Ursolic acid attenuates HMGB1-induced LOX-1 expression in vascular
endothelial cells in vitro and inhibits atherogenesis in hypercholesterolemic mice in vivo.
Ai-Wei Lee1,2, Chun-Yao Huang3,4,6,Chun-Ming Shih3,4,6, Yi-Wen Lin3,4,
Nai-Wen Tsao5,6, Yung-Hsiang Chen7, Yu-Jia Chang8, Nen-Chung Chang3,4,6,
Chi-Yuan Li9, Tsorng-Harn Fong2, Chih-Hao Nien4,6, and Feng-Yen Lin3,4,6,*
1Graduate Institute of Medical Sciences, Taipei Medical University, Taipei, Taiwan
2Department of Anatomy, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan
3Department of Internal Medicine, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan
4Division of Cardiology, Taipei Medical University Hospital, Taipei, Taiwan
5Division of Cardiovascular Surgery, Taipei Medical University Hospital, Taipei, Taiwan 6Cardiovascular Research Center, Taipei Medical University Hospital, Taipei, Taiwan 7Graduate Institute of Integrated Medicine, China Medical University, Taichung, Taiwan 8Graduate Institute of Clinical Medicine, Taipei Medical University, Taipei, Taiwan
9Graduate Institute of Clinical Medical Sciences, China Medical University and Department of Anesthesiology, China Medical University Hospital, Taichung, Taiwan
Running title: Ursolic acid inhibits HMGB1-mediated LOX-1 expression.
*Address correspondence to this author at the Division of Cardiology, Taipei Medical University Hospital, No. 250, Wu-Hsing Street, Shin-Yi District, Taipei City, Taiwan; Tel: 886-2-27361661 ext. 3014; E-mail: g870905@tmu.edu.tw
KEYWORDS: Ursolic acid; cyclooxygenase (COX); nitric oxide synthase (NOS); high-mobility group box 1 (HMGB1)
Abstract
Ursolic acid (UA), a triterpenoid compound found in plants, is used in both the human diet and in medicinal herbs and possesses a wide range of benefits, including
antioxidative and anti-inflammatory effects. Additionally, UA may inhibit lipid absorption in pancreatic cells and enhance lipolysis in adipocytes. Oxidized LDL (oxLDL) acts as a major mediator of endothelium dysfunction, which mediates atherogenesis. Until now, we have not known what role UA plays in the absorption of oxidized LDL in vascular endothelial cells. Regardless of whether UA affects oxLDL uptake mediated by specific oxLDL receptors (such as lectin-like oxidized low-density lipoprotein receptor 1 (LOX-1), scavenger receptor expressed by endothelial cells (SREC), and scavenger receptor B1 (SR-B1)), it is unclear if UA acts on endothelial cells. However, high-mobility group box 1 (HMGB1) is known to accumulate in atherosclerotic lesions and mediates vascular inflammation, although the mechanisms are not understood. Therefore, in this study, human coronary artery endothelial cells (HCAECs) were used in vitro and hypercholesterolemic mice were used in vivo to investigate the effects and mechanisms of HMGB1 and UA on oxLDL uptake. The results demonstrated that HMGB1 enhances oxLDL uptake through induction of LOX-1 in HCAECs and hypercholesterolemic mice. In vitro data showed that exposing HMGB1-stimulated HCAECs to UA decreased the LOX-1-mediated absorption of oxLDL through a cyclooxygenase (COX)-2-related nitric oxide (NO) signaling pathway. Similarly, UA administration decreased LOX-1, but not SREC and SR-B1 expression, in HMGB1-treated hypercholesterolemic mice. These findings suggest that UA may be a potential therapeutic agent for hypercholesterolemia-induced atherosclerosis.
Ursolic acid (3β-hydroxy-urs-12-en-28-oic-acid) (UA) is a triterpenoid compound found in plants. It is well known that UA possesses biological benefits, including antioxidative , anti-inflammatory , and anticarcinogenic effects. The molecular structure of UA is shown in figure 1A. Increasing evidence suggests that UA may combat free-radical-induced lipid peroxidation , increase the activity of endothelial nitric oxide synthase (eNOS), inhibit nicotinamide adenine dinucleotide phosphate oxidase 4 expression , decrease ethanol-mediated liver and heart damage , and attenuate high glucose-induced apoptosis . Additionally, UA appears to have anti-inflammatory actions, such as the inhibition of arachidonate metabolism , attenuation of inducible NOS and cyclooxygenase-2 expression , and attenuation of prostaglandin E2 synthesis . In the 1990s, scientists thought that UA may have the ability to
suppress lipid metabolism and peroxidation . More recent evidence has demonstrated that dietary UA may prevent ultraviolet-B radiation-induced lipid peroxidation in lymphocytes and may contribute to the inhibition of lipid absorption by decreasing lipase activity in pancreatic cells and enhancing lipolysis in adipocytes . Fatty acids are usually derived from triglycerides or phospholipids. Fatty acid intake and metabolism may play a role in the pathogenesis of essential hypertension and
atherosclerosis . In vitro experiments have demonstrated that UA potently inhibits the activity of fatty acid synthase . Furthermore, UA induces the expression of the low density lipoprotein (LDL) receptor in liver cells, which results in the increased clearance of LDL particles and a reduced level of LDL-cholesterol in the plasma . Recently, much attention has been given to the investigation of oxidized LDL
(oxLDL) as a major mediator of endothelial activation and/or dysfunction. However, until now, the effect of UA on the absorption of oxLDL in vascular endothelial cells, which is involved in atherogenesis, was not known.
receptor 1 (LOX-1), scavenger receptor expressed by endothelial cells (SREC), and scavenger receptor B1 (SR-B1), have been described in endothelial cells. These receptors facilitate the uptake of oxLDL and subsequent endothelial activation, transformation of macrophages to foam cells, and smooth muscle cell proliferation during atherogenesis. The expression of LOX-1, SREC, and SR-B1 are also regulated by oxidative stress and cytokines. Additionally, in atherosclerotic lesions, high-mobility group box 1 (HMGB1) is expressed by endothelial cells, smooth muscle cells, and infiltrated macrophages. While HMGB1 is released from cells, it is also a strong stimulator of leukocytes and may mediate inflammation . Previous evidence has shown that HMGB1 induces the secretion of cytokines in macrophages, induces proliferation in smooth muscle cells , and elicits inflammatory responses in
endothelial cells . However, it remains unclear whether oxLDL uptake-related scavenger receptor expression is affected by HMGB1 stimulation in endothelial cells.
In this study, we hypothesized that HMGB1 may affect oxLDL-uptake by receptor regulation, which may be prevented by UA treatment. Therefore, we used human coronary artery endothelial cells (HCAECs) in vitro to explore the cellular events and possible underlying mechanisms. Furthermore, we also examined the effects of UA and HMGB1 in increasing neointimal hyperplasia, LOX-1, SREC and SR-B1 expression in hypercholesterolemic mice in vivo.
MATERIALS and METHODS Reagent
UA (98.5% purity) and other reagents were purchased from Sigma-Aldrich Co. (St. Louis, MO, USA). UA was dissolved in ethanol as a 10 mM stock solution and stored at 4°C.
Manufacture of recombinant HMGB1
The segment containing the open-reading frame of the HMGB1 was originally amplified by RT-PCR of the human coronary artery endothelial cell RNA. The following gene-specific primers were used: Pr-HMGB1-F1: acatgggcaaaggagatcctaag and Pr-HMGB1-R1: ctgcgctagaaccaacttattc. The amplified HMGB1 cDNA fragment was cloned into a pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA, USA) and subsequently cloned in-frame into the EcoRI site of pRSETA (Invitrogen, Carlsbad, CA, USA) for expression in E. coli. BL21 cells were transformed with the pRSET-A-HMGB1 expression vector, and pRSET-A-HMGB1 recombinant proteins were purified by ProBond™ Nickel-Chelating resin according to the ProBondTM Purification System
manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA).
Cell culture
HCAECs were purchased from Cascade Biologics (Portland, OR, USA) and were grown in endothelial cell growth medium (medium 200, Cascade Biologics) supplemented with 2% fetal bovine serum (FBS), 1 µg/mL hydrocortisone, 10 ng/mL human epidermal growth factor, 3 ng/mL human fibroblast growth factor, 10 µg/mL heparin, 100 U/mL penicillin, 100 pg/mL streptomycin, and 1.25 mg/mL Fungizone (Gibco, NY, USA). All cells were grown at 37C in a humidified 5% CO2
atmosphere, and the growth medium was changed every other day. The cells were used at passages 3-8.
Measurement of HMGB1 protein cytotoxicity
Cell cytotoxicity of recombinant HMGB1 protein was analyzed by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. HCAECs were grown in 96-well plates and incubated with various concentrations
(0.1-2 g/ml) of recombinant HMGB1 for 6-36 h. Subsequently, 0.5 μg/ml of MTT was added to each well, and incubation was continued at 37°C for an additional 4 h. Dimethyl sulfoxide (DMSO) was added to each well, and the absorbance was recorded at 530 nm using a DIAS Microplate Reader (Dynex Technologies, VA, USA).
Uptake of DiI-LDL by HCAECs
Human LDL (d:1.019-1.063 g/ml) was isolated by sequential ultracentrifugation of fasting plasma samples from healthy adult males. The native LDL was oxidized as described in our previous report . The oxLDL was labeled with 1,1'-dioctadecyl-3,3,3',3'-tetramethyl-indocarbocyanine perchlorate (DiI) as described previously . To examine the cellular uptake of oxLDL, HCAECs were seated on culture slides and incubated for 4 hours in cultured medium containing 80 µg/mL of DiI-labeled oxLDL. At the end of the treatment, cells were washed with PBS, mounted on cover slips, and examined by confocal microscopy.
Cell enzyme-linked Immunosorbent assay (Cell ELISA)
To measure the cell-surface expression of LOX-1, SREC, and SR-B1, HCAECs in 96-well plates were pretreated with UA and HMGB1 for a variety of concentrations and durations. Expression of cell-surface receptors was measured by separate
incubation for 30 min at room temperature with specific antibodies against human LOX-1, SREC, or SR-B1, and then with horseradish peroxidase-conjugated secondary antibodies. Binding of the secondary antibody was determined by incubating the plates in the dark for 15 min with 100 ml of 3% o-phenylenediamine and 0.03% H2O2
in 50 mM citrate buffer and 100 mM phosphate buffer, then terminating the reaction by the addition of 50 ml of 2M H2SO4. Surface expression of adhesion molecules was
quantified by reading the OD at 490 nm in an ELISA plate reader.
Western blot analysis
Total cell lysates were extracted from the HCAECs. Proteins were separated by SDS-PAGE and were transferred to a PVDF membrane. The membranes were probed using mouse anti-phosphorylated eNOS (Millipore, CA, USA), rabbit anti-
cyclooxygenase (COX)-1 (R&D Systems, MN, USA), and mouse anti-COX-2 (Santa Cruz Biotechnology, CA, USA) antibodies. Mouse anti--actin
(Labvision/NeoMarkers, CA, USA) and mouse anti-eNOS (Millipore, CA, USA) antibodies were used as loading controls. The proteins were visualized using an enhanced chemiluminescence (ECL) detection kit (Amersham Biosciences, NJ, USA).
Measurement of prostaglandin E2 levels
HCAECs were subcultured into 10 cm dishes and cultured as indicated in the figure legends. At the selected time points, the culture supernatant was centrifuged at 1,000 g for 5 min; then, 100 l of the supernatant was assayed for prostaglandin E2 (PGE2) by
enzyme immunoassay (R&D Systems, MN, USA).
Animal study
All animals were treated according to protocols approved by the Institutional Animal Care Committee of the Taipei Medical University (Taipei, Taiwan). The experimental procedures and animal care conformed to the “Guide for the Care and Use of Laboratory Animals” published by the U.S. National Institutes of Health (NIH
Publication No. 85-23, revised 1996). Thirty-six male outbred C57BL/B6 mice (8-10 weeks old) were purchased from BioLASCO Taiwan Co., Ltd. All mice were kept in microisolator cages on a 12-h day/night cycle. After 1 week on a commercial mouse chow diet (Scientific Diet Services, Essex, UK) with water ad
libitum, 24 mice were placed on a 0.2% high-cholesterol (HC) diet (Harlan Laboratories Inc., Madison, WI, USA), and 12 animals remained on a normal diet.
The animals were divided into 5 groups. Group 1 was the naïve control group; group 2 received the HC diet; group 3 received the HC diet and intravenous injections of HMGB1 through the tail vein twice a week; group 4 received the HC diet, intraperitoneal injections of UA (2 mg/kg of body weight (BW)) once a week, and intravenous injections of HMGB1 through the tail vein twice a week; group 5 received the HC diet, intraperitoneal injections of UA (5 mg/kg of BW) once a week, and intravenous injections of HMGB1 through the tail vein twice a week. After 6 weeks of experimentation, the animals were anesthetized by intraperitoneal
injection of Xylocaine (2 mg/kg of BW) plus Zoletil (containing a dissociative anesthetic, Tiletamine/Zolazepam at a ratio of 1:1; 5 mg/kg of BW). The thoracic aortas were harvested and gently dissected free of adherent tissue.
Morphometry and immunohistochemistry
The thoracic aortas were divided into halves, immersion-fixed with 4% buffered paraformaldehyde, and embedded in paraffin. Each embedded-block was sectioned into 5 groups (each group interval of 100 m) with serial 5-m-thick sections. Each thoracic aorta possesses 50 section. Morphometric analysis of 50 arterial cross-sections per animal was performed using Hematoxylin and eosin (H&E) staining and
an LV-2 Image Analyzer (Winhow Instruments, Taipei, Taiwan). The intimal and medial areas of each arterial cross-section specimen were measured, and the atherosclerotic area/total surface area ratio was determined.
Immunohistochemical staining was performed using goat anti-LOX-1 (Santa Cruz Biotechnologies, Santa Cruz, CA, USA), rabbit anti-SR-B1 (Millipore, MA, USA), and goat anti-SREC (Abcam, CA, USA) antibodies.
Biochemical measurements
Blood samples for biochemical measurements were collected from each animal before the experiment and at 2, 4, and 6 weeks after the start of the experiment. Samples were collected from the mandibular artery into sodium citrate-containing tubes and separated by centrifugation. Serum blood urea nitrogen (BUN), creatinine, alanine aminotransferase (ALT), aspartate aminotransferase (AST), lactate, total-cholesterol, and triglycerides were measured using the SPOTCHEMTM automatic dry chemistry system (SP-4410; Arkray, Japan). The mouse plasma HMGB1 levels were determined using an enzyme-linked immunosorbent assay kit (Oxford Biosystems Inc., Oxford, UK).
Statistical analyses
Values are expressed as the means SEM. Statistical evaluation was performed using Student’s t-test and 1- or 2-way ANOVA
followed by Dunnett’s test. A probability value of P < 0.05 was considered significant.
The effects of recombinant HMGB1 on HCAECs
The cell viability of HCAECs was not altered following treatment with 0.1-2 g/mL HMGB1 for 24 hours when compared with control cells (0.1 g/mL: 98.6 ± 7.5% of control, 0.25 g/mL: 95.3 ± 9.4% of control, 0.5 g/mL: 99.1 ± 5.3% of control, 1 g/mL: 102.3 ± 12.3% of control, and 2 g/mL: 97.6 ± 10.5% of control) (Figure 1B). Treatment with 1 g/mL of HMGB1 for 6-36 hours also did not affect HCAEC proliferation (Figure 1C). According to the results, treatment with 0.1-2 g/mL of recombinant human HMGB1 for 6-36 hours did not affect the cell viability of the HCAECs. Concentrations of 1 g/mL of HMGB1 and 1-5 g/mL of ursolic acid were therefore used in subsequent experiments.
HMGB1 induces LOX-1 expression and enhances DiI-oxLDL uptake in HCAECs, which is inhibited by ursolic acid treatment
A DiI-oxLDL uptake assay was performed to investigate whether oxLDL uptake is enhanced in HMGB1-stimulated HCAECs. Confocal microscopy demonstrated that treatment with HMGB1 for 18 h significantly increased DiI-oxLDL uptake in the HCAECs (Figure 2A). Pretreatment of cells with 2.5 or 5 g/mL ursolic acid for 24 hours may significantly decrease the DiI-oxLDL uptake in HMGB1-treated groups. Previous evidence demonstrated that LOX-1, SREC and SR-B1 were originally identified on the membrane of vascular endothelial cells, mediating the uptake of oxLDL. Pretreatment with 10 g/mL LOX-1 competition antibody, but not SREC and SR-B1 antibodies, may decrease the DiI-oxLDL uptake in HMGB1-treated groups. We analyzed the receptor expression in the HCAECs. Cell ELISA demonstrated that 1 g/mL HMGB1 treatment for 18 h may induce membrane LOX-1 expression but not SREC or SR-B1 expression (Figure 2). However, pretreatment of cells with 2.5 or
5 g/mL of ursolic acid for 24 hours may inhibit the membrane LOX-1 expression under HMGB1 stimulation for 18 hours. According to these results, we predict that HMGB1 enhances DiI-oxLDL uptake in HCAECs, which may result from the increased LOX-1 expression. Ursolic acid inhibits the oxLDL uptake significantly in HMGB1-treated HCAECs and is mediated by the decreasing of LOX-1 expression.
Ursolic acid reduces LOX-1 expression via inhibition of COX-2 protein in HMGB1-treated HCAECs
HMGB1 is proposed to modulate the expression of COX-2 involved in the inflammation . Activation of COX-2 and PGE2 production mediates
atherosclerogenesis by oxLDL, which contributes to plaque rupture had been discussed. However, whether inducible COX-2 mediates LOX-1 expression in endothelial cells is unclear until now. To determine whether COX-2 involves in HMGB1-induced LOX-1 expression, and whether ursolic acid reduces LOX-1 expression via inhibition of COX-2 protein in HMGB1-treated HCAECs, western blotting was performed. Western blot analysis showed that treatment with HMGB1 induced COX-2 protein expression in a dose-dependent manner but had no effect on COX-1 protein expression (Figure 3A). The densitometry bar graph demonstrates that after treatment with HMGB1 for 12 hours, COX-2 protein expression increased by about twofold. Pretreatment of cultures with 10 M NS-398, (a COX-2 inhibitor), markedly inhibited HMGB1-induced LOX-1 expression (Figure 3B). Although COX-2 protein expression increased after treatment with 1 g/mL of HMGB1 for 1COX-2 hours, this effect was significantly decreased by 24 hours of pretreatment with 2.5 or 5 g/mL of ursolic acid (Figure 3C). In cells incubated with ursolic acid alone, COX-1 and COX-2 protein levels were similar to those in unstimulated HCAECs (data not
shown). Prostaglandin E2 (PGE2) is a primary product of arachidonic metabolism and
is synthesized via the COX and prostaglandin synthesis pathway. Unstimulated HCAECs produced low amounts of PGE2 (5.6 ± 2.5 pg/ml), and this result was not
affected by incubation with ursolic acid alone (data not shown).When the cells were incubated with 1 g/mL of HMGB1 for 18 hours, the concentration of PGE2 in the
medium increased, reaching levels of 45.3 ± 6.8 pg/ml. When cells were precultured in medium containing 2.5 or 5 g/mL ursolic acid for 24 hours then incubated with 1 g/mL of HMGB1 for 18 hours, only background levels of PGE2 were released (13.8
± 8.5 pg/ml of protein at 2.5 g/mL ursolic acid and 12.4 ± 5.2 pg/ml of protein at 5 g/mL ursolic acid, respectively)(Figure 3D). These results shows that ursolic acid reduces LOX-1 expression via inhibition of COX-2 protein level and attenuates PGE2
production in HMGB1-treated HCAECs.
Ursolic acid reduces LOX-1 expression via the promotion of eNOS activity in HMGB1-treated HCAECs
The eNOS is a ubiquitous signaling molecule that regulates vascular cells physiological and pathological events in vessels . Our previous study demonstrated that eNOS activity may be involved in LOX-1 expression in endothelial cells . Therefore, we next investigated whether the eNOS activity/phosphorylation is also involved in LOX-1 expression in HMGB1-stimulated HCAECs. In control group, HCAECs had high level of eNOS activity. After 18 hours of incubation, eNOS phosphorylation at Ser1,177 was significantly decreased in 0.25, 0.5, and 1 g/mL
HMGB1 protein-stimulated HCAECs compared with control conditions (Figure 4A).
Furthermore, pretreatment with NS-398 for 1 hour may reverse the inhibition of eNOS phosphorylation in HMGB1-treated HCAECs. Since NOS inhibition is
observed in states of increased release of COX-2-derived prostanoid and COX-2 inhibition could also be involved in the modulation of eNOS expression , this result most likely indicated that HMGB1 protein influences eNOS activity mediated by COX-2 expression. The potential involvement of eNOS- and COX-2-related
mechanisms in the manifestation of the effects of ursolic acid on HMGB1-stimulated cells was also examined. Preincubation with 100 μM of the NO donor S-nitroso-N-acetylpenicillamine (SNAP) or S-nitrosocysteine (SNOC) for 4 hours significantly ameliorated membrane LOX-1 expression in HMGB1-treated cells. In contrast, incubation with 10 μM of the NO synthase inhibitor NG-nitro-L-arginine methyl ester (L-NAME) for 24 hours significantly increased naïve membrane LOX-1 expression in HCAECs. However, the L-NAME may reverse the inhibition effect of NS-398 in LOX-1 expression in HMGB1-treated HCAECs (Figure 4B). When cells were pre-cultured in medium containing 2.5 or 5 g/mL ursolic acid for 24 hours, the downregulation of eNOS activity was reversed in HMGB1-stimulated HCAECs (Figure 4C). Preincubation with SNAP or SNOC for 4 hours significantly enhanced eNOS activity in HMGB1-treated cells (Figure 4D). These results show that ursolic acid reduces LOX-1 expression by increasing COX-2-related eNOS activity in HMGB1-treated HCAECs.
HMGB1 infusion indeed induces plasma HMGB1 and lactate elevation in mice Plasma HMGB1 levels in experimental mice were analyzed to monitor the efficiency of HMGB1 infusion. A previous study showed an HMGB1-induced increase of serum lactate, an indication of systemic inflammation. Therefore, the serum lactate levels were checked and are shown in Table 1. In the control and HC diet groups, HMGB1 levels did not change during the experiment. However, HMGB1 increased in all the HMGB1-receiving groups at week 2 and continued to increase
throughout the experimental period in HMGB1, HC diet+HMGB1, and HC diet+HMGB1+2 mg/kg BW UA groups. Lactate levels increased at week 6 after treatment with HMGB1. Interestingly, treatment with 5 mg/kg BW of UA may effectively decrease the plasma level of HMGB1 at week 4, which was similar to the HC diet+HMGB1 group. Similarly, serum lactate may decrease after treatment with 2 mg/kg BW or 5 mg/kg BW of UA for 6 weeks. These results demonstrate that
treatment with UA may decrease the level of HMGB1 and lactate.
During the experimental period, weight gain and final weight did not differ significantly between the groups of animals (data not shown). As shown in Table 2, serum AST, ALT, BUN, and creatinine levels also showed no significant difference between groups. Serum total cholesterol levels were increased after the 2-week HC diet except in the HC diet+HMGB1+5 mg/kg BW UA group. Compared to the HC diet+HMGB1 group, UA treatment did inhibit the serum total cholesterol level at week 6, although the levels are also higher than that in the control group.
Additionally, serum triglyceride levels increased significantly in the HC diet and HC diet+HMGB1 groups at week 2, and continued to increase throughout the
experimental period. In contrast, UA treatment may inhibit the elevation of serum triglyceride levels.
HMGB1 enhances atherosclerotic lesion formation and LOX-1 expression in HC diet-fed mice
Representative photographs of the atherosclerotic lesion formation in aortas stained with hematoxylin and eosin from the 5 groups are shown in figure 5A. There were no atherosclerotic lesions in the aortas of control and HC diet mice.
Compared with sections from the control or HC diet groups, the sections of the aorta from the HC diet + HMGB1 group showed
severe atherosclerotic lesion formation. In contrast, aortas had only slight lesion formation in the 2 µg/kg BW UA treatment group and markedly decreased lesion formation in the 5 µg/kg BW UA treatment group compared with the HC diet + HMGB1 group. These results demonstrate that administration of HMGB1 protein significantly increased atherosclerotic plaque formation in the HC diet-fed mice. UA treatment may effectively inhibit the lesion formation.
Immunohistochemical staining was performed using antibodies against LOX-1, SREC and SR-B1 on sections of the aortas (Figure 5B). Compared with the control group, strong and positive LOX-1 staining was observed in the atherosclerotic lesions of the HMGB1 + HC diet treatment group. The expression of SREC and SR-B1 remained unchanged following the HMGB1 treatment plus HC diet in the mouse aortas. However, administration of UA may not only prevent atherosclerotic lesion formation but also decrease the LOX-1 expression in the vessel wall. These results demonstrate that UA administration significantly decreased LOX-1 expression in the vessel wall, which may have resulted in decreased lesion formation in the HC diet + HMGB1 treatment mice.
DISCUSSION
HMGB1 and cardiovascular diseases
HMGB1 is expressed in all vertebrate cells and is a highly conserved and
ubiquitous protein present in nearly all types of cells. It is a non-histone chromosomal protein 215 amino acids in length with two domains composed of 80 amino acids that regulate gene transcription , modulate the activities of steroid hormone receptors , mediate neuritic outgrowth , stimulate cell proliferation , and act as an endogenous
immune adjuvant . However, HMGB1 has been identified as a mediator of
cardiovascular diseases. Tumor growth factor (TGF)- increases HMGB1 production by monocytes and contributes to lesion progression in human atherosclerosis .
Although previous data has demonstrated that HMGB1 might have a beneficial role in the treatment of myocardial infarction and promotes improvement of ischemia injury , it has been shown to induce tissue factor cascade expression (a major
stimulator of the blood coagulation) and increase the permeability of the endothelial cell monolayer , which impairs the function of the blood vessels.
Until now, the levels of HMGB1 in healthy human and sickness are still
controversial. However, there are many pathological states in which patients present with a higher HMGB1 level than normal . Patients with acute coronary syndrome or severe heart failure have more than 50 ng/dL plasma of HMGB1 . Increased
expression of HMGB1 in human atherosclerotic lesion was presented . Gibot et al. demonstrated that HMGB1 plasma concentrations are associated with severity of septic shock; in contrast, normal subjects generally have no more than 100 ng/dL plasma of HMGB1 . In this animal study, the mice were treated with HMGB1 in 0.2 g/kg BW and the plasma levels of HMGB1 may reach to more than 350 ng/dL at weeks 2. These reached levels of HMGB1 are much higher than the clinical
observation in human. Although previous studies found that the high HMGB1 level is related to the occurrence and survival of sepsis, reductions in body weight, poor appetite and activity, and vital sign changes were not observed in the HMGB1 treatment mice in this study (data not show). Because HMGB1-increased serum lactate is an indicator of systemic inflammation, the level of lactate was used to monitor HMGB1 injection. The normal blood lactate level in humans is 1-0.5
mmol/L. Hyperlactatemia is defined as a mild to moderate persistent increase in blood lactate concentration (2-6 mmol/L) without metabolic acidosis . The Table 1 shows
that the levels of lactate may reach to more than 10 mmol/L at weeks 6 in the
HMGB1 and HMGB1+HC diet groups. These results indicated that HMGB1 induces chronic systemic inflammation effectively in this model. Although the HMGB1 measured by the ELISA kit cannot be distinguished from recombinant human HMGB1 or injury-induced secretion of HMGB1 in mice,it is clear that the elevated HMGB1 in the bloodstream damaged the blood vessels.
It is well known that disturbance of lipid metabolism and high plasma level of HMGB1 play critical roles during atherogenesis, whether HMGB1 interfere with lipid metabolism in human is still unclear. In our study, serum total cholesterol and
triglyceride levels were not increased in normal diet+HMGB1 group, and continued to keep normal throughout the experimental period. Therefore, we believe that HMGB1did not directly alter the lipid metabolic pathway in mice. Presently, we are the first group to demonstrate that HMGB1 increases LOX-1 expression in vascular endothelial cells and enhances atherogenesis in hypercholesterolemic mice. In the further, it is necessary to elucidate the relationship between HMGB1 expression and lipid metabolism in human. Because it is difficult to induce atherosclerosis by feeding normal wild-type mice fed a HC diet, ApoE knock-out mice are often used. Therefore, the fact that only the HC diet fed-C57BL/B6 mice showed no significant
accumulation of atherosclerotic lesion is reasonable in this study; however, the combination of HC diet and HMGB1 stimulation accelerated the large plaque formation and LOX-1 expression in the mouse aorta. This is concordant with the in
vitro results. Therefore, we believe that the dose of the HMGB1 used in the study is reasonable and effective. This model is worthy of continued use in the study of atherosclerosis.
Recently, there has been much evidence of ox-LDL as a major mediator of endothelial dysfunction. Specific ox-LDL receptors, including LOX-1 and scavenger receptors, have been described in endothelial cells, macrophages, and smooth muscle cells. LOX-1 is a scavenger receptor that functions as the primary oxLDL receptor in endothelial cells and is implicated in oxLDL-induced endothelial dysfunction and atherosclerosis. These receptors facilitate uptake of ox-LDL and subsequent endothelial activation, transformation of macrophages to foam cells, and smooth muscle cell proliferation . Additionally, LOX-1 may mediate angiotensin converting enzyme and matrix metalloproteinases expression as well as regulate the migration of remnant-like lipoprotein particle-induced smooth muscle cells . In contrast, the deletion or blockade of the LOX-1 receptor may prevent the DNA damage of
endothelial cells , decrease the collagen accumulation in atherosclerotic lesions , and attenuate arterial restenosis after injury . However, the expression of LOX-1 is
susceptible to stress and inflammation. Enhancing LOX-1 expression in monocytes in high glucose environments was inhibited by treatment with inhibitors of protein kinase C (PKC), mitogen-activated protein kinases (MAPKs), nuclear factor-B (NF-B), and activated protein-1 (AP-1). LOX-1 is upregulated in endothelial cells by stimulation of cytokines , nitric oxide deficiency and activating octamer-1 (Oct-1). In addition, peroxisome proliferation-activated receptor (PPAR)- ligands , anti-diabetic agent , polyphenolic compounds from red wine , and statins also regulate LOX-1 expression.
In this experiment, HMGB1 was indeed shown to induce LOX-1 expression in endothelial cells and experimental mouse aorta, which has not been demonstrated in previous studies. Because LOX-1 may play an important role in the pathogenesis of atherosclerosis, the identification and regulation of LOX-1 and understanding of its
signal transduction pathways might improve our insight into the pathogenesis of atherosclerosis and provide a selective treatment approach.
Although past studies have shown that MAPKs, NF-B, Oct-1 and AP-1 participate in the pathway of LOX-1 expression, we also found that HMGB1 may reduce eNOS activity through the increase of COX-2 expression, which regulates LOX-1 expression; however, the real mechanisms underlying HMGB1 regulation of LOX-1 expression in endothelial cells are not yet understood.
Ursolic acid regulates COX-2-related inflammation
The COXs, of which COX-1 and COX-2 are most well known, are enzymes that are responsible for the formation of important biological mediators and cellular
inflammatory responses. The COX-1 enzyme is endogenous and is constitutively present in most mammalian tissues that help maintain homeostasis. In contrast, COX-2 is produced in large amounts in response to inflammation and mitogen-activated tissue. Multiple lines of evidence suggest that COX-2 is able to regulate
carcinogenesis, atherogenesis, and inflammation. UA is a selective inhibitor of COX-2 catalyzed prostaglandin biosynthesis . Treatment with UA inhibits phorbol 1COX-2- 12-myristate 13-acetate (PMA)-induced AP-1 activity and the binding of c-Jun to the COX-2 promoter and also inhibits carcinogen-induced I-B phosphorylation . Additionally, production of COX-2 mRNA is dependent on the generation of reactive oxygen species (ROS) to drive ERK 1/2 and p38 MAPK activation as well as NF-B-mediated transcription at the COX-2 promoter . HMGB1 induces the production of ROS, which causing multiple pathological changes in gene expression . UA is a potent inhibitor of ROS produced in the cellular system . Although we did not analyze the situation of the ROS in this study, we also speculate that UA may have the
potential in regulation of ROS production which mediating the COX-2 expression.
UA has been characterized as the agent responsible for the inhibition of lipoxygenase and COX-2 activity in macrophages, platelets and monocytic cells involving
atherogenesis. Even though the references showed evidences that UA inhibits the COX-2 activity, according to our study we speculate that inhibition of COX-2 protein expression/level perhaps also play a critical role in UA-inhibited PGE2 production.
However, previous evidence has shown that increased PGE2 production and COX-2
activity results in upregulation of inducible NO (iNOS) and that PI3K-Akt-eNOS
signaling is involved in COX-2 expression in vascular cells. Evidence that eNOS activity may mediate LOX-1 expression in vascular cells and macrophages has also been presented . Although recent studies suggest that UA plays a role in regulating HMGB1-induced oxLDL uptake and LOX-1 expression by mediating NO production and COX-2 expression in endothelial cells, more investigation of the effects of UA on CD36, SR-A, the LDL receptor, and other scavenger receptors in vascular smooth cells, monocytes, and endothelial progenitor cells is needed to clarify the potency of UA in combating atherosclerosis.
Ursolic acid and lipid metabolism
Lipid metabolism refers to the processes that involve the intercourse, absorption, and degradation of lipids. However, the presence of a lipid metabolic disorder is one of the main causes of atherosclerosis. Until now, few studies had proposed
mechanisms for the role of UA in lipid metabolism. In in vitro studies, UA contributes to the inhibition of lipid absorption through the inhibition of pancreatic lipase and by increasing lipolysis in adipocytes . UA-mediated lipolysis might induce lipase translocation, a decrease in perilipin A expression, and the upregulation of adipose triglyceride lipase . Dietary UA confers protection from ultraviolet-B
radiation-induced lipid peroxidation via the elimination of reactive oxygen species in human lymphocytes . Additionally, UA regulates fatty acid synthase through the inactivation of acetyl/malonyl transferase and significantly affects statin pharmacokinetics, including the slowing of the elimination of statin . In an in vivo study, UA increases the conversion of cholesterol into bile acid, which may lead to a reduction in
cholesterol and low density lipoprotein-cholesterol levels in the circulation ; we predict that this is the mechanism by which UA decreases the total cholesterol level in experimental mice in this study. Although UA is a promising candidate for the
treatment of obesity , we are the first group to demonstrate that UA attenuates LOX-1 expression in vascular endothelial cells and inhibits atherogenesis in
hypercholesterolemic mice. In the future, we need to conduct more cellular and molecular experiments to study the impact and underlying mechanisms of UA on lipid metabolism.
Conclusion
This study shows that HMGB1 induces LOX-1 expression in HCAECs. This is the first study to show that UA, an antioxidant, inhibits HMGB1-inducible LOX-1 expression in HCAECs by reducing COX-2 expression and consequently decreasing PGE2 production as well as increasing eNOS activation. Because overexpression of
LOX-1 by vascular endothelial cells is a crucial step in the pathogenesis of atherosclerosis, our study implies that UA may have therapeutic potential in the prevention of cardiovascular diseases. UA may also be beneficial in multiple pathological events involving inhibition of COX-2 expression and increased eNOS activity, including inflammation and atherosclerosis.
We thank Mr. Tze-Liang Yang, and Mrs. Min-Yu Lo for technical assistance. This work was supported by grants from Taipei Medical University (TMU-R-100-01), China Medical University (CMU98-CT-08), the Taiwan Department of Health
Clinical Trial and Research Center of Excellence (DOH100-TD-B-111-004), and partially by National Science Council (NSC 2314-B-038-035-MY2 and NSC 97-2320-B-039-022-MY3), Taipei, Taiwan.
REFERENCES:
[1]. Yin, M.C.; Chan, K.C. Nonenzymatic antioxidative and antiglycative effects of oleanolic acid and ursolic acid. Journal of agricultural and food chemistry. 2007, 55(17), 7177-7181.
[2]. Tsai, S.J.; Yin, M.C. Antioxidative and anti-inflammatory protection of oleanolic acid and ursolic acid in pc12 cells. J Food Sci. 2008, 73(7), H174-178.
[3]. Yan, S.L.; Huang, C.Y.; Wu, S.T.; Yin, M.C. Oleanolic acid and ursolic acid induce apoptosis in four human liver cancer cell lines. Toxicol In Vitro. 2010,
24(3), 842-848.
[4]. Balanehru, S.; Nagarajan, B. Protective effect of oleanolic acid and ursolic acid against lipid peroxidation. Biochemistry international. 1991, 24(5),
981-990.
[5]. Steinkamp-Fenske, K.; Bollinger, L.; Voller, N.; Xu, H.; Yao, Y.; Bauer, R.; Forstermann, U.; Li, H. Ursolic acid from the chinese herb danshen (salvia miltiorrhiza l.) upregulates enos and downregulates nox4 expression in human endothelial cells. Atherosclerosis. 2007, 195(1), e104-111.
[6]. Saravanan, R.; Viswanathan, P.; Pugalendi, K.V. Protective effect of ursolic acid on ethanol-mediated experimental liver damage in rats. Life sciences. 2006, 78(7), 713-718.
[7]. Saravanan, R.; Pugalendi, V. Impact of ursolic acid on chronic ethanol-induced oxidative stress in the rat heart. Pharmacol Rep. 2006, 58(1), 41-47. [8]. Oh, C.J.; Kil, I.S.; Park, C.I.; Yang, C.H.; Park, J.W. Ursolic acid regulates
high glucose-induced apoptosis. Free radical research. 2007, 41(6), 638-644. [9]. Lu, J.; Zheng, Y.L.; Wu, D.M.; Luo, L.; Sun, D.X.; Shan, Q. Ursolic acid
ameliorates cognition deficits and attenuates oxidative damage in the brain of senescent mice induced by d-galactose. Biochemical pharmacology. 2007,
74(7), 1078-1090.
[10]. Najid, A.; Simon, A.; Cook, J.; Chable-Rabinovitch, H.; Delage, C.; Chulia, A.J.; Rigaud, M. Characterization of ursolic acid as a lipoxygenase and cyclooxygenase inhibitor using macrophages, platelets and differentiated hl60 leukemic cells. FEBS letters. 1992, 299(3), 213-217.
[11]. Suh, N.; Honda, T.; Finlay, H.J.; Barchowsky, A.; Williams, C.; Benoit, N.E.; Xie, Q.W.; Nathan, C.; Gribble, G.W.; Sporn, M.B. Novel triterpenoids suppress inducible nitric oxide synthase (inos) and inducible cyclooxygenase (cox-2) in mouse macrophages. Cancer research. 1998, 58(4), 717-723.
[12]. Subbaramaiah, K.; Michaluart, P.; Sporn, M.B.; Dannenberg, A.J. Ursolic acid inhibits cyclooxygenase-2 transcription in human mammary epithelial cells.
Cancer research. 2000, 60(9), 2399-2404.
[13]. Takemura, N.U.; Kato, N. Adult neurogenesis and systemic adaptation: Animal experiments and clinical perspectives for ptsd. Prog Brain Res. 2008,
167(99-109.
[14]. Kim, J.; Jang, D.S.; Kim, H.; Kim, J.S. Anti-lipase and lipolytic activities of ursolic acid isolated from the roots of actinidia arguta. Arch Pharm Res. 2009,
32(7), 983-987.
[15]. Li, Y.; Kang, Z.; Li, S.; Kong, T.; Liu, X.; Sun, C. Ursolic acid stimulates lipolysis in primary-cultured rat adipocytes. Mol Nutr Food Res. 2010, 54(11), 1609-1617.
[16]. Zheng, Z.J.; Folsom, A.R.; Ma, J.; Arnett, D.K.; McGovern, P.G.; Eckfeldt, J.H. Plasma fatty acid composition and 6-year incidence of hypertension in middle-aged adults: The atherosclerosis risk in communities (aric) study. Am J Epidemiol. 1999, 150(5), 492-500.
[17]. Liu, Y.; Tian, W.; Ma, X.; Ding, W. Evaluation of inhibition of fatty acid synthase by ursolic acid: Positive cooperation mechanism. Biochemical and biophysical research communications. 2010, 392(3), 386-390.
[18]. Jie Xue, M.X., Zhenlun Gu. Mechanisms for regulating cholesterol
metabolism by protocatechualdehyde, ursolic acid and quercetin. Asia J Trad Med. 2006, 1( 2), 60-63
[19]. Tsukamoto, K.; Kinoshita, M.; Kojima, K.; Mikuni, Y.; Kudo, M.; Mori, M.; Fujita, M.; Horie, E.; Shimazu, N.; Teramoto, T. Synergically increased expression of cd36, cla-1 and cd68, but not of sr-a and lox-1, with the progression to foam cells from macrophages. J Atheroscler Thromb. 2002,
9(1), 57-64.
Gillotre-Taylor, K.; Horkko, S.; Palinski, W.; Quehenberger, O.; Shaw, P.; Steinberg, D.; Terpstra, V.; Witztum, J.L. Scavenger receptors, oxidized ldl, and
atherosclerosis. Ann N Y Acad Sci. 2001, 947(214-222; discussion 222-213. [21]. Andersson, U.; Erlandsson-Harris, H.; Yang, H.; Tracey, K.J. Hmgb1 as a
DNA-binding cytokine. J Leukoc Biol. 2002, 72(6), 1084-1091. [22]. Kalinina, N.; Agrotis, A.; Antropova, Y.; DiVitto, G.; Kanellakis, P.;
Kostolias, G.; Ilyinskaya, O.; Tararak, E.; Bobik, A. Increased expression of the DNA-binding cytokine hmgb1 in human atherosclerotic lesions: Role of activated macrophages and cytokines. Arteriosclerosis, thrombosis, and vascular biology. 2004, 24(12), 2320-2325.
[23]. Degryse, B.; Bonaldi, T.; Scaffidi, P.; Muller, S.; Resnati, M.; Sanvito, F.; Arrigoni, G.; Bianchi, M.E. The high mobility group (hmg) boxes of the nuclear protein hmg1 induce chemotaxis and cytoskeleton reorganization in rat smooth muscle cells. J Cell Biol. 2001, 152(6), 1197-1206.
[24]. Fiuza, C.; Bustin, M.; Talwar, S.; Tropea, M.; Gerstenberger, E.; Shelhamer, J.H.; Suffredini, A.F. Inflammation-promoting activity of hmgb1 on human microvascular endothelial cells. Blood. 2003, 101(7), 2652-2660.
[25]. Lin, F.Y.; Lin, Y.W.; Huang, C.Y.; Chang, Y.J.; Tsao, N.W.; Chang, N.C.; Ou, K.L.; Chen, T.L.; Shih, C.M.; Chen, Y.H. Groel1, a heat shock protein 60 of chlamydia pneumoniae, induces lectin-like oxidized low-density lipoprotein receptor 1 expression in endothelial cells and enhances atherogenesis in hypercholesterolemic rabbits. J Immunol. 2011, 186(7), 4405-4414. [26]. Oriol, A.; Ribera, J.M.; Arnal, J.; Milla, F.; Batlle, M.; Feliu, E.
Saccharomyces cerevisiae septicemia in a patient with myelodysplastic syndrome. American journal of hematology. 1993, 43(4), 325-326.
Chen, Y.H.; Fong, T.H.; Lin, F.Y. Ursolic acid induces allograft inflammatory factor-1 expression via a nitric oxide-related mechanism and increases
neovascularization. Journal of agricultural and food chemistry. 2010, 58(24), 12941-12949.
[28]. Pedrazzi, M.; Patrone, M.; Passalacqua, M.; Ranzato, E.; Colamassaro, D.; Sparatore, B.; Pontremoli, S.; Melloni, E. Selective proinflammatory activation of astrocytes by high-mobility group box 1 protein signaling. J Immunol. 2007, 179(12), 8525-8532.
[29]. Ardans, J.A.; Economou, A.P.; Martinson, J.M., Jr.; Zhou, M.; Wahl, L.M. Oxidized low-density and high-density lipoproteins regulate the production of matrix metalloproteinase-1 and -9 by activated monocytes. J Leukoc Biol. 2002, 71(6), 1012-1018.
[30]. Futaki, N.; Arai, I.; Hamasaka, Y.; Takahashi, S.; Higuchi, S.; Otomo, S. Selective inhibition of ns-398 on prostanoid production in inflamed tissue in rat carrageenan-air-pouch inflammation. J Pharm Pharmacol. 1993, 45(8), 753-755.
[31]. Chen, Y.L.; Hu, C.S.; Lin, F.Y.; Chen, Y.H.; Sheu, L.M.; Ku, H.H.; Shiao, M.S.; Chen, J.W.; Lin, S.J. Salvianolic acid b attenuates cyclooxygenase-2 expression in vitro in lps-treated human aortic smooth muscle cells and in vivo in the apolipoprotein-e-deficient mouse aorta. J Cell Biochem. 2006, 98(3), 618-631.
[32]. Kukreja, R.C.; Xi, L. Enos phosphorylation: A pivotal molecular switch in vasodilation and cardioprotection? Journal of molecular and cellular cardiology. 2007, 42(2), 280-282.
[33]. Lacza, Z.; Dezsi, L.; Kaldi, K.; Horvath, E.M.; Sandor, P.; Benyo, Z.
during acute no synthase blockade. Life sciences. 2003, 73(9), 1141-1149. [34]. Bolz, S.S.; Pohl, U. Indomethacin enhances endothelial no release--evidence
for a role of pgi2 in the autocrine control of calcium-dependent autacoid production. Cardiovascular research. 1997, 36(3), 437-444.
[35]. Escribano, M.; Molero, L.; Lopez-Farre, A.; Abarrategui, C.; Carrasco, C.; Garcia-Mendez, A.; Manzarbeitia, F.; Martin, M.J.; Vazquez, M.; Sanchez-Fayos, P.; Rico, L.; Porres Cubero, J.C. Aspirin inhibits endothelial nitric oxide synthase (enos) and flk-1 (vascular endothelial growth factor receptor-2) prior to rat colon tumour development. Clin Sci (Lond). 2004, 106(1), 83-91. [36]. Landsman, D.; Bustin, M. A signature for the hmg-1 box DNA-binding
proteins. Bioessays. 1993, 15(8), 539-546.
[37]. Melvin, V.S.; Edwards, D.P. Coregulatory proteins in steroid hormone
receptor action: The role of chromatin high mobility group proteins hmg-1 and -2. Steroids. 1999, 64(9), 576-586.
[38]. Merenmies, J.; Pihlaskari, R.; Laitinen, J.; Wartiovaara, J.; Rauvala, H. 30-kda heparin-binding protein of brain (amphoterin) involved in neurite outgrowth. Amino acid sequence and localization in the filopodia of the advancing plasma membrane. The Journal of biological chemistry. 1991, 266(25), 16722-16729. [39]. Palumbo, R.; Sampaolesi, M.; De Marchis, F.; Tonlorenzi, R.; Colombetti, S.;
Mondino, A.; Cossu, G.; Bianchi, M.E. Extracellular hmgb1, a signal of tissue damage, induces mesoangioblast migration and proliferation. J Cell Biol. 2004, 164(3), 441-449.
[40]. Rovere-Querini, P.; Capobianco, A.; Scaffidi, P.; Valentinis, B.; Catalanotti, F.; Giazzon, M.; Dumitriu, I.E.; Muller, S.; Iannacone, M.; Traversari, C.; Bianchi, M.E.; Manfredi, A.A. Hmgb1 is an endogenous immune adjuvant released by necrotic cells. EMBO Rep. 2004, 5(8), 825-830.
[41]. Germani, A.; Limana, F.; Capogrossi, M.C. Pivotal advances: High-mobility group box 1 protein--a cytokine with a role in cardiac repair. J Leukoc Biol. 2007, 81(1), 41-45.
[42]. Sachdev, U.; Cui, X.; Hong, G.; Namkoong, S.; Karlsson, J.M.; Baty, C.J.; Tzeng, E. High mobility group box 1 promotes endothelial cell angiogenic behavior in vitro and improves muscle perfusion in vivo in response to ischemic injury. J Vasc Surg. 2012, 55(1), 180-191.
[43]. Lv, B.; Wang, H.; Tang, Y.; Fan, Z.; Xiao, X.; Chen, F. High-mobility group box 1 protein induces tissue factor expression in vascular endothelial cells via activation of nf-kappab and egr-1. Thromb Haemost. 2009, 102(2), 352-359. [44]. Huang, W.; Liu, Y.; Li, L.; Zhang, R.; Liu, W.; Wu, J.; Mao, E.; Tang, Y.
Hmgb1 increases permeability of the endothelial cell monolayer via rage and src family tyrosine kinase pathways. Inflammation. 2012, 35(1), 350-362. [45]. Yamada, S.; Maruyama, I. Hmgb1, a novel inflammatory cytokine. Clin Chim
Acta. 2007, 375(1-2), 36-42.
[46]. Yamada, S.; Yakabe, K.; Ishii, J.; Imaizumi, H.; Maruyama, I. New high mobility group box 1 assay system. Clin Chim Acta. 2006, 372(1-2), 173-178. [47]. Gibot, S.; Massin, F.; Cravoisy, A.; Barraud, D.; Nace, L.; Levy, B.; Bollaert, P.E. High-mobility group box 1 protein plasma concentrations during septic shock. Intensive Care Med. 2007, 33(8), 1347-1353.
[48]. Mizock, B.A.; Falk, J.L. Lactic acidosis in critical illness. Crit Care Med. 1992, 20(1), 80-93.
[49]. Li, D.; Singh, R.M.; Liu, L.; Chen, H.; Singh, B.M.; Kazzaz, N.; Mehta, J.L. Oxidized-ldl through lox-1 increases the expression of angiotensin converting enzyme in human coronary artery endothelial cells. Cardiovascular research. 2003, 57(1), 238-243.
[50]. Li, D.; Liu, L.; Chen, H.; Sawamura, T.; Ranganathan, S.; Mehta, J.L. Lox-1 mediates oxidized low-density lipoprotein-induced expression of matrix metalloproteinases in human coronary artery endothelial cells. Circulation. 2003, 107(4), 612-617.
[51]. Aramaki, Y.; Mitsuoka, H.; Toyohara, M.; Jinnai, T.; Kanatani, K.; Nakajima, K.; Mukai, E.; Yamada, Y.; Kita, T.; Inagaki, N.; Kume, N. Lectin-like
oxidized ldl receptor-1 (lox-1) acts as a receptor for remnant-like lipoprotein particles (rlps) and mediates rlp-induced migration of vascular smooth muscle cells. Atherosclerosis. 2008, 198(2), 272-279.
[52]. Thum, T.; Borlak, J. Lox-1 receptor blockade abrogates oxldl-induced
oxidative DNA damage and prevents activation of the transcriptional repressor oct-1 in human coronary arterial endothelium. The Journal of biological chemistry. 2008, 283(28), 19456-19464.
[53]. Li, D.; Mehta, J.L. Upregulation of endothelial receptor for oxidized ldl (lox-1) by oxidized ldl and implications in apoptosis of human coronary artery endothelial cells: Evidence from use of antisense lox-1 mrna and chemical inhibitors. Arteriosclerosis, thrombosis, and vascular biology. 2000, 20(4), 1116-1122.
[54]. Hu, C.; Dandapat, A.; Sun, L.; Chen, J.; Marwali, M.R.; Romeo, F.;
Sawamura, T.; Mehta, J.L. Lox-1 deletion decreases collagen accumulation in atherosclerotic plaque in low-density lipoprotein receptor knockout mice fed a high-cholesterol diet. Cardiovascular research. 2008, 79(2), 287-293.
[55]. Yao, E.H.; Fukuda, N.; Ueno, T.; Matsuda, H.; Matsumoto, K.; Nagase, H.; Matsumoto, Y.; Takasaka, A.; Serie, K.; Sugiyama, H.; Sawamura, T. Novel gene silencer pyrrole-imidazole polyamide targeting lectin-like oxidized low-density lipoprotein receptor-1 attenuates restenosis of the artery after injury.
Hypertension. 2008, 52(1), 86-92.
[56]. Li, L.; Sawamura, T.; Renier, G. Glucose enhances human macrophage lox-1 expression: Role for lox-1 in glucose-induced macrophage foam cell
formation. Circulation research. 2004, 94(7), 892-901.
[57]. Hofnagel, O.; Luechtenborg, B.; Stolle, K.; Lorkowski, S.; Eschert, H.; Plenz, G.; Robenek, H. Proinflammatory cytokines regulate lox-1 expression in vascular smooth muscle cells. Arteriosclerosis, thrombosis, and vascular biology. 2004, 24(10), 1789-1795.
[58]. Smirnova, I.V.; Sawamura, T.; Goligorsky, M.S. Upregulation of lectin-like oxidized low-density lipoprotein receptor-1 (lox-1) in endothelial cells by nitric oxide deficiency. Am J Physiol Renal Physiol. 2004, 287(1), F25-32. [59]. Chen, J.; Liu, Y.; Liu, H.; Hermonat, P.L.; Mehta, J.L. Lectin-like oxidized
low-density lipoprotein receptor-1 (lox-1) transcriptional regulation by oct-1 in human endothelial cells: Implications for atherosclerosis. Biochem J. 2006,
393(Pt 1), 255-265.
[60]. Hayashida, K.; Kume, N.; Minami, M.; Inui-Hayashida, A.; Mukai, E.; Toyohara, M.; Kita, T. Peroxisome proliferator-activated receptor alpha ligands activate transcription of lectin-like oxidized low density lipoprotein receptor-1 gene through gc box motif. Biochemical and biophysical research communications. 2004, 323(3), 1116-1123.
[61]. Li, L.; Renier, G. The oral anti-diabetic agent, gliclazide, inhibits oxidized ldl-mediated lox-1 expression, metalloproteinase-9 secretion and apoptosis in human aortic endothelial cells. Atherosclerosis. 2009, 204(1), 40-46. [62]. Noll, C.; Hamelet, J.; Matulewicz, E.; Paul, J.L.; Delabar, J.M.; Janel, N.
Effects of red wine polyphenolic compounds on paraoxonase-1 and lectin-like oxidized low-density lipoprotein receptor-1 in hyperhomocysteinemic mice. J
Nutr Biochem. 2009, 20(8), 586-596.
[63]. Hofnagel, O.; Luechtenborg, B.; Eschert, H.; Weissen-Plenz, G.; Severs, N.J.; Robenek, H. Pravastatin inhibits expression of lectin-like oxidized low-density lipoprotein receptor-1 (lox-1) in watanabe heritable hyperlipidemic rabbits: A new pleiotropic effect of statins. Arteriosclerosis, thrombosis, and vascular biology. 2006, 26(3), 604-610.
[64]. Yu, Y.H.; Wang, Y.; Dong, B.; Sun, S.Z.; Chen, Y.; Meng, X.H.; Liu, Z.Z. Fluvastatin prevents renal injury and expression of lactin-like oxidized low-density lipoprotein receptor-1 in rabbits with hypercholesterolemia. Chin Med J (Engl). 2005, 118(8), 621-626.
[65]. Ringbom, T.; Segura, L.; Noreen, Y.; Perera, P.; Bohlin, L. Ursolic acid from plantago major, a selective inhibitor of cyclooxygenase-2 catalyzed
prostaglandin biosynthesis. J Nat Prod. 1998, 61(10), 1212-1215. [66]. Shishodia, S.; Majumdar, S.; Banerjee, S.; Aggarwal, B.B. Ursolic acid
inhibits nuclear factor-kappab activation induced by carcinogenic agents through suppression of ikappabalpha kinase and p65 phosphorylation: Correlation with down-regulation of cyclooxygenase 2, matrix
metalloproteinase 9, and cyclin d1. Cancer research. 2003, 63(15), 4375-4383. [67]. Di Mari, J.F.; Saada, J.I.; Mifflin, R.C.; Valentich, J.D.; Powell, D.W. Hetes
enhance il-1-mediated cox-2 expression via augmentation of message stability in human colonic myofibroblasts. Am J Physiol Gastrointest Liver Physiol. 2007, 293(4), G719-728.
[68]. Goldin, A.; Beckman, J.A.; Schmidt, A.M.; Creager, M.A. Advanced
glycation end products: Sparking the development of diabetic vascular injury. Circulation. 2006, 114(6), 597-605.
inhibitor of superoxides produced in the cellular system. Phytother Res. 2007,
21(6), 558-561.
[70]. Timoshenko, A.V.; Lala, P.K.; Chakraborty, C. Pge2-mediated upregulation of inos in murine breast cancer cells through the activation of ep4 receptors. Int J Cancer. 2004, 108(3), 384-389.
[71]. Ramachandran, S.; Prasad, N.R. Effect of ursolic acid, a triterpenoid
antioxidant, on ultraviolet-b radiation-induced cytotoxicity, lipid peroxidation and DNA damage in human lymphocytes. Chem Biol Interact. 2008, 176(2-3), 99-107.
[72]. Wen, J.H.; Xiong, Y.Q. The effect of herbal medicine danshensu and ursolic acid on pharmacokinetics of rosuvastatin in rats. Eur J Drug Metab
Figure legends
Figure 1 Cytotoxicity of HMGB1 in HCAECs. Cell viability was assessed by the MTT assay. A, The molecular structure of UA. B, Treatment of HCAECs with 0.1-2 μg/mL HMGB1 for 24 hours. C, Treatment of HCAECs with 1 μg/mL HMGB1 for 6-36 hours. Data are expressed as the mean ± SEM of the percentage of control (naïve HCAECs at the same time point) of 3 experiments performed in triplicate. *p < 0.05 was considered to be significant.
Figure 2 HMGB1 induces LOX-1 expression and enhances DiI-oxLDL uptake in HCAECs, which is inhibited by ursolic acid treatment. A, HCAECs were pretreated with UA for 24 hours or 10 g/mL of specific competition antibodies for 1 hour followed by DiI-oxLDL uptake in 1 g/mL HMGB1-induced HCAECs. Intracellular DiI-oxLDL was observed using confocal microscopy. Hoechst staining was used to identify the HCAEC nuclei. B, Pretreatment with 1-5 g/mL UA for 24 hours followed by 1 g/mL HMGB1 treatment for 18 h; the membrane LOX-1 expression was analyzed by cell ELISA. C, Pretreatment with 1-5 g/mL UA for 24 hours followed by 1 g/mL HMGB1 treatment for 18 h; the membrane SREC expression was analyzed by cell ELISA. D, Pretreatment with 1-5 g/mL UA for 24 hours followed by 1 g/mL HMGB1 treatment for 18 h; the membrane SR-B1 expression was analyzed by cell ELISA. Data represent the results of 3 independent experiments (mean ± SEM). *p < 0.05 compared with the unstimulated group.
Figure 3 HMGB1 induces LOX-1 expression via expression of COX-2, which is inhibited by ursolic acid treatment in HCAECs. A, HCAECs were treated for 12 hours with 0.25-1 µg/mL of HMGB1, and COX-1 and COX2 expression were analyzed by
western blot analysis. -actin was used as loading controls. The density of the bands was quantified with densitometry, and the data are illustrated in a bar graph (▓: COX-1; □: COX-2). B, HCAECs were pretreated with 5 or 10 µM NS-398 for 1 hour prior to stimulation with 1 g/mL HMGB1 protein for 18 hours. The membrane LOX-1 expression was analyzed by cell ELISA. C, COX-1 and COX-2 expression were analyzed by western blotting after 12 hours of culture in control or 1 µg/mL HMGB1 protein in the absence or presence of UA (1-5 µg/mL)-containing medium. -actin was used as loading controls. The density of the bands was quantified with
densitometry, and the data are illustrated in a bar graph (▓: COX-1; □: COX-2). D, UA inhibits the increase in PGE2 levels in HMGB1-stimulated HCAECs. Cells grown
to confluency in 10 cm dishes were incubated for 24 hours with 1, 2.5, or 5 µg/mL UA and then stimulated for 18 hours with 1 g/mL of HMGB1 protein. The medium was then collected, and the PGE2 concentration was measured by ELISA. Data
represent the results of 3 independent experiments. *p < 0.05 was considered to be significant.
Figure 4 HMGB1 induces LOX-1 expression via inhibition of eNOS activity, which is reversed by ursolic acid treatment in HCAECs. A, HCAECs were treated for 18 hours with 0.25-1 µg/mL of HMGB1 or pretreated with 10 µM NS-398 for 1 hour prior to stimulation with 1 g/mL HMGB1 protein for 18 hours. The eNOS activation (phosphorylation) was quantified by western blot analysis. Total eNOS was used as loading controls. The density of the bands was quantified by densitometry, and the data are illustrated in a bar graph. B, HCAECs were pretreated with 100 µM SNOC or SNAP for 4 hours, 10 µM NS-398 for 1 hour or 10 µM L-NAME for 24 hours prior to stimulation with 1 µg/mL HMGB1 protein for 18 hours. C, Phosphorylation of eNOS
was analyzed after 18 hours of culture in control or HMGB1 protein in the absence or presence of UA-containing medium. D, HCAECs were pretreated with 100 µM SNOC or SNAP for 4 hours prior to stimulation with 1 µg/mL HMGB1 protein for 18 hours. The eNOS activation (phosphorylation) was quantified by western blot
analysis. Total eNOS was used as loading controls. The density of the bands was quantified with densitometry, and the data are illustrated in a bar graph. All data represent the results of 3 independent experiments. *p < 0.05 was considered to be significant.
Figure 5 HMGB1 induces atherosclerotic lesion formation in HC diet-fed mice, and this formation was prevented by UA treatment. (A) Representative photographs of atherosclerotic lesions (fatty streak) in the cross-sections of aortas stained with
hematoxylin and eosin. The bar graph shows the atherosclerotic area/total surface area ratio, and the results are expressed as the mean ± SEM. *p< 0.05. (B) The lumen is uppermost in all sections, and the internal elastic laminae are indicated with arrows. Immunohistochemistry was performed to assess LOX-1 (brown signal), SREC, and SR-B1 in mice aortas. Hematoxylin and eosin staining of corresponding sections was used for nucleus identification.
