Transactivation, Dimerization, and DNA-Binding Activity of White Spot Syndrome Virus Immediate-Early Protein IE1

0022-538X/08/$08.00

⫹0 doi:10.1128/JVI.01244-08

Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Transactivation, Dimerization, and DNA-Binding Activity of White

Spot Syndrome Virus Immediate-Early Protein IE1

䌤

Wang-Jing Liu,

1

Yun-Shiang Chang,

2

Hao-Ching Wang,

3

Jiann-Horng Leu,

1

Guang-Hsiung Kou,

1

* and Chu-Fang Lo

1

*

Institute of Zoology, National Taiwan University, Taipei, Taiwan

1

_{; Department of Molecular Biotechnology, Da-Yeh University,}

Changhua, Taiwan

2

_{; and Institute of Biological Chemistry, Academia Sinica, Taipei, Taiwan}

3

Received 16 June 2008/Accepted 20 August 2008

Immediate-early proteins from many viruses function as transcriptional regulators and exhibit

transacti-vation activity, DNA binding activity, and dimerization. In this study, we investigated these characteristics in

white spot syndrome virus (WSSV) immediate-early protein 1 (IE1) and attempted to map the corresponding

functional domains. Transactivation was investigated by transiently expressing a protein consisting of the DNA

binding domain of the yeast transactivator GAL4 fused to full-length IE1. This GAL4-IE1 fusion protein

successfully activated the Autographa californica multicapsid nucleopolyhedrovirus p35 basal promoter when

five copies of the GAL4 DNA binding site were inserted upstream of the TATA box. A deletion series of

GAL4-IE1 fusion proteins suggested that the transactivation domain of WSSV IE1 was carried within its first

80 amino acids. A point mutation assay further showed that all 12 of the acidic residues in this highly acidic

domain were important for IE1’s transactivation activity. DNA binding activity was confirmed by an

electro-phoresis mobility shift assay using a probe with

32

P-labeled random oligonucleotides. The DNA binding region

of WSSV IE1 was located in its C-terminal end (amino acids 81 to 224), but mutation of a putative zinc finger

motif in this C-terminal region suggested that this motif was not directly involved in the DNA binding activity.

A homotypic interaction between IE1 molecules was demonstrated by glutathione S-transferase pull-down

assay and a coimmunoprecipitation analysis. A glutaraldehyde cross-linking experiment and gel filtration

analysis showed that this self-interaction led to the formation of stable IE1 dimers.

White spot syndrome virus (WSSV) is the causative agent of

a disease that has led to severe mortalities of cultured shrimps

all over the world (10, 14, 23, 53). WSSV is a large

double-stranded DNA virus which is extremely virulent (23, 38, 39),

has a wide host range (14, 33), and targets various tissues (32,

59). It was recently erected as the type species of genus

Whispo-virus in the family Nimaviridae (56). Although the complete

sequence of the WSSV genome has been known for several

years (7, 55, 60), knowledge of the biological functions of the

viral proteins is still quite poor. The WSSV immediate-early

gene ie1 (31) was recently shown to use a shrimp signal

trans-ducer and activator of transcription (STAT) as a transcription

factor to enhance its expression and contribute to its high

promoter activity in host cells (30). In the present study, we

further investigate the characteristics of WSSV IE1. This is

made more difficult by the fact that no continuous shrimp cell

line is currently available, and while bearing in mind that a

heterologous system might introduce experimental artifacts,

here we follow previous studies (22, 30, 34) and use the Sf9

insect cell system.

Many viral immediate-early genes encode multifunctional

transcriptional regulators that both positively and negatively

modulate gene expression (26, 52, 57). These transcriptional

regulators must possess at least two functional domains,

namely, a DNA binding domain (DBD) that allows attachment

of the transactivator to its target sequence within a gene

pro-moter and a transactivation domain (TAD) that can interact

with the basal transcription machinery and promote the

tran-scription of the target genes. These two domains are often

functionally independent and physically separate. In many

cases, the activity of these transcriptional regulators is

regu-lated by homophilic interactions (35, 42) as well as by the

formation of heterodimers with other transcriptional factors.

We show here that WSSV IE1 exhibits all three of these

tran-scriptional regulator functions, and we also attempt to identify

the domains that are associated with these functions.

While the DBDs are extremely well characterized both

func-tionally and structurally, the activation domains do not share

easily recognizable motifs or structures (54). Therefore, in the

present study, the TAD of WSSV IE1 was investigated by

analyzing the transient expression of GAL4 DBD-IE1 N- or

C-terminal deletion mutants. IE1-DNA binding and the

func-tionality of a previously identified Cys

2

/His

2

-type zinc finger

DNA binding motif (31) were investigated using

electro-phoretic mobility shift assays (EMSAs). Finally, to investigate

the intermolecular interactions of WSSV IE1, a combination

of in vitro and in vivo assays were performed to test for IE1

homophilic interactions.

MATERIALS AND METHODS

Plasmids. (i) Luciferase effectors.The plasmid pIZ⌬IE/V5-His was used as

a starting point in dual-luciferase reporter assays. It was modified from the commercialized plasmid pIZ/V5-His (Invitrogen) by deleting the OpIE2 (Orgyia pseudotsugata multicapsid nucleopolyhedrovirus ie2) promoter lo-cated in front of the multiple cloning sites. Next, part (⬃2 kbp) of the WSSV IE1 promoter fragment upstream of the ATG was amplified from the WSSV

* Corresponding author. Mailing address: Institute of Zoology,

Na-tional Taiwan University, Taipei 106, Taiwan. Phone: 886-2-33662453.

Fax: 886-2-23638179. E-mail for Chu-Fang Lo: [email protected].

E-mail for Guang-Hsiung Kou: [email protected].

䌤

_{Published ahead of print on 3 September 2008.}

11362

at National Taiwan Univ. on May 8, 2009

jvi.asm.org

genomic DNA (using the primers CGGAATTCGATGATGGTGATGTTTC TAGG and CCGCTCGAGCTTGAGTGGAGAGAGAGAGC [underlined sequences represent the restriction enzyme recognition sites]) and cloned

into pIZ⌬IE/V5-His. The resulting plasmid was designated pWSSV-V5-His

and was used to express the full-length ie1 coding region, the GAL4 DBD (29), and various fusion proteins consisting of the GAL4 DBD plus down-stream, in-frame insertions of different regions of the WSSV ie1 coding sequence (see Table 1 for the ie1 primers). To construct the GAL4 DBD gene plasmid (pWSSV-GAL4-V5-His), the gene sequence encoding GAL4 DBD amino acids (aa) 1 to 147 was amplified by PCR from yeast genomic DNA

(using the primers 5⬘-GCTCTAGAATGAAGCTACTGTCTTCTATC-3⬘ and

5⬘-TCCCCGCGGCGATACAGTCAACTGTCTTTG-3⬘) and then cloned into the XbaI/SacII-digested pWSSV-V5-His plasmid. One of the fusion

protein plasmids, pWSSV-GAL4-IE11–80-V5-His, contained the wild-type

IE1 sequence spanning aa 1 to 80, and this plasmid was used as a template to produce a range of N-terminal mutants. Site-directed mutations of the acidic residues of the amino terminus of IE1 were generated by using rolling-circle PCR (20) to replace the acidic residues with alanine. To confirm that only the acidic amino acids were involved in transactivation, alanine was also used to replace two randomly chosen nonacidic residues (G20A and G41A muta-tions). Mutations were verified for all plasmids by DNA sequencing analysis. The specifically designed mutagenic primers used to generate the IE1 TAD mutants are listed in Table 2.

(ii) Luciferase reporters.The reporter plasmid p35BAS-Luc, which contained

the firefly luciferase reporter gene, was constructed by PCR cloning of the

Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) p35 basal

promoter into the pGL3-Basic vector (Promega), using the primer pair AcMNPV-p35-F1 and AcMNPV-p35-R1 (Table 1). The other reporter plasmid,

G5p35BAS-Luc, contained five copies of the GAL4 DNA binding site upstream

of the AcMNPV p35 basal promoter, and it was constructed by amplifying five copies of the GAL4 DNA binding site from pG5SEAP (Clontech), using primers

GAL4bs-F and GAL4bs-R (Table 1), and then cloning them into p35BAS-Luc

vector KpnI and XhoI sites.

(iii) Glutathione S-transferase–IE1 (GST-IE1) and GST-VP36B.The plasmids

pGST-IE11–224and pGST-IE181–224were generated by cloning PCR-amplified

WSSV ie1 coding region fragments flanked by EcoRI and XhoI restriction sites into the corresponding sites of predigested pGEX-5X-1 vector (Amersham

Phar-macia Biotech). pGST-IE181–224 C2-H2mutwas constructed by rolling-circle PCR

as described above, using pGST-IE181–224as the template. The plasmid

pGST-VP36B was constructed by cloning the WSSV structural protein pGST-VP36B into the pGEX-5X-1 vector, using primers VP36B-F and VP36B-R. Primer sequences are listed in Table 3.

(iv) IE1 expression plasmids.PCR cloning was used to insert the WSSV ie1 coding region into the vectors pDHsp/V5-His and pDHsp/FLAG-His, which both contain the heat-inducible Drosophila heat shock protein 70 promoter (28). The resulting plasmids, pDHsp/IE1-V5-His and pDHsp/IE1-FLAG-His, ex-pressed the V5 and FLAG tag fusion proteins, respectively. Another IE1 expres-sion plasmid, pcDNA3/IE1, was constructed by PCR cloning the WSSV ie1 coding region into the commercialized vector pcDNA3 (Invitrogen). Primer sequences are listed in Table 3.

Transient transfections and dual-luciferase reporter assay.Transfections of Sf9 insect cells were performed using the Cellfectin reagent (Invitrogen). Briefly,

the Sf9 insect cells were seeded onto a 24-well plate (1⫻ 105

cells/well) and grown in Sf-900 II serum-free medium (Invitrogen) overnight at 27°C. Cells were

TABLE 1. Primers used for construction of luciferase reporter and effector plasmids

Plasmid Primer(s) Primer sequence (5⬘–3⬘)a

pWSSV-IE1

1–224

-V5-His

IE1-F

TCCCCGCGGATGGCCTTTAATTTTGAAGAC

IE1-R

TCCCCGCGGTACAAAGAATCCAGAAATCTCA

pWSSV-GAL4-IE1

1–224

-V5-His

IE1-F/IE1-R

p35

BAS

-Luc

AcMNPV-p35-F1

CCGCTCGAGTGGCGACGGATTTTTATATACA

AcMNPV-p35-R1

CCCAAGCTTTTTGCAATGGTAAAGCTCAAA

G5p35

BAS

-Luc

GAL4bs-F

CGGGGTACCGATCGGAGTACTGTCCTCCG

GAL4bs-R

CCGCTCGAGCAAGCTAATTCCCGGGGATC

pWSSV-GAL4-IE1

1–49

-V5-His

IE1-F (see above)/IE1-49-R

TCCCCGCGGGAGACGCCTCTTCATCACCTC

pWSSV-GAL4-IE1

1–92

-V5-His

IE1-F (see above)/IE1-92-R

TCCCCGCGGTGCCAAGCAGTTTGTCTTGAC

pWSSV-GAL4-IE1

1–137

-V5-His

IE1-F (see above)/IE1-137-R

TCCCCGCGGCCATTTCATGGCTAGCGAAGT

pWSSV-GAL4-IE1

1–186

-V5-His

IE1-F (see above)/IE1-186-R

TCCCCGCGGAAACATTGGGTTTGATGCATT

pWSSV-GAL4-IE1

81–224

-V5-His

IE1-81-F/IE1-R (see above)

TCCCCGCGGAACAGTGGTTCCCATGTCAAG

pWSSV-GAL4-IE1

92–224

-V5-His

IE1-92-F/IE1-R (see above)

TCCCCGCGGGCATTATTCCTTCAAGAGTTT

pWSSV-GAL4-IE1

137–224

-V5-His

IE1-137-F/IE1-R (see above)

TCCCCGCGGTGGATGGCTAGGGATGTGACT

pWSSV-GAL4-IE1

50–92

-V5-His

IE1-50-F

TCCCCGCGGGTACGGCAAGGAAAGTGTGG

IE1-92-R

TCCCCGCGGTGCCAAGCAGTTTGTCTTGAC

pWSSV-GAL4-IE1

20–92

-V5-His

IE1-20-F/IE1-92-R (see above)

TCCCCGCGGGGCACAACAACAGACCCTAC

pWSSV-GAL4-IE1

30–92

-V5-His

IE1-30-F/IE1-92-R (see above)

TCCCCGCGGATCATATTCTTTGAAAGTCT

pWSSV-GAL4-IE1

40–92

-V5-His

IE1-40-F/IE1-92-R (see above)

TCCCCGCGGTCTGGTATTGAGGTGATGAAG

pWSSV-GAL4-IE1

1–60

-V5-His

IE1-F (see above)/IE1-60-R

TCCCCGCGGTGCTTCAAAATTCCCACACTT

pWSSV-GAL4-IE1

1–70

-V5-His

IE1-F (see above)/IE1-70-R

TCCCCGCGGGAGCCAGAAATACGACATAGC

pWSSV-GAL4-IE1

1–80

-V5-His

IE1-F (see above)/IE1-80-R

TCCCCGCGGGAGATTCTCCATATCTTCTGC

a_{Restriction enzyme cutting sites are underlined.}

TABLE 2. Sequences of mutated oligonucleotides used to generate

point mutations in the WSSV IE1 transactivation domain

Plasmid Primer sequence (5⬘–3⬘)a

pWSSV-GAL4-IE1

1–80

...TTTGCCAATATGGACTTGAC

(E6A/D7A)

GAGATTTGTAGAGGCTGCAAA

pWSSV-GAL4-IE1

1–80

...TTTGCCAATATGGCCTTGAC

(D16A)

GAGATTTGTAGAGTCTTCAAA

pWSSV-GAL4-IE1

1–80

...CGCCCCAATATCATATTCTTT

(D24A)

GGTAGGGGCTGTTGTTGTGCC

pWSSV-GAL4-IE1

1–80

...GGGGAGTAGACTTGCAAAGAA

(E34A/E43A)

AACTCTGGTATTGCGGTGATG

pWSSV-GAL4-IE1

1–80

...GGGAATTTTGCAGCAAGTGGA

(E59A)

ACACTTTCCTTGCCGTACGAG

pWSSV-GAL4-IE1

1–80

...TGGCTCGCAGCTAATGCAGAA

(E71A/D72A)

GAAATACGACATAGCACCTC

pWSSV-GAL4-IE1

1–80

...AATGCAGCAGCTATGGAGAATC

(E75A/D76A)

ATCTTCGAGCCAGAAATACGA

pWSSV-GAL4-IE1

1–80

...GCAGAAGATATGGCGAATCTC

(E78A)

ATTATCTTCGAGCCAGAAATA

pWSSV-GAL4-IE1

1–80

...ACGGCTGCCACAACAACAGAC

(G20A)

CAAGTCCATATTGGCAAAGAG

pWSSV-GAL4-IE1

1–80

...AACTCTGCTATTGAGGTGATG

(G41A)

GGGGAGTAGACTTTCAAAGAA

a_{The underlined nucleotides show the positions of the mutations. Plasmids}

with three or more mutations were constructed by nested PCRs using appropri-ate combinations of the primer sets.

at National Taiwan Univ. on May 8, 2009

jvi.asm.org

cotransfected with 300 ng of the reporter plasmid containing the firefly luciferase gene, 500 ng of one of the different effector plasmids or the empty vector, and 100 ng of the Renilla luciferase gene plasmid, phRL/AcMNPVie1 (30). The phRL/AcMNPVie1 plasmid contains the AcMNPV ie1 promoter to drive the expression of the Renilla luciferase gene and was used to monitor and normalize transfection efficiency. Cells were collected at 48 h posttransfection, and the cell lysates were prepared according to the Promega instruction manual for the dual-luciferase assay system. Luciferase activities were measured with a lumi-nometer (Labsystems). Firefly luciferase activity values were then normalized against the activities of the Renilla luciferase to correct for transfection efficiency, and data were expressed as relative luciferase activities. Luciferase activities were determined for triplicate transfections in two independent experiments, and the means and standard deviations (SD) were calculated. For the point mutation assays, statistically significant differences from the wild-type TAD expression plasmid were identified using paired Student’s t test, with significance set at P

values of⬍0.01.

Cell extracts and Western blot analysis.Total cell lysates were prepared by

directly adding 2⫻ sodium dodecyl sulfate-polyacrylamide gel electrophoresis

(SDS-PAGE) sample buffer (100 mM Tris-HCl [pH 6.8], 200 mM dithiothreitol [DTT], 4% SDS, 0.2% bromophenol blue, 20% glycerol) to cell pellets and then boiling the samples for 10 min. The samples were separated in 15% polyacryl-amide gels, transferred to a polyvinylidene difluoride membrane (MSI),

incu-bated with either anti-V5 antibody (Sigma) or anti-␤-actin antibody (Chemicon),

and then detected with a secondary peroxidase-conjugated antibody. Detected proteins were visualized using an ECL (Perkin-Elmer) detection system.

Expression and purification of GST, GST-VP36B, GST-IE11–224, and GST-IE1 deletion mutants.GST fusion proteins were expressed and purified according to the manufacturer’s manual. After overnight culture of the GST plasmids in transformed Escherichia coli BL21 Codon Plus cells (Stratagene), the cultures

were diluted 1:200 (vol/vol) in Luria-Bertani (LB) medium containing 50␮g/ml

of ampicillin and then incubated for another 3 h at 37°C. Expression of the fusion proteins was induced by the addition of IPTG (isopropyl-␤-d-thiogalactopyrano-side) to a final concentration of 1 mM, and the cultures were grown for a further 24 h at 15°C. The soluble GST fusion proteins were resuspended in lysis buffer (50 mM Tris-HCl [pH 8.0], 300 mM NaCl, 1 mM DTT, and 1 mM EDTA) and purified by affinity chromatography with an FF 16/10 GST column (Amersham Biosciences). The fusion proteins were eluted from the beads with 50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 1 mM DTT, 1 mM EDTA, and 10 mM reduced glutathione, and then the purified proteins were condensed with an

Amicon Ultra-30 column (Millipore). To obtain the IE11–224protein, the GST

was removed from the GST-IE11–224fusion protein by digestion with factor Xa

(10 units of protease/1 mg GST fusion protein; Amersham Biosciences) in 1⫻ phosphate-buffered saline (PBS) containing 1 mM DTT at 22°C for 16 h. The digested GST was removed with a GST column. Purity of the samples was assessed by SDS-PAGE, and the protein concentration was determined using a Bio-Rad protein assay kit.

DNA binding assay (EMSA).EMSA was performed as described previously (49), with some modifications. Single-stranded oligonucleotides containing a 25-nucleotide random core sequence flanked on each side by 27 nucleotides

[5⬘-GTCGCTCGAGCGGTATGACGAGATCTA(N)25TAGATCTGCGTCAC

TAGTCTAGACTAG-3⬘ (where N can be any of the four deoxyribonucleotides)]

were synthesized (9). A double-stranded [␣-32_{P]dCTP-labeled oligonucleotide}

library was generated by PCR using the forward primer 5⬘-GTCGCTCGAGCG

GTATGACG-3⬘ and the reverse primer

5⬘-CTAGTCTAGACTAGTGACGC-3⬘. Binding reactions were carried out for 30 min at room temperature in 15-␮l reaction mixtures that contained different concentrations of purified

recombi-nant proteins with 10 mM HEPES (pH 7.9), 1 mM DTT, 5 mM MgCl2, 0.5 mM

ZnCl2, 60 mM KCl, 0.05% NP-40, 200 ng poly(dI-dC), 10% glycerol, and 50

␮g/ml bovine serum albumin. The DNA-protein complexes were resolved in

7.5% polyacrylamide gels in 0.5⫻ Tris-glycine buffer (12.5 mM Tris and 100 mM

glycine). The gels were dried and visualized by autoradiography. Some EMSA

reactions were run with no ZnCl2in the binding buffer.

In vitro protein synthesis and GST pull-down assay.Coupled in vitro tran-scription-translation reactions were conducted using a TNT kit in accordance with the manufacturer’s protocol (Promega). One microgram of plasmid

pcDNA3/IE1 DNA and 2␮l of [35_{S]methionine (1,000 Ci/mmol; 10 mCi/ml)}

were added to the TNT mixture (50-␮l total volume), and reactions were carried out at 30°C for 90 min. To ensure that there was no contamination by nucleic

acids, the purified proteins GST and GST-IE11–224 and the TNT product

[35_{S]methionine-labeled IE1 were all pretreated with nucleases (1 U DNase I}

[Invitrogen] and 0.5␮g RNase [Sigma]) for 1 h at 25°C in 50 mM Tris-HCl, pH

8, 5 mM MgCl2, 2.5 mM CaCl2, 100 mM NaCl, 5% glycerol, and 1 mM DTT.

Subsequently, equal amounts of the TNT product were incubated with GST-IE11–224(10␮g) or GST (10 ␮g) bound to glutathione-Sepharose beads in 150

␮l NETN buffer (20 mM Tris-HCl [pH 8.0], 100 mM NaCl, 1 mM EDTA, 0.5% NP-40, and a cocktail tablet of protease inhibitors [Roche]) in the presence of

ethidium bromide (100␮g/ml) at 4°C for 3 h. After three 10-min washes with

NETN buffer, the proteins that bound to the beads were resolved by 15% SDS-PAGE, and the gel was dried and exposed to Kodak Biomax MS film.

Coimmunoprecipitation.Sf9 cells were seeded on six-well plates (8⫻ 105

cells/well) and cotransfected with 2␮g pDHsp/IE1-V5-His and 2 ␮g pDHsp/

IE1-FLAG-His expression plasmid, using Cellfectin reagent. After transfection for 16 to 18 h, the cells were heat shocked in a 42°C water bath for 30 min and then returned to 27°C. Six hours after being heat shocked, the cells were washed

with PBS and lysed in 100␮l of NP-40 lysis buffer (50 mM Tris-HCl, pH 8.0, 150

mM NaCl, 1% NP-40) supplemented with a protease inhibitor cocktail tablet. The lysis procedure was carried out on ice for 10 min with occasional shaking.

The lysate was centrifuged at 12,000⫻ g for 5 min, and an aliquot of the

supernatant (10␮l) was reserved for immunoblot analysis to confirm the

expres-sion of the transfected gene. The remaining supernatant (90␮l) was then

incu-bated with 15␮l of anti-FLAG M2 affinity gel (Sigma) at 4°C overnight with

rotation. The gel was then washed five times in 150␮l of NP-40 lysis buffer.

Aliquots of the total cell lysates and immunoprecipitates were separated by 15% SDS-PAGE and transferred to a polyvinylidene difluoride membrane. V5-tagged IE1 fusion proteins were detected with rabbit anti-V5 antibody (Sigma) and goat anti-rabbit immunoglobulin G–horseradish peroxidase conjugate (Sigma). FLAG-tagged IE1 was detected with mouse anti-FLAG monoclonal antibody (Sigma) and goat anti-mouse immunoglobulin G–horseradish peroxidase conju-gate (Sigma).

Gel filtration.To evaluate the native molecular size of IE1, purified IE11–224

was analyzed using a Superdex 200-pg gel filtration column (Amersham Bio-sciences) (using buffer comprised of 500 mM NaCl, 1 mM DTT, 1 mM EDTA,

TABLE 3. Primers used for construction of GST-IE1 fusion proteins and IE1 expression plasmids

Plasmid Primer Primer sequence (5⬘–3⬘)a

pGST-IE1

1–224

IE1-1-F

CGGAATTCATGGCCTTTAATTTTGAAGACTC

IE1-224-R

CCGCTCGAGTTATACAAAGAATCCAGAAATC

pGST-VP36B

VP36B-F

GCATGAATTCATGGCGGTAAACTTGGATAATG

VP36B-R

GCAGCTCGAGTTATGTCCAACAATTTAAAAAG

pGST-IE1

81-224

IE1-81-F/IE1-224-R (see above)

CGGAATTCAACAGTGGTTCCCATGTCAAG

pGST-IE1

81–224 C2-H2mut

IE1-C2-mut-F

TGTAGGGCCAAGTACCCAGGC

IE1-C2-mut-R

CGCATTAGCTACAGAAAACAT

IE1-H2-mut-F

GGTGCTTCTGATTTGACATGT

IE1-H2-mut-R

CACTCCAGCGCCTTCAATAAC

pDHsp/IE1-V5-His

IE1-HindIII-F

CCCAAGCTTCTCAAGATGGCCTTTAATTTTG

IE1-SacII-R

TCCCCGCGGTACAAAGAATCCAGAAATCTCA

pDHsp/IE1-FLAG-His

IE1-HindIII-F (see above)/IE1-SacII-R (see above)

pcDNA3/IE1

IE1-HindIII-F (see above)/IE1-XhoI-R

CGCTCGAGTTATACAAAGAATCCAGAAAT

pET-28b(

⫹)/IE1

IE1-NdeI-F/IE1-XhoI-R (see above)

CCCATATGGCCTTTAATTTTGAAGAC

a_{Restriction enzyme cutting sites or mutated sites are underlined.}

at National Taiwan Univ. on May 8, 2009

jvi.asm.org

and 20 mM sodium acetate, pH 5.5). Gel filtration standard proteins (bovine serum albumin [67 kDa], ovalbumin [43 kDa], chymotrypsinogen A [25 kDa], and RNase A [13.7 kDa]) were used to calibrate the column. For each protein,

the logarithm of molecular mass was plotted against Kav, which was calculated as

follows: Kav⫽ (Ve⫺ Vo)/(Vt⫺ Vo), where Veis the elution volume, Vois the

column void volume using blue dextran 2000, and Vtis the total column bed

volume (120 ml for Superdex 200-pg gel filtration column).

WSSV IE1 antibody preparation.A PCR fragment representing the coding region of ie1 was amplified using the IE1-NdeI-F/IE1-XhoI-R primer set (Table 3), digested with restriction enzymes, and cloned into pET-28b(⫹) (Novagen). The resulting pET clone was transformed into BL21 cells. For protein expression and purification, the cells were grown overnight at 37°C in LB medium

supple-mented with 50␮g of kanamycin/ml and 34 ␮g of chloramphenicol/ml. The cells

were inoculated into new medium at a ratio of 1:50 and grown at 37°C for 2 to 2.5 h. Expression was induced by the addition of 1 mM IPTG, and incubation was continued for another 1.5 to 3 h. The induced bacteria were spun down at 4°C, suspended in ice-cold PBS containing 10% glycerol and a protease inhibitor cocktail tablet, and then sonicated for 3 min on ice. The insoluble debris was collected by centrifugation, suspended in PBS containing 1.5% sodium lauryl sarcosine, and solubilized by shaking at room temperature for 1 h. The super-natant was clarified by centrifugation and mixed with Ni-nitrilotriacetic acid-agarose beads (Qiagen) on a rotating wheel at 4°C for 16 h or overnight. The beads were then washed several times with ice-cold wash buffer (1 M NaCl, 10 mM Tris-HCl, pH 7.5) to remove unbound material. The fusion proteins were eluted directly from the beads with SDS sample buffer and then subjected to SDS-PAGE analysis. The protein bands containing the fusion proteins were sliced from the gel, minced, mixed with Freund’s adjuvant, and used for antibody production.

Glutaraldehyde cross-linking of proteins.For protein polymerization assays, Sf9 cells were transfected with pDHsp/IE1-V5-His plasmid DNA and heat shocked as described above. The transfected cells were then washed with PBS, lysed in a hypotonic buffer (10 mM Tris-HCl [pH 7.5], 10 mM KCl, and 5 mM

MgCl2), and incubated on ice for 20 min. The swollen cells were passed through

a 25-gauge needle 20 times to disrupt the cells. After centrifugation at 1,000⫻

g, the supernatant was incubated with glutaraldehyde (Sigma) at a final

concen-tration of 0.01% at room temperature for various times. The reactions were

stopped by the addition of an equal volume of 2⫻ SDS sample buffer, and the

samples were subjected to Western blotting using IE1 polyclonal antibody.

RESULTS

WSSV IE1 contains TADs.

As an initial indication of

whether the WSSV IE1 gene product contains a transcriptional

activation domain, the IE1 gene was fused to sequences

en-coding the 147-aa DBD of the yeast transcriptional activator

GAL4 (Fig. 1A). GAL4-IE1

1–224

transactivation was

moni-tored in transient expression assays in which Sf9 cells were

transfected with a reporter plasmid that contained the

lucifer-ase gene under the control of the basal promoter of the

AcMNPV p35 gene, with (G5p35

BAS

-Luc) or without (p35

BAS

-Luc) GAL4 DNA binding sites (Fig. 1B). The results showed

that GAL4-IE1

1–224

transactivation of the AcMNPV p35 basal

promoter was about 10 times greater when the reporter

plas-FIG. 1. GAL4-dependent IE1 transactivation. (A) Schematic

rep-resentation of the three effector plasmids. For wild-type (wt) IE1

1–224

,

amino acids 1 to 224 from IE1 (dark gray bar) were placed under the

control of the WSSV ie1 promoter. GAL4 DBD had aa 1 to 147 of the

GAL4 DBD (gray bar). For the hybrid GAL4-IE1

1–224

, both sequences

were fused as shown. The V5 epitope (arrowhead) was inserted after

DBD residue 147 or IE1 residue 224. (B) The reporter plasmid

p35

BAS

-Luc contains the baculovirus p35 basal (BAS) promoter

(TATA box and RNA start site) linked to the firefly luciferase gene

(dark gray arrow). G5p35

BAS

-Luc is identical to p35

BAS

-Luc except for

the presence of five GAL4 binding sites (solid boxes) upstream of the

TATA element. (C) Transactivation by GAL4-IE1

1–224

. Sf9 cells were

cotransfected with 300 ng of the indicated reporter plasmid, 500 ng of

one of the different effector plasmids or empty vector, and 100 ng of

the Renilla luciferase gene plasmid, phRL/AcMNPVie1, to correct for

transactivation efficiency. Relative luciferase activity was normalized to

that of G5p35

BAS

-Luc with GAL4-IE1

1–224

, which was arbitrarily set to

100%. Data show the means of six repetitions, and error bars show the

SD. (D) Western blot analysis was used to confirm the expression of

chimeric GAL4-IE1

1–224

, GAL4 DBD, and IE1

1–224

proteins. Protein

extracts corresponding to approximately 1

_{⫻ 10}

5

_{cells/lane were}

sep-arated by SDS-PAGE and examined by Western blot analysis with an

anti-V5 antiserum.

at National Taiwan Univ. on May 8, 2009

jvi.asm.org

mid included the five GAL4 binding sites (Fig. 1C). In contrast,

the presence of the GAL4 DNA binding sites had no effect on

the low transactivation activity exhibited by the wild-type IE1

1–224

construct, while the GAL4 DBD control also showed only low

levels of transactivation (Fig. 1C). Expression of the various

constructs was confirmed by Western blotting (Fig. 1D). We

concluded that WSSV IE1 contains at least one domain that

functions as a transcriptional activator. This conclusion was

further supported by yeast two-hybrid experiments showing

that WSSV IE1 is a strong autoactivator (data not shown).

Mapping of the WSSV IE1 TAD.

In order to determine the

essential domains for transactivation, three series of deletion

mutants of WSSV IE1 were generated and constructed as

fusion proteins with the GAL4 DBD at the N terminus (Fig.

2A, B, and C). Additional V5 tags were attached to the C

termini of these fusion proteins for Western blot analysis (Fig.

2D). The various constructs encoding the IE1 deletion mutants

were transfected into Sf9 cells together with the

GAL4-respon-sive reporter plasmid G5p35

BAS

-Luc. Surprisingly, coarse

mapping (Fig. 2A) showed that the transactivation activity of

most of the IE1 mutants was almost completely abolished,

except for that of GAL4-IE1

1–92

, which exhibited an activity

that was 2 times higher than that of the full-length IE1 fusion

protein and 5.4 times higher than that of the GAL4 DBD

construct. These initial results suggested that WSSV IE1

res-idues 1 to 92 function as a TAD, that resres-idues 50 to 92 may be

critical for this function (compare GAL4-IE1

1–49

to

GAL4-IE1

1–92

), and that residues 93 to 137 may inhibit this

transac-tivation activity (compare GAL4-IE1

1–92

to GAL4-IE1

1–137

).

Next, the series of N-terminal and C-terminal truncation

con-structs, shown in Fig. 2B and C, respectively, were designed to

more finely delineate the boundaries of the N-terminal

activa-tion domain. Transfecactiva-tion with these series showed that

resi-dues 1 to 80 exhibited an even stronger transactivation activity

than residues 1 to 92 did (Fig. 2C), which is consistent with the

results for GAL4-IE1

81–224

versus GAL4-IE1

92–224

(Fig. 2A).

These results suggest that the minimal IE1 TAD may be

lo-cated within aa 1 to 80. Two additional potential inhibitory

domains were also identified. The results of deletions made in

the region of aa 1 to 49 suggested that amino acid residues 41

to 49 might act as an inhibitory domain (Fig. 2B, compare

GAL4-IE1

50–92

to

GAL4-IE1

20–92

,

GAL4-IE1

30–92

,

and

GAL4-IE1

40–92

). The other possible inhibitory domain was

identified at residues 81 to 92 (Fig. 2C, compare GAL4-IE1

1–92

to GAL4-IE1

1–80

), although we note that the different

activa-tion levels might have been due, at least in part, to the larger

quantity of expressed GAL4-IE1

1–80

fusion protein. The

West-ern blots in Fig. 2D confirmed that all of these constructs were

successfully expressed. Note that every deletion mutant had a

higher expression level than that of the wild-type IE1 fusion

protein (compare Fig. 2D to Fig. 1D). These higher expression

levels were probably due to the shorter lengths of the

tran-scripts and encoded proteins, which would lead to increased

transcriptional and translational efficiencies.

Negatively charged amino acids are important for IE1

transactivation activity.

Sequence analysis shows that there are

12 acidic amino acids and 6 basic residues in the IE1 minimal

TAD (aa 1 to 80), giving the TAD a net negative charge of

⫺6

and a pI of 4.3. Since most TADs can be classified as either

acidic activators (46), glutamine-rich activators (11), aromatic

and hydrophobic activators (44), or proline-rich activators

(37), the acidity of the WSSV IE1 TAD suggested that it might

fall within the acidic class of activation domains. We

investi-gated this possibility by constructing mutants (Table 2) in

which alanine (A) was used to replace the wild-type aspartate

(D), glutamate (E), or glycine (G) residues. GAL4

transacti-vation assays showed that almost all of these alanine

substitu-tions significantly reduced G5p35

BAS

-Luc activation (P

⬍

0.01). Replacement of increasing numbers of acidic residues

led to a further decrease in transactivation activity (Fig. 3A),

while substitutions of nonacidic residues (G20A and G41A)

(Fig. 3A) had no significant effect on transactivation. We

there-fore concluded that the negatively charged residues are critical

for WSSV IE1 transactivation activity. An immunoblot analysis

of the mutated IE1 proteins after a typical transfection showed

that most of the alanine substitution mutants produced

pro-teins at levels close to that of the wild-type construct (Fig. 3B).

Only the E71A/D72A mutant exhibited a very low level of

protein expression. This may have been due to instability and

rapid degradation of the expressed protein, which might in

turn explain why this protein exhibited the lowest

transactiva-tion activity in Fig. 3B. Meanwhile, the results for all other

mutants indicate that in the case of IE1, as with other virus

immediate-early proteins, specific acidic amino acids are

par-ticularly critical to transcriptional function (6, 15).

DNA binding activity of WSSV IE1.

The DNA binding

ac-tivity of WSSV IE1 was investigated by gel mobility shift assays

using a 79-bp double-stranded DNA oligonucleotide

contain-ing a central 25-bp randomized sequence. GST-tagged versions

of IE1 and VP36B (a WSSV structural protein which served as

a negative control) were expressed in E. coli to produce either

GST-IE1

1–224

, GST-VP36B, or IE1

1–224

alone. These soluble,

well-expressed proteins were then purified with

glutathione-Sepharose beads (Fig. 4A). The entire purification process was

conducted in the presence of EDTA to ensure that the

ex-pressed proteins were free of Zn

2⫹

contamination. Purified

IE1

1–224

and GST-IE1

1–224

proteins both retarded the

migra-tion of the oligonucleotide and formed major discrete bands by

7.5% native PAGE (Fig. 4B, lanes 4 to 6 and 7 to 9,

respec-tively). Furthermore, the intensities of these bands increased

with increasing amounts of purified protein. In contrast, no

complex was formed with the GST or with the purified WSSV

structural protein control GST-VP36B (Fig. 4B, lanes 1 to 3

and 11). The last three lanes in Fig. 4B show that Zn

2⫹

is not

required for the DNA binding activity of IE1

1–224

. These

pre-liminary data suggested that even though the ie1 coding region

contains a Cys

2

/His

2

-type zinc finger motif (X

3

-Cys-X

3–4

-Cys-X

12

-His-X

3–4

-His-X

4

) (31), WSSV IE1 may not in fact be a

zinc finger protein. This was further investigated in the

follow-ing experiments.

The WSSV IE1 C-terminal region is required for DNA

bind-ing.

Since DBDs and TADs usually do not overlap, we

hypoth-esized that the DBD of IE1 was located in the C-terminal

region. To test this hypothesis, we expressed and purified two

GST-IE1 proteins: GST-IE1

81–224

was a deletion without the

N-terminal TAD, and GST-IE1

81–224C2-H2mut

was identical

ex-cept for a mutated zinc finger motif (Fig. 5A). An SDS-PAGE

gel of these two fusion proteins is shown in Fig. 5B. The lower

band, at

⬃26 kDa, was confirmed by Western blot analysis to

be nonfused GST (data not shown). The EMSA showed that

at National Taiwan Univ. on May 8, 2009

jvi.asm.org

FIG. 2. Identification of IE1 TAD. (A to C) Three series of deletion assays to identify the location of the IE1 TAD. The GAL4-IE1 fusion

proteins were constructed by joining the GAL4 DBD from amino acids 1 to 147 (gray bar) to the indicated segments of IE1 (dark gray bars). Sf9

cells were cotransfected with reporter plasmid G5p35

BAS

-Luc, the indicated GAL4-IE1 fusion plasmids, GAL4 DBD, or empty vector, and 100 ng

of the Renilla luciferase gene plasmid, phRL/AcMNPVie1, and then assayed for luciferase activity. Relative luciferase activities were normalized

with respect to that of GAL4-IE1

1–92

, which was arbitrarily set to 100%. Data show the means of six repetitions, and error bars show the SD.

(D) Western blot analysis of chimeric GAL4-IE1 proteins was performed as described in the legend to Fig. 1.

at National Taiwan Univ. on May 8, 2009

jvi.asm.org

when the TAD was deleted, IE1 was still able to bind DNA in

either the presence or absence of Zn

2⫹

(Fig. 5C, lanes 2 to 4

and 5 to 7). When the deletion’s zinc finger domain was point

mutated, DNA binding activity was not markedly affected in

either the presence or absence of Zn

2⫹

(Fig. 5C, lanes 8 to 10

and 11 to 13). The binding activity of the mutant was not

affected by the presence of Zn

2⫹

ions.

IE1 has a strong affinity for self-interaction.

Many virus

immediate-early proteins are in dimeric form when they bind

to DNA (8, 16, 40, 57). We therefore performed an in vitro

biochemical binding assay to determine whether IE1 can also

self-interact directly. For this assay, the GST-IE1

1–224

fusion

protein was bound to glutathione-Sepharose beads and

incu-bated with in vitro-translated, [

35

_{S]methionine-labeled IE1.}

SDS-PAGE analysis showed that

35

_{S-labeled IE1 bound to the}

GST-IE1

1–224

fusion protein but not to GST, indicating that

IE1 can interact directly with itself (Fig. 6A). We also studied

the homotypic interaction between IE1 proteins by a

coimmu-noprecipitation assay using V5-tagged and FLAG-tagged

ver-sions of IE1 expressed in Sf9 insect cells. Complexes consisting

of IE1-V5 plus IE1-FLAG were coimmunoprecipitated by

anti-FLAG antiserum and detected by Western blotting using

anti-V5 antibody (Fig. 6B). Both sets of results indicated that

IE1 can undergo specific self-interaction directly.

IE1 protein forms a dimer.

Both gel filtration

chromatogra-phy and chemical cross-linking were used to investigate the

form of IE1 polymerization. Gel filtration chromatography

using a Superdex 200-pg gel filtration column revealed that the

major peak of purified IE1 eluted with an apparent molecular

size of 46 kDa, as calculated from the logarithm of molecular

size against the K

av

values of protein standards that were

frac-tionated in the same column (Fig. 6C, inset). In addition to the

major elution fraction, some IE1 was also found in fractions

where the 25-kDa chymotrypsinogen A appeared (Fig. 6C).

Since IE1 is composed of 224 aa residues, with a molecular size

of approximately 25 kDa, these results suggest that a portion of

IE1 is in the monomeric state, most likely in dynamic

equilib-rium with the dimeric form. This finding suggested that IE1

exists mainly as a dimer in solution. For the cross-linking study,

Sf9 cells were transfected with an expression plasmid that

contained the full-length IE1 coding region under the control

of the Drosophila heat shock protein 70 promoter. The cellular

lysates were cross-linked with glutaraldehyde, and IE1 was

detected by immunoblotting using anti-IE1 antibody. With

in-FIG. 3. Effects of substituting alanine (A) for the negatively charged acidic amino acids in the IE1 TAD. Labels indicate the original amino

acid(s) (D, aspartate; E, glutamate; and G, glycine [control]) and its location relative to the N terminus of the IE1 coding region. (A) The reporter

plasmid was cotransfected into Sf9 cells with effector plasmids expressing the IE1 wild-type TAD or the indicated point mutants and with the

Renilla luciferase gene plasmid. Relative luciferase activities were normalized with respect to that of GAL4-IE1

1–80

(wild-type TAD), which was

defined as 100%. Data show the means of six repetitions, and error bars show the SD. Activities that were significantly different from that of

wild-type TAD are indicated with asterisks (P

⬍ 0.01). (B) Western blot analysis of GAL-IE1 wild-type TAD and its substitution mutants was

performed as described in the legend to Fig. 1. The lower panel shows the internal control: total proteins were probed using anti-

␤-actin antibody.

at National Taiwan Univ. on May 8, 2009

jvi.asm.org

creasing treatment time, there was a steady accumulation of

dimeric (50 kDa) IE1 (Fig. 6D). Since IE1 was expressed at

extremely high levels under these conditions, the amount of

monomeric polypeptide (25 kDa) did not decrease

signifi-cantly, even when there was extensive dimer formation.

DISCUSSION

Our data suggest that the IE1 residues sufficient for

trans-activation are confined to the N terminus (Fig. 2). The

N-terminal stretch of IE1 from residues 1 to 80 is highly acidic,

with a net charge of

⫺6 and a theoretical pI of 4.3. Acid-rich

transactivation regions are characteristic of acidic

transactiva-tors (26, 46), and to determine which amino acids are involved

in mediating the activity of this domain, point mutations were

introduced into the sequence. Our results (Fig. 3A) showed

that the double mutations generally had a greater effect on

activation than the single mutations did, that the triple and

quadruple mutations had an even greater effect, and that the

glycine mutants were not significantly different from the

wild-type TAD control. This is in broad agreement with previous

mutational analyses of the activation domains of GAL4,

GCN4, and the herpes simplex virus (HSV) transactivator

VP16, all of which revealed a positive correlation between the

number of acidic amino acids and the transcriptional ability of

the acidic activation domains (12, 18, 21). Clearly, however, net

negative charge was not the sole determinant of activity,

be-cause some residues were more critical than others. For

in-stance, the E59A mutation reduced activity further than the

E78A mutation did, and activity was lower with E34A/E43A

mutations than with E75A/D76A mutations. These results

in-dicate that the transcriptional activity is dependent not only on

the net negative charge but also on the position of the acidic

residue in the WSSV IE1 TAD. To explain why some acidic

residues might be more important than others, we note that

acidic activators interact with general transcription factors such

as transcription factor IIB and TATA-box binding protein (3,

25, 45), and we further note that in the case of the TAD of

FIG. 4. DNA binding activity of IE1 and effect of zinc ions on DNA binding. (A) SDS-PAGE analysis of purified proteins used for EMSA.

(B) EMSA was performed with a radiolabeled 79-bp DNA probe and 0.5 to 3

_{␮g of the indicated proteins. Lane 10 contained no protein and was}

used as a negative control. The bands containing the protein-DNA complexes are indicated.

at National Taiwan Univ. on May 8, 2009

jvi.asm.org

HSV VP16, one specific acidic residue (E476) was shown to be

the most important residue for this transactivator’s interaction

with the human general cofactor PC4 (25). Since IE1 also

presumably interacts with various factors and cofactors, we

therefore hypothesize that each of these interactions is likewise

mediated by specific acidic residues. Alternatively, it is also

possible that mutation of the acidic amino acids in IE1’s TAD

may diminish IE1’s activity by disrupting its secondary

struc-ture, as shown for other transcription factors (13, 48).

In the region of the TAD (aa 1 to 80) of WSSV IE1, three

possible inhibitory domains were identified, at aa 41 to 49, aa

81 to 92, and aa 93 to 137. To date, little is known about

sequences which mediate transcription inhibition and which

are present within transcriptional activators. We note,

how-ever, that the WSSV IE1 potential inhibitory domain from aa

41 to 49 contains a large proportion of positively charged

amino acids (GIEVMKRRL [the three basic residues are

un-derlined]). Slack and Blissard (50) suggested that the

substan-tial concentrations of positively charged amino acids in two

inhibition domains of the baculovirus AcMNPV IE1 may act to

neutralize the adjacent activation region. It is possible that the

basic amino acids in WSSV IE1 aa 41 to 49 are likewise

re-sponsible for negatively regulating WSSV IE1’s transcriptional

activation. The putative WSSV IE1 inhibitory domains at aa 81

to 92 and aa 93 to 137 do not contain large proportions of basic

residues. If they regulate the TAD activity, it is therefore

probable that they do so either by direct interactions with

components of the general transcription factors (4, 51) or by

indirect interactions through secondary “inhibitor” proteins

that mask the activation domain (2, 5).

In addition to the TAD, most transcriptional factors also

require a second region that confers specificity for target

genes. This region may confer target gene specificity either

directly (in the form of a DBD) or indirectly (by serving as an

interface for protein-protein interactions with factors bound to

target genes). Our EMSA results (Fig. 5C) suggested that IE1

has a DBD in the C terminus, and a previous amino acid

sequence analysis of this region identified a putative classic

zinc finger Cys

2

/His

2

domain between aa 186 and 215 (31).

When this zinc finger motif was mutated, however, the mutant

protein still retained its ability to bind DNA, and the absence

of Zn

2⫹

failed to impair this ability (Fig. 5C, lanes 8 to 10 and

11 to 13). We therefore concluded that IE1’s putative zinc

finger motif cannot be directly responsible for its DNA binding

activity. In further support of this conclusion, we also note that

classic zinc finger motifs usually contain a compact

␤␤␣

struc-ture (27, 41, 43, 58), but the predicted secondary strucstruc-ture of

the WSSV IE1 zinc finger motif obtained using the NNpredict,

SOPMA, JPRED, and PHD programs (http://ca.expasy.org

/tools/) does not contain this conserved structure (data not

shown).

When there is only a single predicted zinc finger in a

tran-scription factor (for example, human cytomegalovirus

imme-diate-early protein IE2 [1]), it is not always used to bind DNA.

On the contrary, when transcription factors use zinc fingers to

bind DNA, there are usually several (often three or more)

fingers involved (24, 36, 58). Furthermore, the involvement of

zinc finger motifs in other activities has also been documented

for viruses. For instance, the herpesvirus saimiri

immediate-early protein ORF57 is a transcriptional activator with a zinc

finger-like domain in its C terminus, and during a herpesvirus

saimiri infection, this domain is required for transactivation,

repression of viral proteins, and the redistribution of the host

splicing factor SC-35 (19). Other examples include adenovirus

E1A, which has a zinc finger domain that functions in

protein-protein interactions and transactivation activity (17, 47), and

HSV type 1 immediate-early protein ICP27, whose C-terminal

zinc finger domain is required for ICP27 self-interaction (61).

In the case of IE1, several observations are relevant to the

possible function of its zinc finger. Like many other virus

im-mediate-early proteins that bind DNA in a dimeric form (8, 16,

40, 57), our evidence suggests that WSSV IE1 also has this

FIG. 5. The DNA binding domain of IE1 is located in the C terminus,

and the putative zinc finger motif is not essential for DNA binding.

(A) Schematic representation of the GST-IE1 fusion proteins used for the

EMSA reaction. In GST-IE1

81–224

, the IE1 N-terminal TAD was deleted;

in GST-IE1

81–224C2-H2mut

, the cysteine and histidine residues in the

puta-tive zinc finger motif were also replaced by alanine. (B) SDS-PAGE

analysis of the purified proteins used for EMSA reactions. (C) DNA

binding properties of the IE1 N-terminally truncated fusion proteins.

Both GST-IE1

81–224

(0.5 to 3

␮g) and GST-IE1

81–224 C2-H2mut

(0.5 to 3

␮g)

were detected by EMSA, regardless of whether Zn ions were present in

the DNA binding buffer. The arrows indicate the protein-DNA

com-plexes.

at National Taiwan Univ. on May 8, 2009

jvi.asm.org

characteristic. Starting from the EMSA results (Fig. 4B and

5C), the presence of only a single band of IE1-DNA complex

suggests that only a single form of IE1 was involved in DNA

binding. This single form was most likely the IE1 homodimer,

because when the same purified IE1

1–224

construct that was

used for Fig. 4B was subjected to gel filtration

chromatogra-phy, IE1’s apparent molecular size was 46 kDa (i.e.,

approxi-mately double the predicted molecular size of the IE1

mono-mer [

⬃25 kDa]). IE1’s ability to self-interact is also supported

by the GST pull-down and coimmunoprecipitation data (Fig.

6A and B) and by the glutaraldehyde cross-linking analysis

(Fig. 6D). Thus, it is possible that, as in ICP27 (61), the

puta-tive zinc finger motif of WSSV IE1 may be involved in the

formation of the IE1 homodimer. More work will be needed to

investigate this possibility and to elucidate the mechanisms

involved.

In conclusion, we have been able to ascribe several functions

to separate regions of the WSSV IE1 protein. Our data suggest

that WSSV IE1 has at least two distinguishable domains, an

N-terminal region that is essential for transactivation and a

C-terminal region that is required for DNA binding activity.

We also conclude that IE1 probably occurs primarily as a

homodimeric protein.

ACKNOWLEDGMENTS

This investigation was supported financially by a National Science

Council grant (NSC96-2317-B-002-005) and by the Council of

Agri-culture (97AS-14.1.1-AQ-B1).

We are indebted to Paul Barlow for his helpful criticism.

REFERENCES

1. Asmar, J., L. Wiebusch, M. Truss, and C. Hagemeier. 2004. The putative zinc finger of the human cytomegalovirus IE2 86-kilodalton protein is dis-pensable for DNA binding and autorepression, thereby demarcating a con-cise core domain in the C terminus of the protein. J. Virol. 78:11853–11864. 2. Baichwal, V. R., A. Park, and R. Tjian. 1992. The cell-type-specific activator region of c-Jun juxtaposes constitutive and negatively regulated domains. Genes Dev. 6:1493–1502.

3. Blair, W. S., H. P. Bogerd, S. J. Madore, and B. R. Cullen. 1994. Mutational analysis of the transcription activation domain of RelA: identification of a highly synergistic minimal acidic activation module. Mol. Cell. Biol. 14:7226– 7234.

FIG. 6. Homotypic interaction and dimerization of IE1. (A) SDS-PAGE analysis showing the reaction of GST-IE1 fusion protein with

[

35

_{S]methionine-labeled IE1 protein (input). The full-length IE1 protein is indicated by the arrow. (B) Self-interaction of IE1 demonstrated by}

coimmunoprecipitation. V5-tagged IE1 was transiently coexpressed in Sf9 cells with FLAG-tagged IE1. Six hours after being heat shocked, the cell

lysates were harvested and immunoprecipitated with anti-FLAG M2 affinity resins. The immunoprecipitated complexes were then subjected to

Western blot analysis with anti-V5 antibody. The detected V5-tagged IE1 is indicated by the arrow. The two panels on the left show the

FLAG-and V5-tagged IE1 inputs. (C) Size exclusion chromatography of IE1 on a Superdex 200-pg gel filtration column monitored at 280 nm. The protein

standards bovine serum albumin (BSA; 67 kDa), ovalbumin (OA; 43 kDa), chymotrypsinogen A (CT; 25 kDa), and RNase A (13.7 kDa) were

fractionated on the same column. The inset shows a plot of the K

av

for each protein against the logarithm of its molecular size (log MWt).

(D) Kinetic study of glutaraldehyde cross-linking of IE1 expressed in Sf9 cells. Transiently expressed V5-tagged IE1 was treated with 0.01%

glutaraldehyde for the indicated times at room temperature and subjected to Western blotting with anti-IE1 antibody. Mock, transfection with

vector plasmid.

at National Taiwan Univ. on May 8, 2009

jvi.asm.org

4. Boyd, J. M., P. M. Loewenstein, Q. Tang, L. Yu, and M. Green. 2002. Adenovirus E1A N-terminal amino acid sequence requirements for repres-sion of transcription in vitro and in vivo correlate with those required for E1A interference with TBP-TATA complex formation. J. Virol. 76:1461– 1474.

5. Brown, H. J., J. A. Sutherland, A. Cook, A. J. Bannister, and T. Kouzarides. 1995. An inhibitor domain in c-Fos regulates activation domains containing the HOB1 motif. EMBO J. 14:124–131.

6. Buczynski, K. A., S. K. Kim, and D. J. O’Callaghan. 1999. Characterization of the transactivation domain of the equine herpesvirus type 1 immediate-early protein. Virus Res. 65:131–140.

7. Chen, L.-L., H.-C. Wang, C.-J. Huang, S.-E. Peng, Y.-G. Chen, S.-J. Lin,

W.-Y. Chen, C.-F. Dai, H.-T. Yu, C.-H. Wang, C.-F. Lo, and G.-H. Kou.2002. Transcriptional analysis of the DNA polymerase gene of shrimp white spot syndrome virus. Virology 301:136–147.

8. Chiou, C.-J., J. Zong, I. Waheed, and G. S. Hayward. 1993. Identification and mapping of dimerization and DNA-binding domains in the C terminus of the IE2 regulatory protein of human cytomegalovirus. J. Virol. 67:6201–6214. 9. Choi, Y.-S., and S. Sinha. 2006. Determination of the consensus

DNA-binding sequence and a transcriptional activation domain for ESE-2. Bio-chem. J. 398:497–507.

10. Chou, H.-Y., C.-Y. Huang, C.-H. Wang, H.-C. Chiang, and C.-F. Lo. 1995. Pathogenicity of a baculovirus infection causing white spot syndrome in cultured penaeid shrimp in Taiwan. Dis. Aquat. Organ. 23:165–173. 11. Courey, A. J., D. A. Holtzman, S. P. Jackson, and R. Tjian. 1989. Synergistic

activation by the glutamine-rich domains of human transcription factor Sp1. Cell 59:827–836.

12. Cress, W. D., and S. J. Triezenberg. 1991. Critical structural elements of the VP16 transcriptional activation domain. Science 251:87–90.

13. Defossez, P. A., J. L. Baert, M. Monnot, and Y. de Launoit. 1997. The ETS family member ERM contains an alpha-helical acidic activation domain that contacts TAFII60. Nucleic Acids Res. 25:4455–4463.

14. Flegel, T. W. 1997. Special topic review: major viral diseases of the black tiger prawn (Penaeus monodon) in Thailand. World J. Microbiol. Biotech. 13:422– 433.

15. Forsythe, I. J., C. E. Shippam, L. G. Willis, S. Stewart, T. Grigliatti, and

D. A. Theilmann.1998. Characterization of the acidic domain of the IE1 regulatory protein from Orgyia pseudotsugata multicapsid nucleopolyhedro-virus. Virology 252:65–81.

16. Gallinari, P., K. Wiebauer, M. C. Nardi, and J. Jiricny. 1994. Localization of a 34-amino-acid segment implicated in dimerization of the herpes simplex virus type 1 ICP4 polypeptide by a dimerization trap. J. Virol. 68:3809–3820. 17. Geisberg, J. V., W. S. Lee, A. J. Berk, and R. P. Ricciardi. 1994. The zinc finger region of the adenovirus E1A transactivating domain complexes with the TATA box binding protein. Proc. Natl. Acad. Sci. USA 91:2488–2492. 18. Gill, G., and M. Ptashne. 1987. Mutants of GAL4 protein altered in an

activation function. Cell 51:121–126.

19. Goodwin, D. J., K. T. Hall, M. S. Giles, M. A. Calderwood, A. F. Markham,

and A. Whitehouse.2000. The carboxy terminus of the herpesvirus saimiri ORF 57 gene contains domains that are required for transactivation and transrepression. J. Gen. Virol. 81:2253–2265.

20. Hemsley, A., N. Arnheim, M. D. Toney, G. Cortopassi, and D. J. Galas. 1989. A simple method for site-directed mutagenesis using the polymerase chain reaction. Nucleic Acids Res. 17:6545–6551.

21. Hope, I. A., S. Mahadevan, and K. Struhl. 1988. Structural and functional characterization of the short acidic transcriptional activation region of yeast GCN4 protein. Nature 333:635–640.

22. Hossain, M. S., S. Khadijah, and J. Kwang. 2004. Characterization of ORF89—a latency-related gene of white spot syndrome virus. Virology 325: 106–115.

23. Inouye, K., S. Miwa, N. Oseko, H. Nakano, and T. Kimura. 1994. Mass mortalities of cultured kuruma shrimp, Penaeus japonicus, in Japan in 1993: electron microscopic evidence of the causative virus. Fish Pathol. 29:149– 158.

24. Iuchi, S. 2001. Three classes of C2H2zinc finger proteins. Cell. Mol. Life Sci.

58:625–635.

25. Jonker, H. R., R. W. Wechselberger, R. Boelens, G. E. Folkers, and R.

Kaptein.2005. Structural properties of the promiscuous VP16 activation domain. Biochemistry 44:827–839.

26. Kovacs, G. R., J. Choi, L. A. Guarino, and M. D. Summers. 1992. Functional dissection of the Autographa californica nuclear polyhedrosis virus immedi-ate-early 1 transcriptional regulatory protein. J. Virol. 66:7429–7437. 27. Lee, M. S., G. P. Gippert, K. V. Soman, D. A. Case, and P. E. Wright. 1989.

Three-dimensional solution structure of a single zinc finger DNA-binding domain. Science 245:635–637.

28. Leu, J.-H., Y.-C. Kuo, G.-H. Kou, and C.-F. Lo. 2008. Molecular cloning and characterization of an inhibitor of apoptosis protein (IAP) from the tiger shrimp, Penaeus monodon. Dev. Comp. Immunol. 32:121–133.

29. Lin, Y.-S., M. Carey, M. Ptashne, and M. R. Green. 1990. How different eukaryotic transcriptional activators can cooperate promiscuously. Nature

345:359–361.

30. Liu, W.-J., Y.-S. Chang, A. H.-J. Wang, G.-H. Kou, and C.-F. Lo. 2007. White

spot syndrome virus annexes a shrimp STAT to enhance expression of the immediate-early gene ie1. J. Virol. 81:1461–1471.

31. Liu, W.-J., Y.-S. Chang, C.-H. Wang, G.-H. Kou, and C.-F. Lo. 2005. Mi-croarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp. Virology 334:327–341. 32. Lo, C.-F., C.-H. Ho, C.-H. Chen, K.-F. Liu, Y.-L. Chiu, P.-Y. Yeh, S.-E. Peng,

H.-C. Hsu, H.-C. Liu, C.-F. Chang, M.-S. Su, C.-H. Wang, and G.-H. Kou.

1997. Detection and tissue tropism of white spot syndrome baculovirus (WSBV) in captured brooders of Penaeus monodon with a special emphasis on reproductive organs. Dis. Aquat. Organ. 30:53–72.

33. Lo, C.-F., C.-H. Ho, S.-E. Peng, C.-H. Chen, H.-C. Hsu, Y.-L. Chiu, C.-F.

Chang, K.-F. Liu, M.-S. Su, C.-H. Wang, and G.-H. Kou.1996. White spot syndrome baculovirus (WSBV) detected in cultured and captured shrimp, crabs and other arthropods. Dis. Aquat. Organ. 27:215–225.

34. Lu, L., H. Wang, I. Manopo, L. Yu, and J. Kwang. 2005. Baculovirus-mediated promoter assay and transcriptional analysis of white spot syndrome virus orf427 gene. Virol. J. 2:71. http://www.virologyj.com/content/2/1/71. 35. Massari, M. E., and C. Murre. 2000. Helix-loop-helix proteins: regulators of

transcription in eucaryotic organisms. Mol. Cell. Biol. 20:429–440. 36. McDowall, J. 2007. Protein of the month: zinc fingers. http://www.ebi.ac.uk

/interpro/potm/2007_3/Page1.htm.

37. Mermod, N., E. A. O’Neill, T. J. Kelly, and R. Tjian. 1989. The proline-rich transcriptional activator of CTF/NF-I is distinct from the replication and DNA binding domain. Cell 58:741–753.

38. Momoyama, K., M. Hiraoka, H. Nakano, H. Koube, K. Inouye, and N.

Oseko.1994. Mass mortalities of cultured kuruma shrimp, Penaeus japonicus, in Japan in 1993: histopathological study. Fish Pathol. 29:141–148. 39. Nakano, H., H. Koube, S. Umezawa, K. Momoyama, M. Hiraoka, K. Inouye,

and N. Oseko.1994. Mass mortalities of cultured kuruma shrimp, Penaeus

japonicus, in Japan in 1993: epizootiological survey and infection trails. Fish

Pathol. 29:135–139.

40. Olson, V. A., J. A. Wetter, and P. D. Friesen. 2003. The highly conserved basic domain I of baculovirus IE1 is required for hr enhancer DNA binding and hr-dependent transactivation. J. Virol. 77:5668–5677.

41. Parraga, G., S. J. Horvath, A. Eisen, W. E. Taylor, L. Hood, E. T. Young, and

R. E. Klevit.1988. Zinc-dependent structure of a single-finger domain of yeast ADR1. Science 241:1489–1492.

42. Patikoglou, G., and S. K. Burley. 1997. Eukaryotic transcription factor-DNA complexes. Annu. Rev. Biophys. Biomol. Struct. 26:289–325.

43. Pavletich, N. P., and C. O. Pabo. 1991. Zinc finger-DNA recognition: crystal structure of a Zif268-DNA complex at 2.1 A. Science 252:809–817. 44. Regier, J. L., F. Shen, and S. J. Triezenberg. 1993. Pattern of aromatic and

hydrophobic amino acids critical for one of two subdomains of the VP16 transcriptional activator. Proc. Natl. Acad. Sci. USA 90:883–887. 45. Roberts, S. G., I. Ha, E. Maldonado, D. Reinberg, and M. R. Green. 1993.

Interaction between an acidic activator and transcription factor TFIIB is required for transcriptional activation. Nature 363:741–744.

46. Sadowski, I., J. Ma, S. Triezenberg, and M. Ptashne. 1988. GAL4-VP16 is an unusually potent transcriptional activator. Nature 335:563–564.

47. Sanchez, T. A., I. Habib, J. L. Booth, S. M. Evetts, and J. P. Metcalf. 2000. Zinc finger and carboxyl regions of adenovirus E1A 13S CR3 are important for transactivation of the cytomegalovirus major immediate early promoter by adenovirus. Am. J. Respir. Cell Mol. Biol. 23:670–677.

48. Schmitz, M. L., M. A. dos Santos Silva, H. Altmann, M. Czisch, T. A. Holak,

and P. A. Baeuerle.1994. Structural and functional analysis of the NF-kappa B p65 C terminus. An acidic and modular transactivation domain with the potential to adopt an alpha-helical conformation. J. Biol. Chem. 269:25613– 25620.

49. Sekimata, M., and Y. Homma. 2004. Sequence-specific transcriptional re-pression by an MBD2-interacting zinc finger protein MIZF. Nucleic Acids Res. 32:590–597.

50. Slack, J. M., and G. W. Blissard. 1997. Identification of two independent transcriptional activation domains in the Autographa californica multicapsid nuclear polyhedrosis virus IE1 protein. J. Virol. 71:9579–9587.

51. Song, C.-Z., P. M. Loewenstein, K. Toth, and M. Green. 1995. Transcription factor TFIID is a direct functional target of the adenovirus E1A transcrip-tion-repression domain. Proc. Natl. Acad. Sci. USA 92:10330–10333. 52. Stenberg, R. M. 1996. The human cytomegalovirus major immediate-early

gene. Intervirology 39:343–349.

53. Takahashi, Y., T. Itami, M. Kondo, M. Maeda, R. Fujii, S. Tomonaga, K.

Supamattaya, and S. Boonyaratpalin.1994. Electron microscopic evidence of bacilliform virus infection in kuruma shrimp (Penaeus japonicus). Fish Pathol. 29:121–125.

54. Triezenberg, S. J. 1995. Structure and function of transcriptional activation domains. Curr. Opin. Gen. Dev. 5:190–196.

55. van Hulten, M. C. W., J. Witteveldt, S. Peters, N. Kloosterboer, R. Tarchini,

M. Fiers, H. Sandbrink, R. K. Lankhorst, and J. M. Vlak.2001. The white spot syndrome virus DNA genome sequence. Virology 286:7–22. 56. Vlak, J. M., J. R. Bonami, T. W. Flegel, G.-H. Kou, D. V. Lightner, C.-F. Lo,

P. C. Loh, and P. J. Walker.2004. Nimaviridae, p. 187–192. In C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger, and L. A. Ball (ed.), VIIIth report

at National Taiwan Univ. on May 8, 2009

jvi.asm.org

of the International Committee on Taxonomy of Viruses. Elsevier, Amster-dam, The Netherlands.

57. West, J. T., and C. Wood. 2003. The role of Kaposi’s sarcoma-associated herpesvirus/human herpesvirus-8 regulator of transcription activation (RTA) in control of gene expression. Oncogene 22:5150–5163.

58. Wolfe, S. A., L. Nekludova, and C. O. Pabo. 2000. DNA recognition by Cys2His2 zinc finger proteins. Annu. Rev. Biophys. Biomol. Struct. 29:183– 212.

59. Wongteerasupaya, C., J. E. Vickers, S. Sriurairatana, G. L. Nash, A.

Akarajamorn, V. Boosaeng, S. Panyim, A. Tassanakajon, B.

Withyachum-narnkul, and T. W. Flegel.1995. A non-occluded, systemic baculovirus that occurs in the cells of ectodermal and mesodermal origin and causes high mortality in the black tiger prawn Penaeus monodon. Dis. Aquat. Organ. 21:69–77.

60. Yang, F., J. He, X. Lin, Q. Li, D. Pan, X. Zhang, and X. Xu. 2001. Complete genome sequence of the shrimp white spot bacilliform virus. J. Virol. 75: 11811–11820.

61. Zhi, Y., K. S. Sciabica, and R. M. Sandri-Goldin. 1999. Self-interaction of the herpes simplex virus type 1 regulatory protein ICP27. Virology 257:341– 351.

at National Taiwan Univ. on May 8, 2009

jvi.asm.org