) after 24-h exposure and to

de-crease the percentage of viable cells (

Fig. 1

B) for 24 and 48 h.

Treat-ment of emodin led to more cell changed the morphology and also

ﬂoated on the well compared to the control. Emodin at 50

l

M

sig-niﬁcantly decreased by almost 80% the viable cells and the 50% of

the viable cells were detected by the treatment of 30

l

M emodin

with 48-h incubation (

Fig. 1B).

3.1.2. Effects of emodin on cell cycle arrest and apoptosis in LS1034

cells

The results from ﬂow cytometric analysis shown in

Fig. 2

A and

B indicated that LS1034 cells after treatment with various

concen-trations of emodin for 24 or 48 h increased the percentage of cells

in G0/G1 by concentration-dependent (

Fig. 2

A and B) that

indi-cated that emodin induced G0/G1 phase arrest. Moreover, the

sub-G1 group (apoptosis) also appeared in the DNA content.

Fig. 2

A and B showed that when the concentration of emodin up

to 30

l

M caused about 30% apoptosis for a 48-h exposure which

is the highest apoptosis occur in examined concentrations in

LS1034 cells.

3.1.3. Effects of emodin on chromatin condensation and apoptosis in

LS1034 cells

In order to further conﬁrmed the induction of apoptosis by

emodin in LS1034 cells, it was performed by ﬂow cytometry and

ﬂuorescence photomicrographs of LS1034 cells stained with PI

and DAPI, respectively, after treatment with 10–50

l

M of emodin

for 24 h. Results indicated that emodin at 20–50

l

M induced a

sig-niﬁcant increase of sub-G1 population (apoptosis) (

Fig. 3

C) and

condensations of nucleus (a characteristics of apoptosis) (

Fig. 3

D

and E) in LS1034 cells and this effect is a concentration-dependent

manner.

3.1.4. Effects of emodin on the levels of ROS,

DW

m

and Ca

2+

in LS1034

cells

It is well known that ROS production in cells may contribute to

mitochondrial damage that may facilitate the further release of

ROS into the cytoplasm (

Lee et al., 2001

). Investigating the

possibil-ity that the emodin-induced apoptosis in LS1034 cells could be

re-lated to contributions from the mitochondrial pathway, cells were

treated with 30

l

M emodin for the indicated periods of time. The

results shown in

Fig. 3

A–C indicated that emodin treatment

in-duced signiﬁcant productions of ROS (

Fig. 3

A) and Ca

2+

(

Fig. 3

C)

re-lease, and disruption of

DW

m (

Fig. 3

B) in LS1034 cells. As shown in

Fig. 3

C, both speciﬁc inhibitors signiﬁcantly increased the cell

via-bility in comparison to emodin treatment alone LS1034 cells.

3.1.5. Effects of emodin on the activities of caspase-3 and -9 of LS1034

cells

To evaluate the effects of emodin on the activities of caspase-3

and -9 in LS1034 cells, we used ﬂow cytometric analysis to

deter-mine the caspase activity in emodin-treated LS1034 cells. The

re-sults as can be seen in

Fig. 4

A indicated that emodin signiﬁcantly

promoted caspase-3 and -9 activities in a time-dependent manner

in LS1304 cells. To investigate if emodin induces cell death through

the intrinsic apoptotic signaling, cells were pretreated individually

with inhibitors of caspase-3 DEVD-FMK) and caspase-9

(Z-LEHD-FMK) before 30

l

M emodin for a 24-h treatment.

Fig. 4

B

indicates that both speciﬁc inhibitors signiﬁcantly increased the

cell viability in comparison to emodin treatment alone LS1034

cells.

3.1.6. Western blotting for examining the levels of proteins associated

with apoptosis in LS1034 cells

To conﬁrm that the effect of emodin induced cell death in

LS1034 cells as noted in ﬂow cytometric assays was due to

apopto-sis, LS1034 cells were cultured for 0, 6, 12, 24, and 48 h with or

without 30

l

M emodin treatment. Cells were harvested from each

treatment and then were lysed and total proteins from each

sam-ple were prepared for Western blotting analysis for

apoptosis-associated proteins expression. The results from Western blots

are shown in

Fig. 5

A and B and indicated that the levels of Bax,

caspase-9, cytosolic cytochrome c and AIF were increased and

Table 1

The DNA sequence was evaluated using the Primer Express software in LS1034 cells after emodin for 24 and 48-h exposure.

Primer name Primer sequence Homo caspase-3-F CAGTGGAGGCCGACTTCTTG Homo caspase-3-R TGGCACAAAGCGACTGGAT Homo caspase-9-F TGTCCTACTCTACTTTCCCAGGTTTT Homo caspase-9-R GTGAGCCCACTGCTCAAAGAT Homo GAPDH-F ACACCCACTCCTCCACCTTT Homo GAPDH-R TAGCCAAATTCGTTGTCATACC Casapse, cysteine aspartate-speciﬁc protease; glyceraldehydes-3-phosphate dehy-drogenase. Each assay was conducted at least triplicate to ensure reproducibility.

(4)

the level of Bcl-2 was decreased, which led to cell apoptosis in

emodin-treated LS1034 cells.

3.1.7. Effects of emodin on the mRNA expressions of caspase-3 and -9

in LS1034 cells

After 30

l

M emodin treatment in LS1034 cells for 0, 24 and

48-h incubation, cells were collected and total RNA from eac48-h sample

were isolated and then real-time PCR was used for gene expression

of the mRNA levels of 3 and -9. The gene levels of

caspase-3 and caspase-9 elevated at 24- and 48-h exposure when compared

with the control sample as can be seen in

Fig. 6

.

3.1.8. In vivo antitumor efﬁcacy study

The results from in vitro experiments indicated that emodin

in-duced cytotoxic effects in LS1034 cells through the G0/G1 phase

ar-rest and induction of apoptosis. Herein, we investigated whether or

not emodin affected the xenografts colon tumor in vivo. Thus, we

further examined the effects of emodin on in vivo tumor growth

for 39 days in a LS1034 tumor xenograft model in vivo. Mice after

exposure to 5-FU (33 mg/kg) were acted as a positive control. Tumor

size in the vehicle control group increased four folds over a period of

5 weeks when compared to the 15th day after cell inoculation.

Emo-din (40 mg/kg) treatment once every 3 days resulted in a decrease of

tumor weight (

Fig. 7

C) and tumor volume (

Fig. 7

D), and respective

Fig. 1. Emodin induced cells’ morphological changes and decreased the total viable LS1034 human colon cancer cells. Cells were incubated with or without 0, 10, 20, 30, and 50

l

M of emodin for 24 h or 48 h, and then were examined and photographed by a phase-contrast microscope (A) and were harvested for deter-mination the percentage of viable cells by ﬂow cytometry (B) as described in Section 2. Data represents mean ± S.D. of three experiments.⁄

p < 0.05 was signif-icantly different from the control sample (0

l

M emodin).

Fig. 2. Emodin changed the DNA content and induced apoptosis in LS1034 cells. Cells were incubated with or without 0, 10, 20, 30, 40 or 50

l

M of emodin for 24 and 48 h, and then were harvested for determination the distribution of cell cycle for 24 h-treatment (A), sub-G1 phase (apoptosis) (B) and DNA content of apoptotic in emodin-treated LS1034 cells for 48-h exposure (C) by ﬂow cytometry. DAPI staining (D) and quantitied results (E) were expressed as described in Section 2. Data represents mean ± S.D. of three experiments. ⁄p < 0.05 shows signiﬁcantly different from the control sample (0

l

M emodin).

(5)

solid tumor (

Fig. 7

A) in comparison to the control group. The

inhibi-tion rate of LS10345 xenografts tumor was shown that 46% T/C (the

treated-group (T) over control (C) tumor volume ratio 100%)

(

Table 2

) when compared with the control group.

4. Discussion

Emodin has been isolated from various Chinese medicinal

plants such as Rheum palmatum L. and it has been shown to present

biological function including anticancer activities in many human

cancer cells. In the present investigation, we observed that emodin

inhibited the growth of human colon cancer cells (LS1034) in vitro

through the G0/G1 phase arrest and induction of apoptosis. The

molecular mechanism of emodin induced cell apoptosis through

the increase the ROS and Ca

2+

_{production and induced}

mitochon-drial dysfunction (loss of the

DW

m

level) which also caused by

the changes of ratio of Bxa/Bcl-2. Furthermore, in the present

stud-ies, we also found that emodin inhibited the LS1034 tumor

xeno-graft mice in vivo.

Herein, we found that emodin induced cell morphological

changes and decreased the percentage of viable LS1034 cells and

these effects are a concentration-dependent manner (

Fig. 1

A and

B) which is in agreement with other reports showed that emodin

induced cytotoxic effects in human prostate cancer LNCaP cells

(

Yu et al., 2008

). Results from ﬂow cytometric assay also showed

that emodin promoted G0/G1 phase arrest and induced sub-G1

phase in cell cycle distribution of LS1034 cells (

Fig. 2

A and B)

which is in agreement with previous report addressing anticancer

effects in human prostate cancer cells (

Yu et al., 2008

).

It is well documented that apoptosis is a programmed and

phys-iological mode of cell death. The characters of apoptosis including

cell morphological change and extensive DNA fragmentation and

apoptotic body, which are triggered by apoptosis-inducing signal

and the frequency and time of appearance of which depend on

the cell line (

Arends et al., 1990; Bortner et al., 1995

). If the cells

did not go through apoptosis which may promote survival and

accumulation of cells to form tumor (

Hoeppner et al., 1996

).

There-fore, it was suggested that apoptosis has become a target for

elim-inating cancer cells (

Hong and Sporn, 1997; Kelloff et al., 2000

). To

examine the effects of emodin on apoptosis in LS1034 colon cancer

cells in vitro, ﬂow cytometric assay and DAPI staining were used to

study the sub-G1 phase of cell cycle, morphological changes and

DNA condensation, respectively (

Fig. 2

C and D). Our results indicate

Fig. 3. Emodin affected the levels of productions of reactive oxygen species (ROS), mitochondrial membrane potential (DWm) and Ca2+in LS1034 cells. Cells were treated with

30

l

M emodin for various time periods (1, 3, 6, 12 or 24 h), and then were collected. Cells were stained with DCFH-DA for ROS production (A), rhodamine 123 for the DWm

level (B) and Fluo-3/AM for Ca2+

level (C) and determined by ﬂow cytometry as described in Section 2.⁄

p < 0.05, signiﬁcantly different between control and emodin-treated groups.

(6)

that emodin induced LS1034 cell apoptosis, in good agreement with

the DAPI staining results showing apoptosis in human prostate

can-cer cells treated with emodin (

Yu et al., 2008

). Results from DAPI

staining (

Fig. 2

D and E) showed that the nuclear morphology

chan-ged dramatically after emodin treatment. These observations

indi-cated that the nuclear morphology change s and DNA damages

occurred in the cell apoptotic process of LS1034 cells. Alternatively,

we found that emodin induced production of ROS for causing cell

apoptosis in LS1034 cells (

Fig. 3

A). N-acetylcysteine (NAC, a ROS

scavenger) can decrease emodin-induced cell death when

com-pared with emodin-treated cells alone (

Fig. 4

C) and this result is

in agreement with several other reports (

Chang et al., 2011; Su

et al., 2005; Wang et al., 2011

).

It is reported that apoptosis can be divided into

mitochondria-dependent and -inmitochondria-dependent pathways. Furthermore, it was

re-ported that if the loss of the outer mitochondrial membrane integrity

and the release of cytochrome c from the mitochondria to the cytosol

of cells after exposed stimulator then the cells are committed to

apoptosis (

Di Giovanni et al., 2001; Lee et al., 2001

). In the present

study, our results already showed that emodin decreased the levels

Fig. 4. Emodin stimulated caspase-3, -8 and -9 activities and altered viability after pre-incubation with speciﬁc inhibitors in LS1034 cells. (A) Cells were treated with 30

l

M emodin for 24 and 48 h, and then were collected for determining activities of caspase-3 and -9 by using PhiPhiLux™-G1D2 and CaspaLux™9-M1D2 Kits

(OncoImmunin, Inc.) as described in Section 2. (B) Cells were incubated with 30

l

M emodin for 24 h before exposure in presence and absence of the speciﬁc inhibitors of caspase-3 (Z-DEVD-FMK) and caspase-9 (Z-LEHD-FMK) for 2 h to measure the viability in LS1034 cells. Data represents mean ± S.D. of three experiments. ⁄

p < 0.05 shows signiﬁcant difference compared with the control group.

Fig. 5. Emodin affected the apoptosis-associated protein levels on LS1034 cells. Cells were incubated with or without 30

l

M emodin for 0, 6, 12, 24 and 48 h, and the cells were collected for Western blotting as described in Section 2. (A) The protein levels of Bax, Bcl-2, AIF and caspase-9 were shown and (B) the fractionate cytosolic (top) and mitochondrial (bottom) cellular cytochrome c protein were performed. The use of b-actin and complex IV are as an internal control, respectively.

Fig. 6. Emodin enhanced the mRNA gene expression of caspase-3 and -9 in LS1034 cells. Cells were treated with or without 30

l

M emodin for 24 and 48 h, and then cells were harvested for isolation of total RNA then for real-time PCR to examine the gene expression of caspase-3 and -9 as described in Materials and Methods. Data represents mean ± S.D. of three experiments. ⁄

p < 0.05 and ⁄⁄⁄

p < 0.001 were considered signiﬁcant when compared with the control sample.

Table 2

Representative LS1034 xenograft tumor weight and rate of inhibition (%) after intraperitoneal injected with emodin and 5-FU.

Treatment dosage Tumor weight (g) Inhibition rate (%) 5-FU 33 mg/kg 0.51 ± 0.026 46.47

Control 0.95 ± 0.126 –

(7)

of

DW

m

of LS1034 cells (

Fig. 3

B) and this effect is time-dependent.

Alternatively, the activities of caspase-3 and -9 (

Fig. 4

A) were

stim-ulated, and the gene expression levels of caspase-3 and caspase-9

(

Fig. 6

) were also promoted in emodin-treated LS1034 cells. We

also used caspase-3 and -9 speciﬁc inhibitors (Z-DEVD-FMK and

Z-LEHD-FMK, respectively) to conﬁrm this signaling in this

investi-gation (

Fig. 4

B). However, emodin did not affect gene expression

level of caspse-8 in LS1034 cells (data not shown). Thus, we suggest

that emodin-induced apoptosis in LS1034 cells may be mediated

through a mitochondria-dependent pathway.

In order to investigate the possible molecular signal pathway of

apoptosis in LS1034 cells after exposure to emodin, Western

blot-ting analysis was used for examining the apoptotic protein levels,

which indicated that anti-apoptotic Bcl-2 signiﬁcantly decrease

in comparison to control cells (p < 0.05) and pro-apoptotic Bax

was

signiﬁcantly

increase

in comparison

to

control cells

(p < 0.05) (

Fig. 5

A) which led to the decrease the ratio of

Bax/Bcl-2 then caused mitochondrial dysfunction then induced apoptosis.

It was reported that Bax/Bcl-2 ratio indicates whether and how a

cell will respond to an apoptotic signal (

Yang et al., 2010

). Our

re-sults showed that the Bcl-2/Bax ratio therefore decreased with

increasing emodin concentration. This decrease may contribute

to the activation of caspase-3 and induction of apoptosis via the

mitochondrial apoptosis pathway.

The results from the in vivo experiment (LS1034 tumor

xeno-graft mice model) showed that the tumor grew faster in DMSO

control group; however, slower in 5-FU and emodin-treated

groups. Both the tumor volumes and weights in the 5-FU and

emo-din-treated groups were signiﬁcantly smaller than those in the

DMSO group following 39 days.

In conclusion, we found that emodin induced cell death through

promoting the cell cycle arrest and apoptosis in human colon

can-cer LS1034 cells in vitro and in vivo. Thus, we proposed that emodin

treatment results primarily in caspase-dependent death, a

mecha-nism eliciting much current interest with respect to its therapeutic

potential in colon cancer in the future. Furthermore, emodin

inhib-ited tumor nude mice xenografts bearing LS1034 in vivo. These

ﬁndings may aid in the understanding of the mode of actions of

the emodin and provide a theoretical basis for the therapeutic

use of this compound in further investigations.

Conﬂict of Interest

None declared.

Acknowledgements

This study is supported by the research Grant CMU97-163 from

China Medical University, Taichung, Taiwan.

References

Arends, M.J., Morris, R.G., Wyllie, A.H., 1990. Apoptosis. The role of the endonuclease. Am. J. Pathol. 136, 593–608.

Benson III, A.B., 2007. Epidemiology, disease progression, and economic burden of colorectal cancer. J. Manag. Care Pharm. 13, S5–S18.

Bortner, C.D., Oldenburg, N.B., Cidlowski, J.A., 1995. The role of DNA fragmentation in apoptosis. Trends Cell Biol. 5, 21–26.

Cha, T.L., Qiu, L., Chen, C.T., Wen, Y., Hung, M.C., 2005. Emodin down-regulates androgen receptor and inhibits prostate cancer cell growth. Cancer Res. 65, 2287–2295.

Chang, C.H., Lin, C.C., Yang, J.J., Namba, T., Hattori, M., 1996. Anti-inﬂammatory effects of emodin from ventilago leiocarpa. Am. J. Chin. Med. 24, 139–142. Chang, Y.C., Lai, T.Y., Yu, C.S., Chen, H.Y., Yang, J.S., Chueh, F.S., Lu, C.C., Chiang, J.H.,

Huang, W.W., Ma, C.Y., Chung, J.G., 2011. Emodin induces apoptotic death in murine myelomonocytic leukemia WEHI-3 cells in vitro and enhances phagocytosis in leukemia mice in vivo. Evid. Based Complement Alternat. Med. 2011, 523596.

Chen, Y.C., Shen, S.C., Lee, W.R., Hsu, F.L., Lin, H.Y., Ko, C.H., Tseng, S.W., 2002. Emodin induces apoptosis in human promyeloleukemic HL-60 cells Fig. 7. Emodin suppressed tumor nude mice xenografts bearing LS1034. (A) The

whole in vivo experimental protocol was summarized. (B) Illustration of a representative tumor after treatment with emodin and control. (C) The effect of emodin and 5-FU tumor weight and (D) the effect of emodin and 5-FU on tumor size. Data presented are the mean ± S.D. (n = 10) at 15–39 days post-tumor implantation and the groups were compared and analyzed by using one-way ANOVA followed by Dunnett’s test.⁄

(8)

accompanied by activation of caspase 3 cascade but independent of reactive oxygen species production. Biochem. Pharmacol. 64, 1713–1724.

Chiang, J.H., Yang, J.S., Ma, C.Y., Yang, M.D., Huang, H.Y., Hsia, T.C., Kuo, H.M., Wu, P.P., Lee, T.H., Chung, J.G., 2011. Danthron, an anthraquinone derivative, induces DNA damage and caspase cascades-mediated apoptosis in SNU-1 human gastric cancer cells through mitochondrial permeability transition pores and Bax-triggered pathways. Chem. Res. Toxicol. 24, 20–29.

Chiu, B.C., Ji, B.T., Dai, Q., Gridley, G., McLaughlin, J.K., Gao, Y.T., Fraumeni Jr., J.F., Chow, W.H., 2003. Dietary factors and risk of colon cancer in Shanghai, China. Cancer Epidemiol. Biomarkers Prev. 12, 201–208.

Chun-Guang, W., Jun-Qing, Y., Bei-Zhong, L., Dan-Ting, J., Chong, W., Liang, Z., Dan, Z., Yan, W., 2010. Anti-tumor activity of emodin against human chronic myelocytic leukemia K562 cell lines in vitro and in vivo. Eur. J. Pharmacol. 627, 33–41.

Cusack Jr., J.C., Liu, R., Xia, L., Chao, T.H., Pien, C., Niu, W., Palombella, V.J., Neuteboom, S.T., Palladino, M.A., 2006. NPI-0052 enhances tumoricidal response to conventional cancer therapy in a colon cancer model. Clin. Cancer Res. 12, 6758–6764.

Degterev, A., Boyce, M., Yuan, J., 2003. A decade of caspases. Oncogene 22, 8543– 8567.

Di Giovanni, S., Mirabella, M., Papacci, M., Odoardi, F., Silvestri, G., Servidei, S., 2001. Apoptosis and ROS detoxiﬁcation enzymes correlate with cytochrome c oxidase deﬁciency in mitochondrial encephalomyopathies. Mol. Cell. Neurosci. 17, 696– 705.

Ding, Y., Zhao, L., Mei, H., Zhang, S.L., Huang, Z.H., Duan, Y.Y., Ye, P., 2008. Exploration of Emodin to treat alpha-naphthylisothiocyanate-induced cholestatic hepatitis via anti-inﬂammatory pathway. Eur. J. Pharmacol. 590, 377–386.

Ferlini, C., Scambia, G., 2007. Assay for apoptosis using the mitochondrial probes, Rhodamine123 and 10-N-nonyl acridine orange. Nat. Protoc. 2, 3111–3114. Ho, Y.T., Yang, J.S., Lu, C.C., Chiang, J.H., Li, T.C., Lin, J.J., Lai, K.C., Liao, C.L., Lin, J.G.,

Chung, J.G., 2009. Berberine inhibits human tongue squamous carcinoma cancer tumor growth in a murine xenograft model. Phytomedicine 16, 887–890. Hoeppner, D.J., Hengartner, M.O., Fisher, D.E., 1996. Programmed cell death: from

development to disease. Meeting report. Biochim. Biophys. Acta 1242, 217–220. Hong, W.K., Sporn, M.B., 1997. Recent advances in chemoprevention of cancer.

Science 278, 1073–1077.

Huang, Q., Shen, H.M., Shui, G., Wenk, M.R., Ong, C.N., 2006. Emodin inhibits tumor cell adhesion through disruption of the membrane lipid Raft-associated integrin signaling pathway. Cancer Res. 66, 5807–5815.

Huang, S.P., Chen, J.C., Wu, C.C., Chen, C.T., Tang, N.Y., Ho, Y.T., Lo, C., Lin, J.P., Chung, J.G., Lin, J.G., 2009. Capsaicin-induced apoptosis in human hepatoma HepG2 cells. Anticancer Res. 29, 165–174.

Huang, X.Z., Wang, J., Huang, C., Chen, Y.Y., Shi, G.Y., Hu, Q.S., Yi, J., 2008. Emodin enhances cytotoxicity of chemotherapeutic drugs in prostate cancer cells: the mechanisms involve ROS-mediated suppression of multidrug resistance and hypoxia inducible factor-1. Cancer Biol. Ther. 7, 468–475.

Imray, C.H., Radley, S., Davis, A., Barker, G., Hendrickse, C.W., Donovan, I.A., Lawson, A.M., Baker, P.R., Neoptolemos, J.P., 1992. Faecal unconjugated bile acids in patients with colorectal cancer or polyps. Gut 33, 1239–1245.

Ji, B.C., Hsu, W.H., Yang, J.S., Hsia, T.C., Lu, C.C., Chiang, J.H., Yang, J.L., Lin, C.H., Lin, J.J., Suen, L.J., Gibson Wood, W., Chung, J.G., 2009. Gallic acid induces apoptosis via caspase-3 and mitochondrion-dependent pathways in vitro and suppresses lung xenograft tumor growth in vivo. J. Agric. Food Chem. 57, 7596–7604. Jing, X., Ueki, N., Cheng, J., Imanishi, H., Hada, T., 2002. Induction of apoptosis in

hepatocellular carcinoma cell lines by emodin. Jpn. J. Cancer Res. 93, 874–882. Jing, Y., Yang, J., Wang, Y., Li, H., Chen, Y., Hu, Q., Shi, G., Tang, X., Yi, J., 2006. Alteration of subcellular redox equilibrium and the consequent oxidative modiﬁcation of nuclear factor kappaB are critical for anticancer cytotoxicity by emodin, a reactive oxygen species-producing agent. Free Radic. Biol. Med. 40, 2183–2197.

Kelloff, G.J., Crowell, J.A., Steele, V.E., Lubet, R.A., Malone, W.A., Boone, C.W., Kopelovich, L., Hawk, E.T., Lieberman, R., Lawrence, J.A., Ali, I., Viner, J.L., Sigman, C.C., 2000. Progress in cancer chemoprevention: development of diet-derived chemopreventive agents. J. Nutr. 130, 467S–471S.

Klein, S., McCormick, F., Levitzki, A., 2005. Killing time for cancer cells. Nat. Rev. Cancer 5, 573–580.

Kuo, T.C., Yang, J.S., Lin, M.W., Hsu, S.C., Lin, J.J., Lin, H.J., Hsia, T.C., Liao, C.L., Yang, M.D., Fan, M.J., Wood, W.G., Chung, J.G., 2009. Emodin has cytotoxic and protective effects in rat C6 glioma cells: roles of Mdr1a and nuclear factor kappaB in cell survival. J. Pharmacol. Exp. Ther. 330, 736–744.

Kwak, H.J., Park, M.J., Park, C.M., Moon, S.I., Yoo, D.H., Lee, H.C., Lee, S.H., Kim, M.S., Lee, H.W., Shin, W.S., Park, I.C., Rhee, C.H., Hong, S.I., 2006. Emodin inhibits vascular endothelial growth factor-A-induced angiogenesis by blocking receptor-2 (KDR/Flk-1) phosphorylation. Int. J. Cancer 118, 2711–2720. Lai, J.M., Chang, J.T., Wen, C.L., Hsu, S.L., 2009. Emodin induces a reactive oxygen

species-dependent and ATM-p53-Bax mediated cytotoxicity in lung cancer cells. Eur. J. Pharmacol. 623, 1–9.

Lee, M.G., Lee, K.T., Chi, S.G., Park, J.H., 2001. Costunolide induces apoptosis by ROS-mediated mitochondrial permeability transition and cytochrome C release. Biol. Pharm. Bull. 24, 303–306.

Lin, S.Y., Lai, W.W., Ho, C.C., Yu, F.S., Chen, G.W., Yang, J.S., Liu, K.C., Lin, M.L., Wu, P.P., Fan, M.J., Chung, J.G., 2009. Emodin induces apoptosis of human tongue squamous cancer SCC-4 cells through reactive oxygen species and mitochondria-dependent pathways. Anticancer Res. 29, 327–335.

Lu, C.C., Yang, J.S., Huang, A.C., Hsia, T.C., Chou, S.T., Kuo, C.L., Lu, H.F., Lee, T.H., Wood, W.G., Chung, J.G., 2010. Chrysophanol induces necrosis through the production of ROS and alteration of ATP levels in J5 human liver cancer cells. Mol. Nutr. Food Res. 54, 967–976.

Lu, H.F., Lai, K.C., Hsu, S.C., Lin, H.J., Kuo, C.L., Liao, C.L., Yang, J.S., Chung, J.G., 2009. Involvement of matrix metalloproteinases on the inhibition of cells invasion and migration by emodin in human neuroblastoma SH-SY5Y cells. Neurochem. Res. 34, 1575–1583.

Markowitz, S.D., Dawson, D.M., Willis, J., Willson, J.K., 2002. Focus on colon cancer. Cancer Cell 1, 233–236.

Muto, A., Hori, M., Sasaki, Y., Saitoh, A., Yasuda, I., Maekawa, T., Uchida, T., Asakura, K., Nakazato, T., Kaneda, T., Kizaki, M., Ikeda, Y., Yoshida, T., 2007. Emodin has a cytotoxic activity against human multiple myeloma as a Janus-activated kinase 2 inhibitor. Mol. Cancer Ther. 6, 987–994.

Nakagawa, T., Yuan, J., 2000. Cross-talk between two cysteine protease families. Activation of caspase-12 by calpain in apoptosis. J. Cell. Biol. 150, 887–894. Shieh, D.E., Chen, Y.Y., Yen, M.H., Chiang, L.C., Lin, C.C., 2004. Emodin-induced

apoptosis through p53-dependent pathway in human hepatoma cells. Life Sci. 74, 2279–2290.

Slattery, M.L., Boucher, K.M., Caan, B.J., Potter, J.D., Ma, K.N., 1998. Eating patterns and risk of colon cancer. Am. J. Epidemiol. 148, 4–16.

Srinivas, G., Anto, R.J., Srinivas, P., Vidhyalakshmi, S., Senan, V.P., Karunagaran, D., 2003. Emodin induces apoptosis of human cervical cancer cells through poly(ADP-ribose) polymerase cleavage and activation of caspase-9. Eur. J. Pharmacol. 473, 117–125.

Su, C.C., Yang, J.S., Lu, C.C., Chiang, J.H., Wu, C.L., Lin, J.J., Lai, K.C., Hsia, T.C., Lu, H.F., Fan, M.J., Chung, J.G., 2010. Curcumin inhibits human lung large cell carcinoma cancer tumour growth in a murine xenograft model. Phytother. Res. 24, 189– 192.

Su, Y.T., Chang, H.L., Shyue, S.K., Hsu, S.L., 2005. Emodin induces apoptosis in human lung adenocarcinoma cells through a reactive oxygen species-dependent mitochondrial signaling pathway. Biochem. Pharmacol. 70, 229–241. Wang, L., Lin, L., Ye, B., 2006. Electrochemical studies of the interaction of the

anticancer herbal drug emodin with DNA. J. Pharm. Biomed. Anal. 42, 625– 629.

Wang, W., Sun, Y., Li, X., Li, H., Chen, Y., Tian, Y., Yi, J., Wang, J., 2011. Emodin potentiates the anticancer effect of cisplatin on gallbladder cancer cells through the generation of reactive oxygen species and the inhibition of survivin expression. Oncol. Rep. 26, 1143–1148.

Wu, S.H., Hang, L.W., Yang, J.S., Chen, H.Y., Lin, H.Y., Chiang, J.H., Lu, C.C., Yang, J.L., Lai, T.Y., Ko, Y.C., Chung, J.G., 2010. Curcumin induces apoptosis in human non-small cell lung cancer NCI-H460 cells through ER stress and caspase cascade-and mitochondria-dependent pathways. Anticancer Res. 30, 2125–2133. Yang, J.S., Chen, G.W., Hsia, T.C., Ho, H.C., Ho, C.C., Lin, M.W., Lin, S.S., Yeh, R.D., Ip,

S.W., Lu, H.F., Chung, J.G., 2009. Diallyl disulﬁde induces apoptosis in human colon cancer cell line (COLO 205) through the induction of reactive oxygen species, endoplasmic reticulum stress, caspases casade and mitochondrial-dependent pathways. Food Chem. Toxicol. 47, 171–179.

Yang, J.S., Hour, M.J., Huang, W.W., Lin, K.L., Kuo, S.C., Chung, J.G., 2010. MJ-29 inhibits tubulin polymerization, induces mitotic arrest, and triggers apoptosis via cyclin-dependent kinase 1-mediated Bcl-2 phosphorylation in human leukemia U937 cells. J. Pharmacol. Exp. Ther. 334, 477–488.

Yim, H., Lee, Y.H., Lee, C.H., Lee, S.K., 1999. Emodin, an anthraquinone derivative isolated from the rhizomes of Rheum palmatum, selectively inhibits the activity of casein kinase II as a competitive inhibitor. Planta Med. 65, 9–13.

Yu, C.X., Zhang, X.Q., Kang, L.D., Zhang, P.J., Chen, W.W., Liu, W.W., Liu, Q.W., Zhang, J.Y., 2008. Emodin induces apoptosis in human prostate cancer cell LNCaP. Asian J. Androl. 10, 625–634.

Yu, F.S., Yang, J.S., Yu, C.S., Lu, C.C., Chiang, J.H., Lin, C.W., Chung, J.G., 2011. Safrole induces apoptosis in human oral cancer HSC-3 cells. J. Dent. Res. 90, 168–174.

Yu, F.S., Yu, C.S., Chan, J.K., Kuo, H.M., Lin, J.P., Tang, N.Y., Chang, Y.H., Chung, J.G., 2006. The effects of emodin on the expression of cytokines and functions of leukocytes from Sprague–Dawley rats. In Vivo 20, 147–151.

Zhang, L., Lau, Y.K., Xi, L., Hong, R.L., Kim, D.S., Chen, C.F., Hortobagyi, G.N., Chang, C., Hung, M.C., 1998. Tyrosine kinase inhibitors, emodin and its derivative repress HER-2/neu-induced cellular transformation and metastasis-associated properties. Oncogene 16, 2855–2863.

Ziegler, D.S., Kung, A.L., 2008. Therapeutic targeting of apoptosis pathways in cancer. Curr. Opin. Oncol. 20, 97–103.