• 沒有找到結果。

Osteoblast-derived Wnt-1-induced secreted protein 1 increases VCAM-1 expression and enhances prostate cancer metastasis by down-regulating miR-126

N/A
N/A
Protected

Academic year: 2021

Share "Osteoblast-derived Wnt-1-induced secreted protein 1 increases VCAM-1 expression and enhances prostate cancer metastasis by down-regulating miR-126"

Copied!
20
0
0

加載中.... (立即查看全文)

全文

(1)

Adiponectin promotes VCAM-1 expression and subsequently enhances osteosarcoma migration by down-regulating miR-126 through PI3K/Akt

signaling pathway

Huai-Ching Tai1, An-Chen Chang2, Hone-Jeng Yu1, Chao-Yuan Huang1, Yu-Chieh Tsai3, Yu-Wei Lai4, Chih-Hsin Tang2,5,6*, and Shih-Wei Wang7*

1Department of Urology, National Taiwan University Hospital, Taipei, Taiwan

2Graduate Institute of Basic Medical Science, China Medical University, Taichung, Taiwan

3Department of Oncology, National Taiwan University Hospital, Taipei, Taiwan 4Division of Urology, Taipei City Hospital Renai Branch, Taipei, Taiwan

5Department of Pharmacology, School of Medicine, China Medical University, Taichung, Taiwan

6Department of Biotechnology, College of Health Science, Asia University, Taichung, Taiwan

7Department of Medicine, Mackay Medical College, New Taipei City, Taiwan

*: Address correspondence to: Shih-Wei Wang, PhD

Department of Medicine, Mackay Medical College

No. 46, Sec. 3, Zhongzheng Rd., Sanzhi Dist., New Taipei City , Taiwan Tel: 886-2-26360303-1219; Fax: 886-2-26361295

E-mail: [email protected] Or

Chih-Hsin Tang, PhD

Graduate Institute of Basic Medical Science, China Medical University No. 91, Hsueh-Shih Road, Taichung, Taiwan

Tel: 886-4-22052121-7726; Fax: 886-4-22333641 E-mail: [email protected] 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36

(2)

ABSTRACT

The skeleton, most common metastatic site for prostate cancer (PCa), faces risk of intractable bone pain. Wnt-1-induced secreted protein 1 (WISP-1) belongs to the CCN family (CTGF/CYR61/NOV) that plays a key role in bone formation. This study investigates whether osteoblast-derived WISP-1 is associated with PCa metastasis. We found osteoblast-conditioned medium (OBCM) expediting migration and vascular adhesion molecule-1 (VCAM)-1 expression in human PCa (PC3 and DU145) cells. Osteoblast transfection with WISP-1 shRNA reduced OBCM-mediated PCa migration and VCAM-1 expression. Stimulation of PCa with OBCM or WISP-1 elevated focal adhesion kinase (FAK) and p38 phosphorylation, yet FAK and p38 inhibitor or siRNA abolished osteoblast-derived WISP-1-induced migration and VCAM-1 expression. We noted osteoblast-derived WISP-1 inhibiting miR-126 expression, as well as miR-216 mimic reversing osteoblast-derived WISP-1-enhanced migration and VCAM-1 expression. This study proves that osteoblast-derived WISP-1 promotes migration and VCAM-1 expression in human PCa cells by down-regulating miR-126 expression via v1 integrin, FAK, and p38 signaling pathways. Thus, WISP-1 may be a new molecular therapeutic target in PCa bone metastasis.

Running title: Osteoblast-derived WISP-1 increases PCa migration Keywords: WISP-1; Osteoblasts; Prostate cancer; miR-126; VCAM-1. 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

(3)

INTRODUCTION

Prostate cancer (PCa) is the most commonly diagnosed malignancy in the USA and other western countries . For its early stages, surgery is the most frequent therapeutic intervention. In advanced states, however, more systemic intervention is required to inhibit growth and spread of secondary metastases. Bone metastasis is a common complication associated with advanced PCa, often causing acute pain and bone fracture. Bone metastasis has prognostic value in PCa, since extent of disease in the bone significantly affects survival . Tumor metastasis to bone is linked with osteoblast and osteoclast, resulting in bone lesions . Osteoblasts, major cellular component of bones, play a key role in osteogenesis . In tumor microenvironment, cancer cells yield soluble factors to stimulate osteoblast activation, proliferation, and maturation. On the other hand, they secrete bone matrix and growth factors to enhance both malignancy and osteoblastic bone metastasis , making osteoblast-derived factors crucial during bone metastasis.

WNT1-inducible signaling pathway protein 1 (WISP-1) is a cysteine-rich protein belonging to the Cyr61, CTGF, Nov (CCN) family of matricellular proteins that have developmental functions and regulate bone formation . CCN family proteins are mostly secreted and associated with extracellular matrix (ECM), which has been demonstrated to play important roles in tumor development, including tumor survival, proliferation, migration, and invasion . WISP-1 is reportedly expressed in developing breast tumors in transgenic mice . Mounting evidence also suggests WISP-1 enhanced tumorigenesis and metastasis in many types of cancer . These suggest WISP-1 playing a vital role during cancer development and metastasis.

Several cell adhesion molecules secreted by cancer cells are cited as involved in metastasis: e.g., integrin, cadherin, immunoglobulin superfamily . Vascular cell adhesion molecule-1 (VCAM-1, a.k.a. CD106), a member of the immunoglobulin superfamily, is a transmembrane glycoprotein that mediates adhesion of lymphocytes or monocytes to vascular endothelium . Aberrant expression of VCAM-1 in cancer cells was documented in preclinical models as well as patient samples of gastric cancer and renal cell carcinoma . Likewise, VCAM-1 has been indicated to regulate tumor progression and bone metastasis in glioblastoma and breast cancer . It is unknown whether VCAM-1 has any functional role in PCa metastasis to bone.

Bone-derived growth factor and chemokines play central roles as trophic factors that attract breast, lung, and prostate cancer cells to bone tissue . Understanding mechanisms between human PCa and osteoblasts is critical to devising therapies for PCa bone metastasis. We hypothesized that osteoblast-derived WISP-1 may regulate VCAM-1 expression and promote migration of PCa cells. We saw osteoblast-derived 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94

(4)

WISP-1 promoting PCa migration and VCAM-1 expression by down-regulating miR-126 through v1 integrin/focal adhesion kinase (FAK)/p38 signaling pathway.

MATERIALS and METHODS

Materials

Anti-mouse and anti-rabbit IgG-conjugated horseradish peroxidase; rabbit polyclonal antibodies specific to VCAM-1, ERK, ERK, p38, p38, JNK, JNK, p-FAK, p-FAK, and -actin; WISP-1 short hairpin RNA (shRNA) and control shRNA plasmids were purchased from Santa Cruz Biotechnology (Santa Cruz, CA); p38 inhibitor (SB203580) from EnZO Life Sciences (Farmingdale, NY), FAK inhibitor from Calbiochem (San Diego, CA); recombinant human WISP-1 from R&D Systems (Minneapolis, MN); Dulbecco’s modified Eagle’s medium (DMEM), RPMI-1640 medium, fetal bovine serum (FBS) and all other culture reagents from Gibco-BRL Life Technologies (Grand Island, NY), luciferase assay kit from Promega (Madison, WI), MiR-126 mimic or other chemicals from Sigma-Aldrich (St. Louis, MO).

Cell culture

The human prostate cancer cell lines (PC3 and DU145) were purchased from American Type Culture Collection (Manassas, VA). Human primary osteoblasts were

obtained from Lonza (Walkersville, MD).Cells were maintained at 37°C in 5% CO2 atmosphere in RPMI-1640 medium supplemented with 20 mM HEPES, 10% heat-inactivated FBS, 2mM glutamine, 100 U/mL penicillin and 100 μg/mL streptomycin (Invitrogen, Carlsbad, CA). To obtain osteoblast-conditioned medium (OBCM), cells were grown to confluence and culture media were changed with RPMI without FBS. OBCM were collected two days after change of media and stored at -70°C until use. In serial experiments, osteoblasts were transfected for 24 h with WISP-1 or control shRNA to prevent WISP-1 production, media collected 48 h later. Level of WISP-1 in culture medium was assayed by WISP-1 enzyme immunoassay (ELISA) kit (R&D Systems, Minneapolis, MN), as per manufacturer’s instructions.

Migration and invasion assay

Migration assay used Transwell inserts (Costar, New York, NY; pore size, 8 μm) in 24-well dishes. For invasion assays, filters were precoated with 30 L of Matrigel basement membrane matrix (BD Biosciences, Bedford, MA) for 30 min. Procedures were alike for both migration and invasion assays. Before migration assay, cells were pretreated for 30 min with inhibitors: e.g., FAK inhibitor, SB203580, or vehicle control (0.1% dimethyl sulfoxide). About 1  104 cells in 200 μL of serum-free 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132

(5)

medium were placed in the upper chamber, 300 L of serum-free medium containing WISP-1 or OBCM in the lower chamber. Plates were incubated for 16 h at 37°C in 5% CO2, cells fixed in 3.7% formaldehyde solution for 15 min and stained with 0.05% crystal violet in phosphate-buffered saline (PBS) for 30 min. Cells on upper sides of filters were removed with cotton-tipped swabs, filters washed with PBS. Cells on undersides were examined and counted under a microscope. Each clone was plated in triplicate for each experiment, which was repeated at least three times.

Quantitative real-time PCR

Total RNA was extracted from cells by TRIzol kit (MDBio Inc., Taipei, Taiwan). Reverse transcription reaction used 2 μg of total RNA reverse transcribed into cDNA, using oligo(dT) primer. Quantitative real-time polymerase chain reaction (RT-qPCR) analysis used TaqMan® one-step PCR Master Mix (Applied Biosystems, Foster City, CA). Total complementary DNA (100ng/25μL reaction) was mixed with sequence-specific primers and TaqMan® probes, as per manufacturer’s instructions, sequences for all target gene primers and probes purchased commercially (β-actin served as internal control) (Applied Biosystems). Q-PCR assays were carried out in triplicate, using a StepOnePlus sequence detection system. Cycling conditions were 10 min of polymerase activation at 95 °C, followed by 40 cycles at 95 °C for 15 s and 60 °C for 60 s. For miRNA detection, reverse transcription used Mir-X™ miRNA First-Strand Synthesis and SYBR® RT-qPCR (Clontech Laboratories, Inc., CA). U6 snRNA levels served for normalization. Specific forward primer of miR-126 was TCGTACCGTGAGTAATAATGCG-3′. Forward and reverse primers for U6 were 5′-CTCGCTTCGGCAGCACATATACTA-3′ and 5′-ACGAATTTGCGTGTCATCCT TGCG-3′. Threshold was set above non-template control background and within the linear phase of target gene amplification to calculate cycle number at which transcript was detected (denoted as CT).

Western blot analysis

Cellular lysates were prepared as described , proteins resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to Immobilon polyvinyldifluoride (PVDF) membranes. Blots were blocked with 4% bovine serum albumin (BSA) for 1 h at room temperature, then probed with rabbit anti-human antibodies against -actin, VCAM-1, p-p38, p38, p-JNK, JNK, p-FAK, FAK, p-ERK or ERK (1:3000) for 2 h at room temperature. After three washings, blots were incubated with a donkey anti-rabbit peroxidase-conjugated secondary antibody (1:5000) for 1 h at room temperature. Blots were visualized with enhanced chemiluminescence and Kodak X-OMAT LS film (Eastman Kodak, Rochester, NY). 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170

(6)

siRNA transfection

The siRNA against human FAK, p38, VCAM-1, and control were purchased from Santa Cruz Biotechnology. Cells were grown to 80% confluence in 6-well plates, then transfected with siRNAs (100 nM) by Lipofectamine 2000 Transfection Reagent (Invitrogen, Carlsbad, CA) for 24 h.

Reporter gene assay

To construct miR-126 promoter-luciferase and VCAM-1 3’UTR-luciferase plasmid, 1.7 kb of miR-126 promoter and VCAM-1 3’UTR fragments containing miR-126 binding site GTATAGTACTGGCATGGTACGG were inserted into multiple cloning site of pGL2-Basic vector containing luciferase reporter gene. All constructs were sequenced and verified. Cells grown to 80% confluence in 12-well plates were transfected with 1 µg luciferase plasmid using Lipofectamine 2000. To prepare lysates, 100 µL reporter lysis buffer (Promega) was added to each well, cells scraped from dishes. Supernatant was collected after 13,000 rpm centrifuge for 2 min. Aliquots of cell lysates (20 µL) containing equal amounts of protein (20-30 µg) were placed in wells of an opaque black 96-well plate, 80 µL of luciferase substrate added to all samples, luminescence was measured in a microplate luminometer.

Statistics

Data are presented as mean ± standard error of mean (SEM). Statistical analysis between samples used Student’s t test. Comparison of more than two groups used one-way ANOVA with Bonferroni’s post-hoc test, p < 0.05 considered significant.

RESULTS

Osteoblasts-derived WISP-1 promotes prostate cancer cell migration

Bone-derived growth factors and chemokines reportedly promote tumor metastasis to bone . We hypothesized osteoblasts as capable of regulating PCa metastasis to bone; OBCM for PCa cell migration was examined via Transwell assay. OBCM concentration-dependent directed PCa cells (DU145 and PC-3) migration and invasion (Figs. 1A-B). It is well established that osteoblasts can synthesize and secrete WISP-1, which play important roles in bone formation and cell differentiation . To pinpoint the role of WISP-1 in OBCM responsible for PCa migration, WISP-1 mAb was used. Figures 1C-D show WISP-1 mAb blocking OBCM-induced migration and invasion in PCa cells. To corroborate this hypothesis, we stimulated PCa cells with WISP-1 and found it significantly increasing migration and invasion in PCa cells. To 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208

(7)

confirm the role of WISP-1 in OBCM, we transfected osteoblasts with control or WISP-1 shRNA, collecting and applying their OBCM to PCa cells. Transfection of osteoblasts with WISP-1 reduced WISP-1 expression in OBCM was assessed by ELISA (Fig. 1G). WISP-1 shRNA also antagonized OBCM-mediated PCa migration and invasion (Figs. 1H-I). Results indicated osteoblast-derived WISP-1 promoting migration and invasion in PCa cells.

Osteoblast-derived WISP-1 directing prostate cancer migration involves VCAM-1 up-regulation through integrin v1 receptor

1 reportedly mediates tumor bone metastasis ; we hypothesized VCAM-1 involvement in osteoblast-derived WISP-VCAM-1-directed PCa migration. Stimulation of PCa cells with OBCM or WISP-1 increased VCAM-1 mRNA expression concentration-dependently (Figs. 2A&C). Transfection of PCa cells with VCAM-1 siRNA markedly inhibited OBCM or 1-induced migration (Figs. 2B-D). WISP-1 shRNA antagonized OBCM-mediated VCAM-WISP-1 expression (Figs. 2E-F). Data suggest OBCM-derived WISP-1-induced PCa migration occurring via up-regulation of VCAM-1 expression. WISP-1 is known to affect cell functions by binding to the cell-surface integrin receptor . Incubation of PCa cells with OBCM increased mRNA expression of v and 1 integrin (data not shown). Cotransfection of PCa cells with v1 siRNA definitely reduced OBCM or WISP-1-enhanced cell migration (Fig. 3A&D). On the other hand, v1 siRNA diminished OBCM or WISP-1-mediated VCAM-1 expression (Figs. 3B,C,E). Hence, osteoblast-derived WISP-1 increased migration and VCAM-1 expression in human PCa cells through integrin v1 receptor.

FAK and p38 signal pathways involved in osteoblast-derived WISP-1-mediated PCa migration and VCAM-1 expression

FAK, a widely expressed non-receptor protein tyrosine kinase, is an early downstream factor of integrin-mediated signaling to regulate cellular function . To verify whether FAK activation is involved in osteoblast-derived WISP-1-induced cell migration, we directly measured phosphorylation of FAK in response to OBCM. Stimulation of PCa cells with OBCM increased FAK phosphorylation (Fig. 4A). By contrast, knockdown of WISP-1 in osteoblasts diminished OBCM-mediated FAK phosphorylation (Fig. 4A). FAK inhibitor or siRNA reduced OBCM or WISP-1-increased cell migration and VCAM-1 expression in human PCa (Figs. 4C-H). Directly applying WISP-1 enhanced FAK phosphorylation (Fig. 4B).

Mitogen-activated protein kinase (MAPK) activation is cited as sine qua non for migration in human PCa . To delineate signal pathways downstream of WISP-1, 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246

(8)

MAPK activity in OBCM-treated cells was examined. Fig. 4A shows OBCM exposure increasing phosphorylation of ERK, p38, and JNK. Knockdown of WISP-1 reduced OBCM-mediated p38 but not ERK and JNK phosphorylation, indicating p38 (not ERK or JNK) as involved in osteoblast-derived WISP-1-mediated cell function. Recombinant human WISP-1 promoted p38 phosphorylation time-dependently (Fig. 4B). To test p38 involvement in osteoblast-derived WISP-1-mediated migration, we used p38 inhibitor (SB203580) and siRNA to find p38 inhibitor or siRNA reduced OBCM or WISP-1-increased cell migration and VCAM-1 expression (Figs. 4C-H), suggesting FAK and p38 pathway as involved in OB-derived WISP-1-mediated migration and VCAM-1 expression in human PCa.

Osteoblast-derived WISP-1 increased cell migration and VCAM-1 expression by down-regulating miR-126 through v1 integrin, FAK, and p38 signaling pathways

It has been reported that miR-126 regulating VCAM-1 expression is involved in many cellular functions ; we hypothesized miR-126 regulating VCAM-1 mediates osteoblast-derived WISP-1-induced cell migration. Indeed, incubation of PCa cells with OBCM reduced miR-126 expression, and WISP-1 shRNA rescued OBCM-inhibited miR-126 expression (Fig. 5A). Stimulation of PCa cells with WISP-1 inhibited miR-126 expression in a concentration dependent manner (Fig. 5B). To prove miR-126 as involved in osteoblast-derived WISP-1-mediated cell migration, miR-126 mimic was used; transfection with it abolished OBCM-induced migration and VCAM-1 expression (Fig. 5C&D). Simultaneously, v1, FAK, and p38 siRNA reversed OBCM-inhibited miR-126 expression and promoter activity (Fig. 5E&F), indicating osteoblast-derived WISP-1 suppressing miR-216 via v1/FAK/p38 pathway. To examine whether miR-216 regulates 3′UTR of VCAM-1, we constructed luciferase reporter vector harboring 3’UTR of VCAM-1 mRNA and vector containing miR-216 binding site. Results show OBCM increasing luciferase activity in VCAM-1 3′UTR plasmid, and v1, FAK, or p38 siRNA reduced OBCM-mediated VCAM-1 3′UTR activity (Fig. 5G). Taken together, these data demonstrate miR-216 directly repressing VCAM-1 protein expression through binding to the 3′UTR of the human

VCAM-1 gene through v1/FAK/p38 signaling pathway.

DISCUSSION

PCa cells exhibit a striking tendency to metastasize to bone . To analyze trophic signals that control PCa bone metastasis is crucial for identification of new molecular targets for anti-metastasis therapy. We hypothesized osteoblast-derived factors helping to direct migration of PCa cells and found osteoblast-derived factors from 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284

(9)

osteoblast inducing migration of human PCa cells. By using WISP-1 shRNA to knock down WISP-1 expression in osteoblasts, we identified WISP-1 as chief factor in osteoblasts, promoting PCa migration and VCAM-1 up-regulation. One mechanism underlying osteoblast-derived WISP-1-directed migration was transcriptional up-regulation of VCAM-1 expression by down-regulating miR-126 through v1 integrin, FAK, and p38 signaling pathways.

Tumor invasion and metastasis are the main biological characteristics of cancer. Metastasis is the major cause of cancer death, involved in multiple processes: e.g., invading cells to change cell-cell adhesion properties, rearrange ECM environment, suppress anoikis, and reorganize their cytoskeletons . Cell adhesion molecules are transmembrane glycoproteins that mediate cell-cell and cell-ECM interaction. VCAM-1, a cell adhesion molecule, reportedly mediates epithelial-to-mesenchymal transition, invasion, and bone metastasis . In breast cancer, VCAM-1 is a crucial activator of indolent bone metastasis and recruitment of osteoclasts to develop bone lesion. Pretreatment with VCAM-1 antibody reduces breast cancer migration and bone metastasis , meaning VCAM-1 plays a critical role in tumor migration; its disruption can prevent bone metastasis. Our study unearthed evidence of VCAM-1 is a major factor in osteoblast-derived WISP-1-mediated migration in human PCa cells. We found osteoblast-derived WISP-1 inducing PCa cells to express VCAM-1, whereas siRNA against VCAM-1 significantly reduced WISP-1-mediated cell motility. VCAM-1 is thus a downstream effector in osteoblasts-derived WISP-1-increased motility of human PCa cells.

Newly identified small noncoding RNAs, miRNAs, belong to a novel class of gene regulators that control gene expression by binding to complementary sequences in 3’UTRs of target mRNAs . Deregulated miRNA expression is reported in human cancer and may affect multiple steps during metastasis . MiR-126 has been cited as a negative regulator of VCAM-1 that mediates many cellular functions . Our study defines a mechanism for miR-126 function: miR-126 mediated PCa migration by suppressing VCAM-1 expression. Data show osteoblast-derived WISP-1 inhibiting miR-126 expression and promoter activity. Transfection with miR-126 mimic halted osteoblast-derived WISP-1-mediated migration and VCAM-1 expression. Moreover, we indicated miR-126 directly repressing VCAM-1 protein expression through binding to 3’-UTR of human VCAM-1 gene, thereby negatively regulating VCAM-1-mediated metastasis.

Prior study has shown MAPK activated after stimulation of CCN family proteins . We found OBCM promoting ERK, p38, and JNK phosphorylation. However, knockdown of WISP-1 in osteoblasts decreased OBCM-induced p38 phosphorylation, with other MAPKs (JNK and ERK) unaffected, suggesting p38 but not JNK and ERK 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322

(10)

involved in osteoblast-derived WISP-1-mediated cell functions. Also, p38 inhibitor reduced osteoblast-derived WISP-1-promoted migration and VCAM-1 expression, as confirmed by p38 siRNA inhibiting osteoblast-derived WISP-1-enhanced migration and VCAM-1 expression in human PCa. Transfection with v1, FAK, or p38 siRNA diminished OBCM-mediated miR-126 expression and VCAM-1 3′UTR activity. Data hint v1 integrin, FAK, and p38 signaling pathway involved in osteoblast-derived WISP-1-inhibited miR-126 expression in human PCa cells.

Bone is a common site of cancer metastasis. PCa shows a particular predilection for metastasis to bone. Bone-derived growth factors and chemokines play central roles as trophic factors that attract PCa cells to bone tissue [3]. Osteoblast-derived factors constitutively secreted by human osteoblasts have shown its key role of hematopoietic cells to marrow [15]. Effect of osteoblast-derived factors on VCAM-1 expression and migration activity in human PCa cells remains mostly unknown. We observed osteoblast-derived WISP-1 promoting migration and VCAM-1 expression in human PCa cells by down-regulating miR-126 expression through v1 integrin, FAK, and p38 signaling pathways. Inhibition of WISP-1 thus presents a new therapeutic target.

Acknowledgments

This work was supported by grants from the National ScienceCouncil of Taiwan (NSC100-2320-B-039-028-MY3, NSC102-2632-B-039-001-MY3, NSC101-2320-B-715-002-MY3, NSC102-2314-B-002-163-MY2).

Conflict of Interest statement

All authors have no financial or personal relationships with other people or organizations that could inappropriately influence our work.

323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348

(11)

FIGURE LEGENDS

Fig. 1 Osteoblast-derived WISP-1 increases prostate cancer migration.

(A-D) Prostate cancer (PCa) cells (DU145 and PC-3) were incubated with various concentrations of osteoblast conditional medium (OBCM) or OBCM pretreated with IgG or WISP-1 monoclonal antibody (10 g/mL) for 30 min, in vitro migration and invasion measured by Transwell assay. (E&F) PCa cells were incubated with WISP-1 (1-10 ng/mL) for 24 h, in vitro migration and invasion gauged by Transwell assay. (G-I) Osteoblasts were transfected with control or WISP-1 shRNA for 24 h, medium collected as OBCM, WISP-1 expression examined by ELISA. Also, OBCM was applied to PCa cells for 24 h, in vitro migration and invasion measured by Transwell assay, results expressed as mean ± S.E.M. *, p < 0.05 compared with control; #, p < 0.05 compared with OBCM or WISP-1-treated group.

Fig. 2 Vascular cell adhesion molecule-1 (VCAM-1) involved in osteoblast-derived WISP-1-mediated PCa cell migration.

(A&C) PCa cells were incubated with various OBCM or WISP-1 concentrations for 24 h, and VCAM-1 expression was examined by real-time quantitative polymerase chain reaction (RT-qPCR). (B&D) PCa cells were transfected with VCAM-1 siRNA for 24 h followed by stimulation with OBCM (30 %) or WISP-1 (10 ng/mL) for 24 h,

in vitro migration measured by Transwell assay. (E&F) Osteoblasts were transfected

with control or WISP-1 shRNA for 24 h, medium collected as OBCM and applied to PCa cells for 24 h. VCAM-1 expression was examined by RT-qPCR and western blot. Results are expressed as mean ± S.E.M. *, p < 0.05 compared with control; #, p < 0.05 compared with OBCM or WISP-1-treated group.

Fig. 3 Osteoblast-derived WISP-1 boosts migration and VCAM-1 expression via integrin v1 receptor.

(A-E) PCa cells were transfected with v1 siRNA for 24 h followed by stimulation with OBCM (30 %) or WISP-1 (10 ng/mL) for 24 h, in vitro migration and VCAM-1 expression gauged by Transwell, RT-qPCR, and western blot. Results are expressed as mean ± S.E.M. *, p < 0.05 compared with control; #, p < 0.05 compared with OBCM or WISP-1-treated group.

Fig. 4 FAK and p38 pathways involved in osteoblast-derived WISP-1-increased migration and VCAM-1 expression.

(A) Osteoblasts were transfected with control or WISP-1 shRNA for 24 h, medium was collected as OBCM and applied to PCa cells. The FAK, p38, ERK, and JNK phosphorylation was examined by western blot. (B) PCa cells were incubated with 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386

(12)

WISP-1 (10 ng/mL) for indicated time intervals, FAK and p38 phosphorylation was examined by western blot. (C-H) PCa cells were pretreated with FAK inhibitor (10 M) and SB203580 (10M) or transfected with FAK and p38 siRNA for 24 h followed by stimulation with OBCM (30 %) or WISP-1 (10 ng/mL) for 24 h, in vitro migration and VCAM-1 expression measured by Transwell, RT-qPCR, and western blot. Results are expressed as mean ± S.E.M. *, p < 0.05 compared with control; #, p < 0.05 compared with OBCM or WISP-1-treated group.

Fig. 5 Osteoblast-derived WISP-1 boosts PCa migration and VCAM-1 expression by down-regulating miR-126 expression.

(A) Osteoblasts were transfected with control or WISP-1 shRNA for 24 h. Medium was collected as OBCM and applied to PCa cells, miR-126 expression examined by qPCR. (B) PCa cells were incubated with WISP-1 (10 ng/mL) for indicated time intervals, miR-126 expression examined by qPCR. (C&D) PCa cells were transfected with miR-126 mimic for 24 h followed by stimulation with OBCM (30 %) or WISP-1 (10 ng/mL) for 24 h, miR-126 expression examined by qPCR. (E-G) PCa cells were transfected with v1, FAK, or p38 siRNA for 24 h followed by stimulation with OBCM (30 %) or WISP-1 (10 ng/mL) for 24 h, and miR-126 expression, miR-126 promoter activity, or VCAM-1 3’UTR activity were examined. Results are expressed as mean ± S.E.M. *, p < 0.05 compared with control; #, p < 0.05 compared with OBCM or WISP-1-treated group.

Fig. 6 Schematic presentation of signaling pathways involved in osteoblast-derived WISP-1-induced migration and VCAM-1 expression of PCa cells. Osteoblast-derived WISP-1 promotes migration and VCAM-1 expression in human PCa cells by down-regulating miR-126 expression via v1 integrin, FAK, and p38 signaling pathways. 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413

(13)

REFERENCES

1. Bryant RJ and Hamdy FC. Screening for prostate cancer: an update. European urology. 2008; 53(1):37-44.

2. Mundy GR. Metastasis to bone: causes, consequences and therapeutic opportunities. Nature reviews Cancer. 2002; 2(8):584-593.

3. Shah RB, Mehra R, Chinnaiyan AM, Shen R, Ghosh D, Zhou M, Macvicar GR, Varambally S, Harwood J, Bismar TA, Kim R, Rubin MA and Pienta KJ. Androgen-independent prostate cancer is a heterogeneous group of diseases: lessons from a rapid autopsy program. Cancer research. 2004; 64(24):9209-9216. 4. Hanahan D and Weinberg RA. The hallmarks of cancer. Cell. 2000;

100(1):57-70.

5. Ell B and Kang Y. SnapShot: Bone Metastasis. Cell. 2012; 151(3):690-690 e691.

6. Kristensen HB, Andersen TL, Marcussen N, Rolighed L and Delaisse JM. Osteoblast Recruitment Routes in Human Cancellous Bone Remodeling. The American journal of pathology. 2014.

7. Weilbaecher KN, Guise TA and McCauley LK. Cancer to bone: a fatal attraction. Nature reviews Cancer. 2011; 11(6):411-425.

8. Hsu YL, Hou MF, Kuo PL, Huang YF and Tsai EM. Breast tumor-associated osteoblast-derived CXCL5 increases cancer progression by

ERK/MSK1/Elk-1/snail signaling pathway. Oncogene. 2013; 32(37):4436-4447. 9. Hsu YL, Huang MS, Yang CJ, Hung JY, Wu LY and Kuo PL. Lung tumor-associated osteoblast-derived bone morphogenetic protein-2 increased epithelial-to-mesenchymal transition of cancer by Runx2/Snail signaling pathway. The Journal of biological chemistry. 2011; 286(43):37335-37346.

10. Holbourn KP, Acharya KR and Perbal B. The CCN family of proteins: structure-function relationships. Trends in biochemical sciences. 2008; 33(10):461-473.

11. French DM, Kaul RJ, D'Souza AL, Crowley CW, Bao M, Frantz GD, Filvaroff EH and Desnoyers L. WISP-1 is an osteoblastic regulator expressed during skeletal development and fracture repair. The American journal of pathology. 2004; 165(3):855-867.

12. Chen PP, Li WJ, Wang Y, Zhao S, Li DY, Feng LY, Shi XL, Koeffler HP, Tong XJ and Xie D. Expression of Cyr61, CTGF, and WISP-1 correlates with clinical features of lung cancer. PloS one. 2007; 2(6):e534.

13. Hou CH, Chiang YC, Fong YC and Tang CH. WISP-1 increases MMP-2 expression and cell motility in human chondrosarcoma cells. Biochemical pharmacology. 2011; 81(11):1286-1295. 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451

(14)

14. Nagai Y, Watanabe M, Ishikawa S, Karashima R, Kurashige J, Iwagami S, Iwatsuki M, Baba Y, Imamura Y, Hayashi N and Baba H. Clinical significance of Wnt-induced secreted protein-1 (WISP-1/CCN4) in esophageal squamous cell carcinoma. Anticancer research. 2011; 31(3):991-997.

15. Pennica D, Swanson TA, Welsh JW, Roy MA, Lawrence DA, Lee J, Brush J, Taneyhill LA, Deuel B, Lew M, Watanabe C, Cohen RL, Melhem MF, Finley GG, Quirke P, Goddard AD, et al. WISP genes are members of the connective tissue growth factor family that are up-regulated in wnt-1-transformed cells and aberrantly expressed in human colon tumors. Proc Natl Acad Sci U S A. 1998; 95(25):14717-14722.

16. Xie D, Yin D, Wang HJ, Liu GT, Elashoff R, Black K and Koeffler HP. Levels of expression of CYR61 and CTGF are prognostic for tumor progression and survival of individuals with gliomas. Clin Cancer Res. 2004; 10(6):2072-2081.

17. Chuang JY, Chang AC, Chiang IP, Tsai MH and Tang CH. Apoptosis signal-regulating kinase 1 is involved in WISP-1-promoted cell motility in human oral squamous cell carcinoma cells. PloS one. 2013; 8(10):e78022.

18. Makrilia N, Kollias A, Manolopoulos L and Syrigos K. Cell adhesion molecules: role and clinical significance in cancer. Cancer investigation. 2009; 27(10):1023-1037.

19. Desgrosellier JS and Cheresh DA. Integrins in cancer: biological implications and therapeutic opportunities. Nature reviews Cancer. 2010; 10(1):9-22.

20. Denys A, Clavel G, Semerano L, Lemeiter D and Boissier MC. A1.6 Vascular adhesion molecule VCAM-1 overexpression in collagen induced arthritis : a model for rheumatoid arthritis vascular dysfunction. Annals of the rheumatic diseases. 2014; 73 Suppl 1:A3.

21. Ding YB, Chen GY, Xia JG, Zang XW, Yang HY and Yang L. Association of VCAM-1 overexpression with oncogenesis, tumor angiogenesis and metastasis of gastric carcinoma. World J Gastroenterol. 2003; 9(7):1409-1414.

22. Lin KY, Lu D, Hung CF, Peng S, Huang L, Jie C, Murillo F, Rowley J, Tsai YC, He L, Kim DJ, Jaffee E, Pardoll D and Wu TC. Ectopic expression of vascular cell adhesion molecule-1 as a new mechanism for tumor immune evasion. Cancer research. 2007; 67(4):1832-1841.

23. Martinez LM, Vallone VB, Labovsky V, Choi H, Hofer EL, Feldman L, Bordenave RH, Batagelj E, Dimase F, Villafane AR and Chasseing NA. Changes in the peripheral blood and bone marrow from untreated advanced breast cancer patients that are associated with the establishment of bone metastases. 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489

(15)

Clinical & experimental metastasis. 2014; 31(2):213-232.

24. Joo YN, Eun SY, Park SW, Lee JH, Chang KC and Kim HJ. Honokiol inhibits U87MG human glioblastoma cell invasion through endothelial cells by regulating membrane permeability and the epithelial-mesenchymal transition. International journal of oncology. 2014; 44(1):187-194.

25. Lu X, Mu E, Wei Y, Riethdorf S, Yang Q, Yuan M, Yan J, Hua Y, Tiede BJ, Haffty BG, Pantel K, Massague J and Kang Y. VCAM-1 promotes osteolytic expansion of indolent bone micrometastasis of breast cancer by engaging alpha4beta1-positive osteoclast progenitors. Cancer cell. 2011; 20(6):701-714. 26. Chen PC, Cheng HC, Yang SF, Lin CW and Tang CH. The CCN family proteins: modulators of bone development and novel targets in bone-associated tumors. Biomed Res Int. 2014; 2014:437096.

27. Huang CY, Chen SY, Tsai HC, Hsu HC and Tang CH. Thrombin induces epidermal growth factor receptor transactivation and CCL2 expression in human osteoblasts. Arthritis Rheum. 2012; 64(10):3344-3354.

28. Chirgwin JM and Guise TA. Molecular mechanisms of tumor-bone interactions in osteolytic metastases. Critical reviews in eukaryotic gene expression. 2000; 10(2):159-178.

29. Ono M, Inkson CA, Kilts TM and Young MF. WISP-1/CCN4 regulates osteogenesis by enhancing BMP-2 activity. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research. 2011; 26(1):193-208.

30. Brigstock DR. The CCN family: a new stimulus package. J Endocrinol. 2003; 178(2):169-175.

31. Guan JL. Role of focal adhesion kinase in integrin signaling. The

international journal of biochemistry & cell biology. 1997; 29(8-9):1085-1096. 32. Hour MJ, Tsai SC, Wu HC, Lin MW, Chung JG, Wu JB, Chiang JH, Tsuzuki M and Yang JS. Antitumor effects of the novel quinazolinone MJ-33: inhibition of metastasis through the MAPK, AKT, NF-kappaB and AP-1

signaling pathways in DU145 human prostate cancer cells. International journal of oncology. 2012; 41(4):1513-1519.

33. Banerjee N, Kim H, Talcott S and Mertens-Talcott S. Pomegranate

polyphenolics suppressed azoxymethane-induced colorectal aberrant crypt foci and inflammation: possible role of 126/VCAM-1 and

miR-126/PI3K/AKT/mTOR. Carcinogenesis. 2013; 34(12):2814-2822.

34. Sun C, Alkhoury K, Wang YI, Foster GA, Radecke CE, Tam K, Edwards CM, Facciotti MT, Armstrong EJ, Knowlton AA, Newman JW, Passerini AG and Simon SI. IRF-1 and miRNA126 modulate VCAM-1 expression in response 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527

(16)

to a high-fat meal. Circulation research. 2012; 111(8):1054-1064.

35. Harris TA, Yamakuchi M, Ferlito M, Mendell JT and Lowenstein CJ. MicroRNA-126 regulates endothelial expression of vascular cell adhesion

molecule 1. Proceedings of the National Academy of Sciences of the United States of America. 2008; 105(5):1516-1521.

36. Del Conte A, Minatel E, Schinella D, Baresic T, Basso SM and Lumachi F. Complete Metabolic Remission with Gefitinib in a Hemodialysis Patient with Bone Metastases from Non-small Cell Lung Cancer. Anticancer research. 2014; 34(1):319-322.

37. Ell B, Mercatali L, Ibrahim T, Campbell N, Schwarzenbach H, Pantel K, Amadori D and Kang Y. Tumor-induced osteoclast miRNA changes as

regulators and biomarkers of osteolytic bone metastasis. Cancer cell. 2013; 24(4):542-556.

38. Ricci E, Mattei E, Dumontet C, Eaton CL, Hamdy F, van der Pluije G, Cecchini M, Thalmann G, Clezardin P and Colombel M. Increased expression of putative cancer stem cell markers in the bone marrow of prostate cancer patients is associated with bone metastasis progression. The Prostate. 2013; 73(16):1738-1746.

39. Itatani Y, Kawada K, Fujishita T, Kakizaki F, Hirai H, Matsumoto T, Iwamoto M, Inamoto S, Hatano E, Hasegawa S, Maekawa T, Uemoto S, Sakai Y and Taketo MM. Loss of SMAD4 from colorectal cancer cells promotes CCL15 expression to recruit CCR1+ myeloid cells and facilitate liver metastasis.

Gastroenterology. 2013; 145(5):1064-1075 e1011.

40. Desgrosellier JS and Cheresh DA. Integrins in cancer: biological implications and therapeutic opportunities. Nat Rev Cancer. 10(1):9-22. 41. Esquela-Kerscher A and Slack FJ. Oncomirs - microRNAs with a role in cancer. Nature reviews Cancer. 2006; 6(4):259-269.

42. Zhang Quan JK-T. Long noncoding RNAs and viral infections. BioMedicine. 2013; 3(1):34-42.

43. Chen PS, Su JL and Hung MC. Dysregulation of microRNAs in cancer. J Biomed Sci. 2012; 19:90.

44. Kawaki H, Kubota S, Suzuki A, Suzuki M, Kohsaka K, Hoshi K, Fujii T, Lazar N, Ohgawara T, Maeda T, Perbal B, Takano-Yamamoto T and Takigawa M. Differential roles of CCN family proteins during osteoblast differentiation: Involvement of Smad and MAPK signaling pathways. Bone. 2011; 49(5):975-989. 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564

參考文獻

相關文件

• Richard Szeliski, Image Alignment and Stitching: A Tutorial, Foundations and Trends in Computer Graphics and Computer Vision, 2(1):1-104, December 2006. Szeliski

• Richard Szeliski, Image Alignment and Stitching: A Tutorial, Foundations and Trends in Computer Graphics and Computer Vision, 2(1):1-104, December 2006. Szeliski

PDLSCs: Periodontal Ligament derived Stem Cells GMSCs: Gingiva derived Mesenchymal Stem Cells SHED: Stem cells from Human Exfoliated Deciduous teeth IDPSCs: Immature Dental Pulp

At the best of our knowledge, only rare cases of salivary glands tumors with abundant melanin pigment and/or expression of multiple melanocytic markers (S-100, SOX10, HMB45,

Unit 1 Unit 1 - How many people are in your familyA. Read

temperature T (in C) as a function of the height h (in kilometers), assuming that a linear model is appropriate.. (b) Draw the graph of the function in

The Vertical Line Test A curve in the xy-plane is the graph of a function of x if and only if no vertical line intersects the curve more than once.. The reason for the truth of

A revolution: Probability propagation in networks with cycles, Jordan, Kearns and Solla (eds), Advances in Neural Information Processing Systems 10, MIT Press.