FOXC2於白藜蘆醇抑制肺癌細胞轉移之相關探討; FOXC2 is critical for resveratrol-mediated inhibition of metastasis in lung cancer
全文
(2) Contents Contents .................................................................................................. ... .I Figure Contents..................................................................................... .....III! ठᖴ....................................................................................................... ..... V! ύЎᄔा............................................................................................... .....VI Abstract ................................................................................................. .....VII! 1. Introduction....................................................................................... ..... 1 1.1 Metastasis.................................................................................................................1 1.2 Epithelial-mesenchymal transition......................................................................... 1 1.3 Forkhead-box C2 .....................................................................................................3 1.4 Resveratrol ...............................................................................................................3. 2. Material and Methods ....................................................................... ..... 7! 2.1 Reagents...................................................................................................................6 2.2 Cell culture...............................................................................................................6 2.3 Western blotting analysis.........................................................................................7 2.4 Migration and invasion assays .................................................................................7 2.5 Cell viability by MTS assay.....................................................................................7 2.6 Colony formation assay ...........................................................................................8 2.7 Reverse transcriptase–polymerase chain reaction (RT-PCR)..................................8 2.8 Immunofluorescence staining ..................................................................................8 2.9 Establish stable cell line by retrovirus infection ......................................................9 2.10 Construction of luciferase reporters.......................................................................9 2.11Transfection and reporter assay ............................................................................10 2.12 The PP2A immunoprecipitation phosphatase activity .........................................10. I.
(3) 2.13 Construction and Production of shRNA in Lentiviral Vector ..............................10 2.14 Statistical analysis ................................................................................................11. 3. Results............................................................................................... .....12 3.1 Resveratrol inhibits epithelial-mesenchymal transition in lung cancer cells.........12 3.2 Resveratrol significance inhibits EMT-inducing transcription factor, FOXC2, at transcriptional level in lung cancer cells................................................................13 3.3 Ectopic expression of FOXC2 reverses resveratrol-mediated cell mobility and EMT. ......................................................................................................................13 3.4 PI-3K/Akt activity is required to increase the expression of FOXC2 in A549 cells… ....................................................................................................................14 3.5 Protein serine/threonine phosphatase 2A catalytic subunit C (PP2A/C) acts as an up-regulator of resveratrol-inhibited FOXC2 expression. .....................................15. 4. Discussions ....................................................................................... .....17 5. References......................................................................................... .....20. II.
(4) Figure Contents Figure 1.Resveratrol inhibited the cell metastatic and invasive ability in lung cancer cells. ...............................................................................................................35 Figure 2.Resveratrol repressed EMT transition in lung cancer cells. ............................36 Figure 3.Immunofluorescence staining for the effects of resveratrol on the expression of E-cadherin in lung cancer cells..................................................................37 Figure 4.Treatment with resveratrol changed cell morphology from mesenchymal-like to epithelial-like in CL1-5 cells. ....................................................................38 Figure 5.Cell viability for treatment with resveratrol in CL1-5 cells. ...........................39 Figure 6.Effect of resveratrol on EMT-inducing transcription factors in lung cancer cells. ...............................................................................................................40 Figure 7.Resveratrol repressed the expression of FOXC2 in lung cancer cells.............41 Figure 8.Effects of resveratrol on the expression of FOXC2 and E-cadherin in A549 cells. ...............................................................................................................42 Figure 9.Effect of resveratrol on FOXC2 promoter activity in CL1-5 cells..................43 Figure 10.Stable expression of FOXC2 in A549 cells. ..................................................44 Figure 11.Effect of resveratrol on stable expressed FOXC2 cells in A549. ..................45 Figure 12.Immunofluorescence staining for the effects of the expression of E-cadherin on resveratrol-treated A549-FOXC2 cells. ....................................................46 Figure 13.Effects of resveratrol on cell metastatic and invasive ability in A549-FOXC2 cells. .......................................................................................47 Figure 14.Effects of resveratrol on cell viability in A549-FOXC2 cells. ......................48 Figure 15.Resveratrol inhibited colony formation in A549-FOXC2 cells.....................49 Figure 16.Effects of PI-3K/Akt inhibitor, LY294002, or MAPK inhibitor, U0126, on the expression of FOXC2 in A549 cells ........................................................50. III.
(5) Figure. 17.Effects. of. overexpression. Akt. on. resveratrol-inhibited. FOXC2. expression… ..................................................................................................51 Figure 18.Effects of resveratrol on PP2A/C protein expression and PP2A activity in A549 cells. .....................................................................................................52 Figure 19.Effects of okadaic acid (OA), a PP2A inhibitor, on resveratrol-inhibited FOXC2 expression in A549 cells...................................................................53 Figure 20.Effects of PP2A/C on the expression of FOXC2 in lung cancer cells. .........55 Figure 21.Effects of knockdown PP2A/C expression on resveratrol-induced FOXC2 inactivation.....................................................................................................56 Figure 22.Effects of knockdown PP2A/C expression on resveratrol-inhibited cell mobility in A549 cells....................................................................................57 Figure 23.A model showing a PP2A/Akt/FOXC2 axis signaling pathway involved in lung cancer cell metastasis.............................................................................58 !. IV.
(6) ठᖴ ᙯ໔Ǵٿԃޑਔ໔ၸѐΑǴགྷ߃ჴᡍ࠻ਔޑᚸᔉคޕǴၡຳຳናና وၸٰǴࣴزғޑғࢲǴΨΑࢤပǶٿԃࡐ۩ၮӦԵډύ୯ᙴᕎғ܌Ǵٰ ډਁؼԴৣޑჴᡍ࠻ᏢಞǶӧ೭ᜐᏢಞډӭᆶϩғБय़Ԗᜢޑჴᡍೌמᆶמ ѯǴӧ೭ᜐǴҗ૱ޑགᖴԴৣ๏Αך೭ঁᏢಞޑᐒǶᖴᖴԴৣӧ೭ٿԃޑ ਔ໔๏ؼךӳޑᏢಞᕉნǴӧᏢಞޑၸำύǴᖴᖴԴৣޑऐЈ௲ᏤᆶхǶӧԜǴ Ψགᖴᖴ࣓Դৣǵ୯ፁଣহᑫ୯ԴৣаϷύࣴଣᑵֻܹԴৣᏼҺޑךα၂ہ Ǵ๏ϒךᝊࡰޑᏤǶ! ӧࣴٿޑ܌زԃύǴࡐ໒ЈΨࡐ۩ၮډٰޑ೭္Ǵགᖴჴᡍ࠻ޑՏᏢۊ ॺǵӕᏢǴаϷᏢۂǴӢࣁԖգॺǴᡣჴᡍ࠻ޑғࢲкᅈઢǶӧ೭္ձགᖴ ϩηᙴᏢύЈඁᏢۊǴᖴᖴඁᏢۊჹךܭჴᡍόჇޑྠځ௲ᏤǴᡣך೭ٿ ԃޑჴᡍૈճՉǶᖴᖴ٫ޱǵ٧ذǴӢࣁգॺޑഉՔǴᡣٿךԃٰޑғࢲк ᅈઢǶᖴᖴߋ༇ǵCfotpoǵޞमǴգॺࢂჴᡍ࠻ޑӳұՔǴᡣךӧჴᡍ࠻ޑғ ࢲᡂள׳укჴǵԖ፪Ƕӧ೭္ǴΨाགᖴϩηᙴᏢύЈᥦҏറγޑշතǴ ӧނჴᡍБय़๏ϒךᝊࡰޑᏤǶ! ךΨाᖴᖴᇡΜԃޑӳܻ϶ǴችԮǴഉࡋךၸ೭ٿԃޑਔ໔Ƕനࡕགᖴ ޑךৎΓǴᖴᖴգॺٿԃٰޑᜢЈǵхǴᡣךคࡕ៝ϐኁޑ᠐ਜǶᗨฅӧᏢಞ ޑၡຳຳናናǴΨࢂգॺޑЍǴᡣךԖᝩុوΠѐޑΚǶӢࣁգॺǴω ԖϞϺךޑǴ׆ఈӧ҂ٰޑВη္ǴёаόູॄգॺჹޑךයఈǴᖴᖴգॺǴך ངգॺǶ! !!!!!!!!!! ᕎੱғނᏢࣴ!܌زᎄԳ! :9 ԃ 8 Д!. V.
(7) ύЎᄔा қ㈻ᝳᎇ(resveratrol)ࢂᅿϺฅޑࢥלނન(phytoalexin)ǴЬाӸӧܭဟ ǵғаϷਬ╘ύǶҜ-໔፦ᙯϯ(epithelial-mesenchymal transition, EMT)ࢂ खजวػၸำύޑғຝǴࣁҜಒझࠠᄊ(epithelium)ᙯᡂԋ໔ယಒझ (mesenchyme)ࠠᄊޑᅿၸำǴࢂ҅தวػǵαᘰӝаϷൾ܄Ҝဍዦวғޑ ୷ᘵǶҞزࣴޑᡉҢҜ-໔፦ᙯϯჹӭᅿဍዦޑวำڀԖख़ाޑቹៜǴ Ҝ-໔፦ᙯϯёߦ߈ဍዦಒझޑዎаϷဍዦޑᙯ౽ǴӧΓᜪаϷނჴᡍύ วҜ-໔፦ᙯϯᏤठႣࡕόؼǶჴᡍ่݀ᡉҢқ㈻ᝳᎇफ़եҜ-໔፦ᙯ ϯ࣬ᜢޑᙯᒵӢη FOXC2 ߄ޑǴΨวқ㈻ᝳᎇૈڋόӕޤᕎಒझޑ౽ Ϸߟ᠍ૈΚǴׯᡂҜ-໔፦ᙯϯ࣬ᜢޑೈқ፦߄Ǵٯӵቚу E-cadherin ֖ޑ ໆǴफ़ե fibronetinǵN-cadherin کvimentin ߄ޑǶࣁΑှқ㈻ᝳᎇڋҜ໔፦ᙯϯޑᐒࢂڋցၸफ़ե FOXC2 ߄ޑǴӢԜӧޤᕎಒझύၸࡋ߄ FOXC2Ǵၸࡋ߄ FOXC2 ਔઇᚯқ㈻ᝳᎇڋҜ-໔፦ᙯϯޑຝǴቚ уޤᕎಒझᙯ౽Ϸߟ᠍ૈΚǴᇥܴΑқ㈻ᝳᎇࢂᙖҗफ़ե FOXC2 ߄ޑٰڋ Ҝ-໔፦ᙯϯຝޑวғǶࣁқ㈻ᝳᎇӵՖ ڋFOXC2 ߄ޑǴӧ ޤᕎಒझύуΕ PI3K/Akt ౦܄ᇙᏊаϷ MAPK ڋᏊϐࡕǴ่݀ᡉҢ PI3K/Akt ౦܄ᇙᏊ ڋFOXC2 ߄ޑǴ߄Ңᙖҗ Akt ૻ৲ሀၡ৩ፓ FOXC2 ߄ ޑ Ƕ ς ํ ޕ ለ / ለ ѐ ᕗ ለ 䁙 (protein serine/threonine phasphotase 2A, ᙁᆀ PP2A)ૈ٬ Akt ᕗለϯޑՏᗺѐᕗለϯԶ٬ځѨѐࢲ ܄Ƕқ㈻ᝳᎇૈࢲϯํለ/ለѐᕗለ䁙ǴуΕํለ/ለѐᕗለ䁙ᒧ ࠠڋᏊ okadaic acid ࢂ܈а shPP2A/C ํڋለ/ለѐᕗለ䁙߄ޑਔ ٬ள FOXC2 ߄ޑቚуǶ೭٤่݀ᡉҢלᕎᛰނқ㈻ᝳᎇૈᙖҗࢲϯํለ/ ለѐᕗለ䁙फ़ե PI3K/Akt-FOXC2 ߄ޑǴԶၲޤڋډᕎಒझᙯ౽ޑҞ ޑǶ. VI.
(8) Abstract Resveratrol (trans-3, 5, 4’-trihydroxystilbene), a phytoalexin found in various plants such as grapes, has been shown to prevent cancer metastasis in murine models. Epithelial-mesechymal transition (EMT) associates with pathological process such as fibrosis and cancer which leads to carcinoma progression and poor prognosis in various human and mouse model. Here we showed that EMT was inhibited by resveratrol through down-regulating the expression of FOXC2 (forkhead box C2), a critical transcription factor involved in EMT transition. Our data showed that treatment with reveratrol inhibited cell mobility and up-regulation of the expression of E-cadherin, an epithelial marker, we also found that treatment with resveratrol down-regulating several mesenchymal markers such as fibronectin, N-cadherin and vimentin in various lung cancer cells. Ectopic expression of FOXC2 in lung cancer cells recovered resveratrol-mediated suppression of cell mobility and EMT transition. To define the molecular mechanisms involved in resveratrol-regulated FOXC2 expression, PI3K/Akt and MAPK inhibitors were used. Treatment with PI3K/Akt inhibitor down-regulated FOXC2 expression and these data suggest that Akt signaling pathway may involved in the regulation of FOXC2 expression in lung cancer cells. Resveratrol also activated serine/threonine protein phosphatase 2A (PP2A), known to dephosphorylation of several protein kinase including Akt. Inhibition of PP2A by okadaic acid (OA), a phosphatase inhibitor, or knockdown the expression of PP2A by shPP2A/C increased the expression of FOXC2. These data indicated that the cancer-chemopreventive agent resveratrol induced PP2A/C activation and further inactivated the PI3K/Akt-FOXC2 pathway that resulted in decreasing metastatic ability of lung cancer cells.. VII.
(9) 1. Introduction 1.1 Metastasis Metastasis is a disease that cancer cells spread from the primary neoplasm to distant organs. Metastasis is usually in the late stage of cancer and common cause death in cancer patients. Stephen Paget’s in 1889 proposal that “seed and soil” hypothesis to explain metastasis which depends on cross-talk between selected cancer cells (the ‘seed’) and specific organ microenvironments (the ‘soil’) [1]. There is also a propensity for certain tumors to seed in particular organs. Metastasis is a multi-step process: the first step-“invasion”-some tumor cells invade into surrounding normal host tissue [2] and the second step-“intravasion”-tumor cells penetrate small vascular channels or lymphatics to entry into the circulation [3,4]. Only small part of tumor cells survival in the circulation, and then interacts with platelets, lymphocytes, and monocytes. [5].. The. surviving. cancer. cells. complete. the. next. step-“extravasation”-which arrest in the capillary beds of distant organs by adhering either to capillary endothelial cells or to subendothelial basement membrane. Finally, in the new host environment, tumor cells growth succeed from minute growths (micrometastasis) into malignant, secondary tumors [6,7]. 1.2 Epithelial-Mesenchymal Transition Epithelial cells form a sheet or layers of cells that contact each other by tight junction, adherens junction, desmosome and gap junction to hold them tightly together and inhibit the movement of individual cell away from the epithelial layer [8]. Epithelial cells establish apical-basolateral polarity through association with a lamina layer at their basal surface, called the basement membrane [9]. In contrast to epithelial cells, mesenchymal cells interact with neighboring cells only focally contacts without forming organized cell layers, and exhibit a front-back end polarity [10]. In culture, epithelial cells grow as cluster and maintain complete cell-cell interaction with 1.
(10) neighbours, whereas mesenchymal cells looks like spindle-shaped, fibroblast-like morphology. and. tent. to. highly. motile,. but. in. vivo. may. not. [11].. Epithelial-mesenchymal transition (EMT) was first recognized in serious of elegant experiments in 1980s, the epithelial cells transformed to mesenchymal cells through a cellular program called EMT [12,13,14]. During EMT, cells would separate, lose the apical-basolateral polarity, and become more elongated, fibroblast-shaped, and change adhesions to facilitate cells movement and to invade extracellular matrix (ECM) [10,15]. EMT transition reduces cell-cell interaction via the transcriptional repression and delocalization of adherences junctions (cadherin), tight junctions (occluding and claudin), desmosomes (desmolakin) and cytokeratin intermediate filaments (vimentin and fibronectin) [16,17,18,19]. Repression of the expression of E-cadherin [20], an important caretaker of the epithelial phenotype and induction of vimentin [21], a hallmark of mesenchymal type is characterized of EMT. During embryogenesis, EMT plays an important role in development tissues, and required to gastrulation formation [22,23] , neural crest development [24], heart-valve development [25,26] and secondary palate formation [27]. The reverse program epithelial cells become mesenchymal cells termed mesenchymal-epithelial transition (MET), occurs during embryogenesis and several pathological processes [15,28]. EMT transition also associates with pathological processes such fibrosis [29] and cancer[30] which leads to carcinoma progression and poor prognosis in various human and mouse tumors. Loss of E-cadherin, a tumor suppressor protein correlates with carcinoma progression and poor prognosis in various human and mouse model, such breast cancer and prostate cancer [31,32]. Mutation of E-cadherin leads protein loss of function and leads to about 50% of lobular breast carcinomas [33]. There are several pathways induce EMT transition, notably TGF-E signaling which implicated as major induction signals [30,34], Wnt signal [35,36], Notch pathway [37,38], 2.
(11) Hedgehog signaling [39]. Hypoxia is one of physiological mechanisms that promote EMT program through up-regulation hypoxia-inducing factor-1D (HIF1D), TWIST [40] and SNAIL [41]. Some transcription factors known to involved in EMT transition such as Snail[42,43], Slug [44], Twist [45], ZEB1/GEF [46], and ZEB2/SIP1 [47],E12/E47 [48], Goosecoid [49] and FOXC2 [50] associated with tumor invasion and metastasis. Twist is a basic helix-loop-helix (bHLH) transcription factor, plays a role in mesodermal differentiation and myogenesis [51]. Recently studies showed that increasing the expression of twist leads to cancer metastasis [45]. SNAI1 and Slug (SNAI2) are the members of SNAIL family which are conserved zinc-finger proteins and bind to the E-box elements of E-cadherin promoter to repress the expression of E-cadherin in epithelial cells [42,43,44]. 1.3 Forkhead-Box C2 The FOXC2 (forkhead-box C2), previously termed MFH1 (mesenchyme forkhead-1) or FKHL14, located on 16q24.1 is one of forkhead box family which have conserved DNA binding domain term forkhead box or winged helix domain [52]. The expression of FOXC2 is mainly in mesoderm-derived tissues [53] and adipose tissue in adult [54]. FOXC2 plays an important role in kidney embryonic development [55] and lymphatic sporting during vascular development [56]. Foxc2 also plays a role in angiogenesis by regulating integrin E3 expression [57]. The expression of FOXC2 leads to cancer cells migration and invasion in vitro, and in vivo studies show that expression of FOXC2 is associated with basal-like subtype breast cancer which is higher compared with HER2 overexpression tumor and luminal ER-positive subtype of tumor [50]. 1.4 Resveratrol Resveratrol (trans-3, 5, 4’-trihydroxystilbene) is a polyphenols which was first isolated from white hellebore (Veratrum grandiflorum O. Loes) in 1940, and since 3.
(12) then have been also found in various plants including grapes, peanuts, mulberries [58]. In 1963, the root in Polygonum Caspidatum used in traditional Chinese and Japanese medicine called Ko-jo-kon[59] found the existence of resveratrol. The sources of resveratrol was from red wine and red grape [60] which was synthesized in the leaf epidermis and in the grape skins [61]. Resveratrol can prevent or slow the progression of illnesses including cardiovascular [62], cancer [63] and ischemic injury [64,65] . There are studies shown that resveratrol could extend lifespan by silent information regulator 2 (Sir2)-dependent mechanisms in Saccharomyces cerevisiae cerevisiae [66], Caenorhabditis elegans [67] and Dorsophila melanogaster [68], and also extend lifespan of short-lived fish Nothobrachius furzen [69]. Resveratrol is an activator of SIRT1 which has the ability to prolong survival of calorie restriction mice treated with high-calorie diet [70]. The effects of resveratrol are dependent on the cell type, cellular condition, and concentrations and it can have opposing activities [61]. Because resveratrol has the ability to inhibit cancer formation at initiation, promotion and progression, it is shown to have chemoprevention ability [61]. Recently studies shows that resveratrol have chemoprevention functions in liver cancer [71,72], colon cancer [73,74], breast cancer [75], lung cancer [76,77], melanoma [78,79], head and neck squamous cell carcinoma [80,81] and ovarian and cervical carcinoma [82,83,84]. Resveratrol down-regulates the enzyme activity and transcriptional activity of cytochrome P-450 1A1 (CYP1A1) which is a carcinogen-activating enzyme, indicated that resveratrol can inhibit tumor progression at initiation stage [85] and resveratrol also can inhibit tumor formation by down-regulating the expression of cyclooxygenase 2 (COX2) [86]. Treatment with resveratrol could promote apoptosis through FasL pathway [87] , mitochondria pathway [88], p53 activation pathway [89,90,91,92] and Rb-E2F/DP pathway [93]. Resveratrol mediates cell-cycle arrest at difference stages in different cells 4.
(13) [89,94,95,96,97,98]. Some transcription factors are inhibited by resveratrol, including NF-NB [99,100,101,102], AP-1 [103], Egr-1 [104,105], and AP-2D>@ and also down-regulate. protein. kinases. such. INBD[100],. JNK,. MAPK,. ERK1/2. [91,92,107,108], Akt [109,110], PKC [111], PKD [112] and CKII [113]. Pharmacokinetic studies shows that in human, resveratrol has rapid metabolism (~8 to 14 min) and converted to sulfate and glucuronide conjugate within ~30 min at liver and kidney [114]. Resveratrol inhibits vascular endothelial growth factor (VEGF)-induced angiogenesis in HUVECs [115] and also inhibits cancer cells invasion and migration in breast cancer [116]. Recently studies shown that resveratrol inhibits the invasion of tumor cells through repression of MMP-2 [116] or MMP-9 [117]. Resveratrol has the effect on prevention tumor growth and metastasis to lung in Lewis Lung Carcinoma-Bearing Mice [118]. Now, treatment with resveratrol in human colon cancer and colorectal cancer have several clinical trials at phase I stage [58]. Thus, we examined the signaling pathway involve in resveratrol-mediated cell metastasis in human lung cancer cells. These data showed that resveratrol induced the activation of. serine/threonine. protein. phosphatase. 2A,. PP2A/C,. in. turn,. down-regulation the signaling pathway PI3K/Akt-FOXC2. In this study, we found that inactivation of PP2A/C increase the expression of FOXC2 through up-regulation of Akt. These data also found the forkhead protein, FOXC2, was involved in resveratrol-mediated inhibition of metastasis in lung cancer and it may suggest to be a biomarker to early diagnosis in lung cancer. We provide evidence that resveratrol would be a critical therapeutic strategy for lung cancer.. 5.
(14) 2. Materials and Methods 2.1 Reagents. Resveratrol ʻЇ99% purify) was purchased from Sigma-Aldrich (St. Louis, MO, USA). A stock solution of resveratrol was made in dimethyl sulfoxide (DMSO, Sigma-Aldrich) at a concentration of 5mM and stored at -8˃к LY294002 (2-(4-Morpholino)-8-phenyl-4H-1-benzopyran-4-one), and okadaic acid (OA) was purchased. from. Sigma-Aldrich.. UO126. (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) was purchased from Calbiochem. (Nottingham,. U.K.). Anti-E-cadherin,. anti-fibronectin,. and. anti-N-cadherin were purchased from BD biosciences (San Jose, CA, USA). Anti-FOXC2 was from Abcam (Cambridge, MA, USA) and Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-PP2A C subunit was from Santa Cruz Biotechnology. (Santa. Cruz,. CA,. USA).. Anti-PP2A. C. subunit. (52F8),. anti-phospho-Akt (Ser473), anti-Akt, anti-phospho-extracellular signal-regulated kinase (ERK) 1/2, and anti-ERK were all purchased from Cell Singling Technology (Beverly, MA, USA). Anti-vimentin was purchased from Neomarker (Fremont, CA, USA). Anti-twist, anti-slug, and anti-snail were from Santa Cruz. Anti-D-tubulin was from Sigma-Aldrich (St. Louis, MO, USA). 2.2 Cell culture. GP+E86 and PA317 cell lines were cultured in Dulbeco’s Nodified Eagle Medium (DMEM, GIBCO, Invitrogen, Carlsbad, CA, USA). Lung cancer cell lines CL1-5, A549, H322, H1435, and 293T cells were supplement with DME/F12 (1:1) (Hyclone Laboratories, Logan, Utah, USA). NCI-H520 cells were maintained in RPMI-1640 (Hyclone Laboratories, Logan, Utah, USA). The A549 overexpression FOXC2 cells and A549 and CL1-5 knockdown PP2A/C expression cells were cultured in DME/F12 containing 2Pg/mL puromycin (Sigma-Aldrich). All of medium contained 10% fetal bovine serum and antibiotics (100IU/ml penicillin G and 100Pg/ml streptomycin). Cell culture were maintained at 37к in humidified 5% CO2 6.
(15) atmosphere. For treatment, the resveratrol was diluted in medium and added to cultures to give the desired final concentrations. Untreated cultures received the same amount of the carrier solvent DMSO. 2.3 Western blotting analysis. Resveratrol-treated cells were examined by Western blot analysis at the indicated time. The whole cell extracts were prepared by lysing cell in NETN lysis buffer (150mM NaCl, 20mM Tris-HCl pH8.0, 0.5% NP40 and 1mM EDTA) containing protease inhibitor cocktail (Sigma-Aldrich). After electrophoresis, the proteins were electrotransferred to PVDF membrane (Millipore Corporation, Bedford, MA, USA), blocked by 5% non-fat milk, and probed with the indicated antibodies at 4°C overnight. The blots were than washed, exposed to horseradish peroxidase-conjugated secondary antibodies (Abcam) 1:5000 dilution for 1hr at room temperature, and then detected by chemiluminescence reagent (Millipore). 2.4 Migration and invasion assays. For migration assay, cells pretreated by the indicated concentrations of resveratrol for 24h and suspended 5Ø104 cells to layered in the upper compartment of a Transwell an 8-Pm-diameter polycarbonate filter (8Pm pore size) which was from Corning Incorporated (Corning, NY, USA), and incubated at 38±C for 24h. For invasion assays, 5Ø104 cells was suspend to the upper layer which coated with 30PL diluted matrigel (BD biosciences) and then treated the indicated concentrations of resveratrol for 48h. Each chamber was washed with PBS, cells were fixed by cold-methanol, stained by 0.05% crystal violet, removed noninvaded cells on the top of transwell with cotton swab, and then counted cell with three different fields under light microscope. 2.5 Cell viability by MTS assay. MTS assays were performed according to the manufacturer's instructions (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Promega, Madison, WI, USA). 5×104 cells were treated with resveratrol for the 7.
(16) indicated time in 24-well tissue culture plate with 1000µL of medium. 2.6 Colony formation assay. 500 cells were seeded in 6-well tissue culture plate and treated with resveratrol for 48h, replaced fresh medium and incubated for 4 days until colonies were visible. Cells were fixed with 3.7% formaldehy/PBS and were stained by 0.05% crystal violet. The total number of colonies formed on each well were counted. 2.7 Reverse transcriptase–polymerase chain reaction (RT-PCR). Total RNA was isolated using Trizol reagent (Invitrogen) and reverse transcribed into single-stranded cDNA with moloney murine leukemia virusreverse transcriptase (MMLV-RT; Invitrogen) as manufacturer’s instructions. The primer sequences for FOXC2 were: 5’-GCCTAAGGACCTGGTGAAGC-3’ 5’-TTGACGAAGCACTCGTTGAG-3’. (forward) (reverse);. 5’-GCTCGTCGTCGACAACGGCTC-3’. for. human. (forward). and E-actin. were: and. 5’-CAAACATGATCTGGGTCATCTTCTC-3’ (reverse). The reaction mixture was first denatured at 9ˇк for 5 min. For FOXC2, the PCR condition was 94к for 30 sec, 56к for 30 sec, and 72к for 30 sec for 35 cycles; forE-actin was 94к for 30 sec, 55к for 30 sec, and 72к for 30 sec for 22cycles followed by 72к for 10 min. 2.8 Immunofluorescence staining. Treatment with resveratrol for 48h, cells were fixed in 4% paraformaldehyde/PBS for 15min at room temperature and then permeabilized with 0.1% Triton X-100/PBS for 10min at room temperature. Nonspecific binding sites were block with 5% BSA/PBS and then the cells were incubated with in 1:100 polyclonal antibodies for E-cadherin (Cell Signaling, MA, USA) overnight at 4к and then at room temperature for 1h. After slide was rinsed, primary antibody was detection by Alex Fluoro 488-FITC (Molecular Probes, Eugene, OR, USA) for 1h at room temperature. The nuclei were counterstained with 4', 6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) for 10min at room temperature. 8.
(17) Images were capture with ZEISS fluorescence microscope using software program Axio Vision 4.7.2. 2.9 Establish stable cell line by retrovirus infection. The human FOXC2 cDAN was subcloned into the pBabe-Puro vector and was obtained from Addgene (Cambridge, MA, USA). Retroviral vector expressing FOXC2 gene or the control vector was transfected 4Pg plasmid into an ecotropic packaging cell line by using lipofectaminTM LTX (Invitrogen), GP+E86 containing 4Ø105 cells in 6-cm-diameter dish, and harvested overnight. Before infection to a second generation packaging cell line, PA317, the medium of GP+E86 containing polybrene (8µg/mL) were filtered by 0.22PM filter, and added 3mL medium to the 10-cm-diameter dish containing 5Ø105 cells of PA317. After 2h, added the complete medium to 10mL in PA317 and harvested overnight. Packaging cells then were selected with 2µg/mL of puromycin until a confluent 10-cm-diameter dish of resistant cells was obtained. Amphotropic virus were collected from the medium of PA317 to infect cultured cells as described above, and then these cultured cells were selected with 2Pg/mL puromycin. After selection, these cell lines dilute with 1:1000 to obtain single clone about four weeks. 2.10 Construction of luciferase reporters. The FOXC2 promoter (nucleotides -1990 to. the. Nru. site. +6). was. amplification. by. PCR. (sense:. 5’-. tgctcgagtgcccaaccagaccagcaac, and antisense: 3’- actaagcttctgcgtgctgcttccgagac) using FOXC2 BAC clone (Invitrogen) as template. The PCR produce was inserted into the cutting site at XhoI and HindIII of pGEM T-easy vector (Promega). The fragment after confirming sequence was subsequently inserted into pGL3-basic reporter (Promega). For a series of deletion constructs was down by described above. For. FOX2-promoter. from. -1990. to. -984,. the. primers. are. (sense:. 5’-. tgctcgagtgcccaaccagaccagcaac, and antisense: 3’-tgctcgagcctgccattccaatccagcg); for -984 to +6 using primers (sense: 5’- actaagcttcgcttggattggaatggcagg, and antisense: 9.
(18) 3’- actaagcttctgcgtgctgcttccgagac); from -215 to +6 using primers for (sense: 5’-tgctcgagatccgcccggtccgctgaag, and antisense: 3’- actaagcttctgcgtgctgcttccgagac). By restriction enzyme BlpI digested FOXC2-promoter from -984 to +6 to generate FOXC2-promoter from -984 to -460 and from -460 to +6. 2.11 Transfection and reporter assay. Transfection of plasmid DNA (pcDNA3.1 and myr-Akt) was performed using Lipofectamine TM LTX or Lipofectamine 2000 for reporter assay according to the manufacturer’s instructions (Invitrogen). For luciferase reporter assays, firefly luciferase activities were normalized to total protein concentrations. After transfection, resveratrol were treated for 48hr. Luciferase assays were carried out using the Luciferase Assay System (Promega) according to manufacturer’s protocol. 2.12 The PP2A immunoprecipitation phosphatase activity. A549 cells were treated with resveratrol at the indicated times and lysed by NETN lysis buffer containing aprotinin, PMSF. Equal amount of 500Pg proteins were used to assay phosphatase activity according to manufacturer’s instructions (Millipore). Briefly, adding 2Pg anti-PP2A C subunit to lysate, rotated at ˇ̓C for overnight and then washed. Added phosphopeptide to lysate, incubated at 30̓C for 10min, and then added malachite green detection solution to lysate incubation for 10 min at room temperature and detected activity for OD650. 2.13 Construction and Production of shRNA in Lentiviral Vector. shPP2A E1 (TRCN000002486) clone, shPP2A C1 (TRCN000002484) clone, pLKO.1-shLuc vector (shRNA against luciferase, act as a control), pMD.G plasmid and pCMVdeltaR8.91 plasmid were obtained form National RNAi Core Facility at the Genomics Research Center (Academia Sinica, Taipei, Taiwan). Recombinant lentiviruses were produced by co-transfecting 293T cells with the lentivirus expression plasmid, the lentivirus packaging vectors pCMVdeltaR8.91, and the 10.
(19) vesicular stomatitis virus G glycoprotein (VSVG) expression vector pMD.G using the LipofectamineTM LTX according toʳ manufacturer’s instructions. The viruses were collected from the culture supernatants on 2 days post-transfection and filtered by 0.45PM filter. Cultured cells were incubated with lentivirus ccontating 8 µg/mL polybrene for 24h, replaced medium and incubated for another 2 days. For stable clone, cells were then selected with 2µg/mL puromycin for 1 week. 2.14 Statistical analysis. Results are expressed as mean ± SD or SE, as indicated. One-tailed student’s t test was used to compare the intergroup; p < 0.05 was considered statistically significant.. 11.
(20) 3. Results 3.1 Resveratrol inhibits epithelial-mesenchymal transition in lung cancer cells. There were many studies shown epithelial-mesenchymal transition (EMT) plays an important role in regulating invasion and migration of cancer cells. To elucidate whether resveratrol inhibited cell mobility of lung cancer cells, CL1-5 and A549 lung carcinoma cells were treated with various concentrations of resveratrol, and cell mobility were determined by migration and invasion assay. Treatment with the indicated concentrations of resveratrol decreased the migration and invasion ability of lung cancer cells in a dose-dependent manner (Fig.1). During EMT transition, cancer cells lose the expression of E-cadherin which regulating cell-cell contact and acquired mesenchymal markers such as vimentin, fibronectin, and N-cadherin [21,31,119]. To examine that the effects of resveratrol in lung cancer cells would abolish EMT transition, lung cancer cells treated with 10PM resveratrol for 48h and then analyzed E-cadherin and mesenchymal markers expression by western blotting analysis. Resveratrol increased the expression of E-cadherin and decreased the expression of mesenchymal markers such as fibronectin, N-cadherin and vimentin in lung cancer cells (Fig.2). To confirm resveratrol-inhibited EMT with up-regulation of the expression of E-cadherin, immunnofluorescence staining was preformed. The expression of E-cadherin was induced in resveratrol-treated A549, but not in control cells (Fig.3). The cell morphology of CL1-5 cells changed from spindle-shaped mesenchymal type to less-elongated epithelial cell morphology after treatment with resveratrol (Fig.4). The effect of resveratrol on cell viability of CL1-5 cells was down by MTS assay. Treatment with resveratrol for the indicated time had no effect on cell viability (Fig.5). These data indicated that treatment with resveratrol decreased cell mobility through down-regulation EMT and changed cell morphology from spindle-shaped to epithelial characteristics of lung cancer cells.! 12.
(21) 3.2 Resveratrol significantly inhibits EMT-inducing transcription factor, FOXC2, at transcriptional level in lung cancer cells. To elucidated how resveratrol-inhibited EMT, EMT-inducing transcription factors, FOXC2, twist, slug and snail were analysis by western blot analysis in lung cancer cell lines. Resveratrol significantly decreased the expression of FOXC2 in CL1-5 and A549 cells, but had less effect on twist and slug (Fig.6). Inhibition the expression of FOXC2 by resveratrol had the same result in other lung cancer cell lines (Fig.7). To examine that resveratrol-mediated inhibition of FOXC2 was through down-regulation of gene expression, RT-PCR was performed. Fig.7 revealed that resveratrol inhibited the expression of FOXC2 was at transcriptional level in lung cancer cells. The inhibition ability of FOXC2 in response to resveratrol was for 48h and resveratrol enhanced E-cadherin expression was at time-dependent manner (Fig.8). To determine the regulatory mechanism underlying the transcription of FOXC2 gene by resveratrol, we analyzed the promoter region of human FOXC2 gene. Within the ~1.9-kb fragment of upstream the start codon, there were several transcription factor binding sites. To identify the resveratrol-response elements, a series of 5’ promoter deletion mutants of the FOXC2 gene (F1-F6) were constructed. The F1, F3, F5 and F6 reporter constructs were down-regulated by resveratrol about 40-50% which indicating that resveratrol-response elements lie between -215 and +6 (F6) (Fig.9). These observations suggest that resveratrol-inhibition EMT were through down-regulated the expression of FOXC2 in human lung cancer cells. 3.3 Ectopic expression of FOXC2 reverses resveratrol-mediated cell mobility and EMT. To. investigate. whether. the. expression. of. FOXC2. involved. in. resveratrol-mediated repression of cell mobility in lung cancer cells, FOXC2 was 13.
(22) ectopic expressed in A549 lung cancer cells. Overexpression of FOXC2 in A549 decreased the levels of E-cadherin and up-regulated mesenchymal markers, fibronectin, N-cadherin and vimentin expression (Fig.10). It was therefore of interest to determine whether resveratrol-inhibited EMT transition were exerted through the regulation of forkhead protein. Western blot and immunofluorescence staining experiments were preformed. Stable expressed cells with FOXC2 increased the migration and invasion ability in vitro study, and rescued resveratrol-reduced cell mobility and resveratrol-inhibited the expression of EMT markers (Fig.11-13). Treatment with resveratrol had no effect on cell viability in A549 overexpression of FOXC2 cells (Fig.14-15). These results indicated that resveratrol-mediated repression of EMT transition through down-regulated the expression of FOXC2 in lung cancer cells. 3.4 PI-3K/Akt activity is required to increase the expression of FOXC2 in A549 cells. Activation of FOXC2 is involved in phosphatidylinositol 3-kinase (PI3K) and ERK1/2 signaling pathways in adipocytes [120] and endothelial cells [121] but the role of FOXC2 in cell mobility and EMT in lung cancer cells is not clear. To address this issue, A549 cells were treated with PI-3K/Akt inhibitor, LY294002 and dual inhibitor of MEK1 and MEK2, U0126, and then FOXC2 expression were analyzed by western blot and by reporter assay. Fig.16 revealed that PI-3K/Akt inhibitor, LY294002, but not MEPK inhibitor, U0126, reduced the expression of FOXC2 and FOXC2 promoter activities (F1). To confirm this observation, we used another approach to test the role of Akt in regulating FOXC2 expression by transfected constitutively activate myristoylated Akt, myr-Akt, in A549 cells with or without resveratrol. These results revealed that constitutive activation of Akt induced up-regulation FOXC2 expression, and rescued resveratrol-mediated inhibition of 14.
(23) FOXC2. Overexpression of Akt in cancer cells led to EMT induction and rescued resveratrol-mediated EMT markers expression (Fig.17). These data suggest the possible involvement of PI-3K/Akt, rather than MAPK signaling pathway, in the regulation of FOXC2 expression and EMT transition in lung cancer cells. 3.5 Protein serine/threonine phosphatase 2A catalytic subunit C (PP2A/C) acts as an up-regulator of resveratrol-inhibited FOXC2 expression. Many researchers have showed that PP2A, a serine/threonine phosphatase, interacts with Akt and thus down-regulates Akt activity by dephosphorylating Akt [122]. To examine that involvement of PP2A/C in resveratrol-mediated inhibition of PI-3K/Akt, A549 human lung cancer cells were treated with resveratrol with different concentrations or at different time and then analyzed the expression of PP2A/C and PP2A activity. Treatment with resveratrol increased the expression of PP2A/C and up-regulated the expression of PP2A/C in a time-dependent manner as well as PP2A activities (Fig.18). To determine the role of PP2A/C in regulating the expression of FOXC2 through dephosphorylated Akt, A549 cells were treated with resveratrol in the presence of okadaic acid (OA), a PP2A inhibitor. Data from western blot confirmed that decreased the expression of PP2A/C by PP2A inhibitor significantly increased FOXC2 and phospho-Akt expression and decreased resveratrol-induced PP2A activation (Fig.19). To further confirm this observation, we used another approach to test the role of PP2A/C by expression shLuc and shPP2A/C targeted knockdown control or PP2A/C by lentivirus infection, respectively. These results support those obtained above that down-regulation of PP2A/C increased the expression of FOXC2 and phospho-Akt by transient or stable infection (Fig.20). To ascertain the role of FOXC2 in resveratrol-mediated PP2A/C up-regulation, we knockdown PP2A/C and then treated with resveratrol. Down-regulated PP2A/C expression rescued resveratrol-inhibited FOXC2 and phosphorylated Akt expression and increased 15.
(24) resveratrol-inhibited cell mobility (Fig.21-22). These findings provided evidence that resveratrol-inhibited FOXC2 activation and cell mobility through down-regulation of Akt that inhibited by up-regulation the expression of PP2A/C.. 16.
(25) 4. Discussions Recent reports have shown that resveratrol is a potent cancer chemoprevention agent [63] that prevent, inhibits by either reducing angiogenesis [115], cancer cell metastasis [116,117] or inducing cancer cell apoptosis [87,88]. In this study, we verified that the regulation of the signaling pathway from protein serine/threonine phosphatase, PP2A/C, to subsequent Akt-mediated FOXC2 activation was critical for resveratrol-inhibited metastasis in human lung cancer cells. The EMT program plays a role in cancer-related mortality: progression to distant metastatic disease and acquisition of therapeutic resistance and link to generation of cancer cells with stem cell-like properties [123]. To the best of our knowledge, there are currently no reports on EMT transition being involved in resveratrol-mediated inhibition of metastatic ability of cancer cells. In the present study, resveratrol inhibited the EMT transition and cell mobility in different lung cancer cells (Fig.1-3). We also showed that resveratrol significantly decreased FOXC2 expression but slightly on other EMT-related transcription factors, such as twist and slug (Fig.6-8). Overexpression of FOXC2 also significantly rescued resveratrol-inhibited EMT transition and cell mobility in lung cancer cells (Fig.11-13). In this study, resveratrol had the ability to repress EMT transition through down-regulation of FOXC2 expression. FOXC2 may be the potent downstream events that involved in resveratrol-inhibited cell metastasis in lung cancer cells. FOXC1 and FOXC2 belong to the members of forkhead proteins. Overexpression of FOXC1 in MCF12A cells leads to complete EMT transition, as determined by cell morphology change from differentiated epithelial morphology to CD44+ cell-like mesenchymal phenotype and decrease E-cadherin, increase N-cadherin expression, and increase cell motility and invasion ability [124]. Overexpression of FOXC2 in EpRas mouse mammary carcinoma cells leads to the 17.
(26) increased in cell metastatic ability to lung. Ectopic expression of Twist, Snail, Goosecoid or in response to EMT inducer, TGF-E, in HMLE cells elevates FOXC2 expression and EMT transition [50]. Although the expression of FOXC2 may lead to cancer cells with higher metastatic potential, the mechanism involved in FOXC2 regulation remains unclear. Therefore, we suggest that resveratrol inhibits FOXC2 expression through PP2A-mediated Akt repression to decrease cancer mobility and overexpression of FOXC2 rescued resveratrol-inhibited cancer mobility. The results of our study showed that a signaling cascade of PP2A/Akt/FOXC2 in response to resveratrol-inhibited cancer metastasis. The expression of Foxc2 is up-regulated in the presence of insulin and TNF-D which through PI3K-Akt and ERk1/2-dependent pathway in 3T3-L1 adipocyte [120]. VEGF-activated PI3K and ERK pathways regulate the activity of Foxc1 and Foxc2 in Dll4 and Hey2 induction [121]. In this study, treatment with PI-3K/Akt inhibitor, LY294002, inhibited FOXC2 activation, but in the present of ERK1/2 inhibitor, U0126, did not decrease the inhibitor of FOXC2 analysis by western blot and reporter assay (Fig.16). Myr-Akt-transfected A549 cells induced the expression of FOXC2 and rescued resveratrol-inhibited FOXC2 expression (Fig.17). According to the above observation, we presume that resveratrol-mediated decreased FOXC2 expression is through PI-3K/Akt pathway, rather than ERK1/2 pathway in lung cancer cells. In this study, the questions of how Akt regulates the expression of FOXC2 need further investigation. PP2A is a key protein serine/threonine phosphatase that is responsible for 30-50% of the total cellular serine/thronine dephosphorylation activity. PP2A is a holoenzyme contains an active core dimmer composed by the catalytic subunit (PP2A/C) and a scaffold protein termed the A subunit (PP2A/A).The AC core dimmer complex interact with regulatory B subunits (PP2A/B) to determine the substrate 18.
(27) specificity, subcellular localization and catalytic activity of the PP2A [125]. PP2A has been reported that regulates many signaling transduction processes, such as Akt [126,127] and MAPK [128].PP2A has been shown to decreases Akt activity and dephosphorylated Akt at both Thr-308 and Ser-473 [126,127]. PP2A interacts with Akt [122] and PP2A inhibitors such as okadaic acid activate the expression of Akt means that PP2A plays an opposite role in regulation Akt [126,127]. Inhibition of PP2A activity by okadaic acid stimulates cell migration ability in Lewis lung carcinoma cells [129,130]. In this study, we showed that PP2A/C expression knockdown by shRNA induced cell metastatic ability and the expression of FOXC2 (Fig.20-22). Resveratrol-mediated activated the expression of PP2A/C was critical for Akt dephosphorylation and FOXC2 down-regulation (Fig.19 and 21). Thus, we suggest that resveratrol-activated PP2A/C triggers dephosphorylation of downstream Akt to decrease the expression of FOXC2. In conclusion, we present the first evidence demonstrating that the cancer-chemopreventive agent resveratrol induces a PP2A/C-dependent signaling pathway. We delineated the mechanism of resveratrol-inhibited metastasis. PP2A/C is activated after resveratrol treatment. The activated PP2A/C further inactivated the PI3K/Akt-FOXC2 pathway and resulted in the decreased metastatic ability of lung cancer cells (Fig.23).. 19.
(28) 5. Reference 1. Paget S (1989) The distribution of secondary growths in cancer of the breast. 1889. Cancer Metastasis Rev 8: 98-101. 2. Folkman J (1986) How is blood vessel growth regulated in normal and neoplastic tissue? G.H.A. Clowes memorial Award lecture. Cancer Res 46: 467-473. 3. Fisher B, Fisher ER (1966) The interrelationship of hematogenous and lymphatic tumor cell dissemination. Surg Gynecol Obstet 122: 791-798. 4. Fisher ER, Fisher B (1967) Recent observations on concepts of metastasis. Arch Pathol 83: 321-324. 5. Nicolson GL (1988) Cancer metastasis: tumor cell and host organ properties important in metastasis to specific secondary sites. Biochim Biophys Acta 948: 175-224. 6. Fidler IJ (2002) The organ microenvironment and cancer metastasis. Differentiation 70: 498-505. 7. Fidler IJ (2003) The pathogenesis of cancer metastasis: the 'seed and soil' hypothesis revisited. Nat Rev Cancer 3: 453-458. 8. Yap AS, Brieher WM, Gumbiner BM (1997) Molecular and functional analysis of cadherin-based adherens junctions. Annu Rev Cell Dev Biol 13: 119-146. 9. Schock F, Perrimon N (2002) Molecular mechanisms of epithelial morphogenesis. Annu Rev Cell Dev Biol 18: 463-493. 10. Hay ED (1995) An overview of epithelio-mesenchymal transformation. Acta Anat (Basel) 154: 8-20. 11. Thompson EW, Newgreen DF, Tarin D (2005) Carcinoma invasion and metastasis: a role for epithelial-mesenchymal transition? Cancer Res 65: 5991-5995; discussion 5995. 12. Greenburg G, Hay ED (1982) Epithelia suspended in collagen gels can lose 20.
(29) polarity and express characteristics of migrating mesenchymal cells. J Cell Biol 95: 333-339. 13. Greenburg G, Hay ED (1986) Cytodifferentiation and tissue phenotype change during transformation of embryonic lens epithelium to mesenchyme-like cells in vitro. Dev Biol 115: 363-379. 14. Greenburg G, Hay ED (1988) Cytoskeleton and thyroglobulin expression change during transformation of thyroid epithelium to mesenchyme-like cells. Development 102: 605-622. 15. Boyer B, Thiery JP (1993) Epithelium-mesenchyme interconversion as example of epithelial plasticity. APMIS 101: 257-268. 16. Vandewalle C, Comijn J, De Craene B, Vermassen P, Bruyneel E, et al. (2005) SIP1/ZEB2 induces EMT by repressing genes of different epithelial cell-cell junctions. Nucleic Acids Res 33: 6566-6578. 17. Ikenouchi J, Matsuda M, Furuse M, Tsukita S (2003) Regulation of tight junctions during the epithelium-mesenchyme transition: direct repression of the gene expression of claudins/occludin by Snail. J Cell Sci 116: 1959-1967. 18. De Craene B, Gilbert B, Stove C, Bruyneel E, van Roy F, et al. (2005) The transcription factor snail induces tumor cell invasion through modulation of the epithelial cell differentiation program. Cancer Res 65: 6237-6244. 19. Savagner P, Yamada KM, Thiery JP (1997) The zinc-finger protein slug causes desmosome dissociation, an initial and necessary step for growth factor-induced epithelial-mesenchymal transition. J Cell Biol 137: 1403-1419. 20. Leret ML, Peinado V, Gonzalez JC, Suarez LM, Rua C (2004) Maternal adrenalectomy affects development of adrenal medulla. Life Sci 74: 1861-1867. 21. Bindels S, Mestdagt M, Vandewalle C, Jacobs N, Volders L, et al. (2006) Regulation of vimentin by SIP1 in human epithelial breast tumor cells. Oncogene 21.
(30) 25: 4975-4985. 22. Viebahn C (1995) Epithelio-mesenchymal transformation during formation of the mesoderm in the mammalian embryo. Acta Anat (Basel) 154: 79-97. 23. Viebahn C, Mayer B, Miething A (1995) Morphology of incipient mesoderm formation in the rabbit embryo: a light- and retrospective electron-microscopic study. Acta Anat (Basel) 154: 99-110. 24. Duband JL, Monier F, Delannet M, Newgreen D (1995) Epithelium-mesenchyme transition during neural crest development. Acta Anat (Basel) 154: 63-78. 25. Bolender DL, Markwald RR (1979) Epithelial-mesenchymal transformation in chick atrioventricular cushion morphogenesis. Scan Electron Microsc: 313-321. 26. Mjaatvedt CH, Markwald RR (1989) Induction of an epithelial-mesenchymal transition by an in vivo adheron-like complex. Dev Biol 136: 118-128. 27. Fitchett JE, Hay ED (1989) Medial edge epithelium transforms to mesenchyme after embryonic palatal shelves fuse. Dev Biol 131: 455-474. 28. Davies JA (1996) Mesenchyme to epithelium transition during development of the mammalian kidney tubule. Acta Anat (Basel) 156: 187-201. 29. Liu Y (2004) Epithelial to mesenchymal transition in renal fibrogenesis: pathologic significance, molecular mechanism, and therapeutic intervention. J Am Soc Nephrol 15: 1-12. 30. Grunert S, Jechlinger M, Beug H (2003) Diverse cellular and molecular mechanisms contribute to epithelial plasticity and metastasis. Nat Rev Mol Cell Biol 4: 657-665. 31. Vincent-Salomon A, Thiery JP (2003) Host microenvironment in breast cancer development: epithelial-mesenchymal transition in breast cancer development. Breast Cancer Res 5: 101-106. 32. Loric S, Paradis V, Gala JL, Berteau P, Bedossa P, et al. (2001) Abnormal 22.
(31) E-cadherin expression and prostate cell blood dissemination as markers of biological recurrence in cancer. Eur J Cancer 37: 1475-1481. 33. Berx G, Becker KF, Hofler H, van Roy F (1998) Mutations of the human E-cadherin (CDH1) gene. Hum Mutat 12: 226-237. 34. Siegel PM, Shu W, Cardiff RD, Muller WJ, Massague J (2003) Transforming growth factor beta signaling impairs Neu-induced mammary tumorigenesis while promoting pulmonary metastasis. Proc Natl Acad Sci U S A 100: 8430-8435. 35. Nelson WJ, Nusse R (2004) Convergence of Wnt, beta-catenin, and cadherin pathways. Science 303: 1483-1487. 36. Eger A, Stockinger A, Park J, Langkopf E, Mikula M, et al. (2004) beta-Catenin and TGFbeta signalling cooperate to maintain a mesenchymal phenotype after FosER-induced epithelial to mesenchymal transition. Oncogene 23: 2672-2680. 37. Timmerman LA, Grego-Bessa J, Raya A, Bertran E, Perez-Pomares JM, et al. (2004) Notch promotes epithelial-mesenchymal transition during cardiac development and oncogenic transformation. Genes Dev 18: 99-115. 38. Zavadil J, Cermak L, Soto-Nieves N, Bottinger EP (2004) Integration of TGF-beta/Smad and Jagged1/Notch signalling in epithelial-to-mesenchymal transition. EMBO J 23: 1155-1165. 39. Karhadkar SS, Bova GS, Abdallah N, Dhara S, Gardner D, et al. (2004) Hedgehog signalling in prostate regeneration, neoplasia and metastasis. Nature 431: 707-712. 40. Yang MH, Wu MZ, Chiou SH, Chen PM, Chang SY, et al. (2008) Direct regulation of TWIST by HIF-1alpha promotes metastasis. Nat Cell Biol 10: 295-305. 41. Imai T, Horiuchi A, Wang C, Oka K, Ohira S, et al. (2003) Hypoxia attenuates the expression of E-cadherin via up-regulation of SNAIL in ovarian carcinoma cells. 23.
(32) Am J Pathol 163: 1437-1447. 42. Batlle E, Sancho E, Franci C, Dominguez D, Monfar M, et al. (2000) The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol 2: 84-89. 43. Cano A, Perez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, et al. (2000) The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol 2: 76-83. 44. Hajra KM, Chen DY, Fearon ER (2002) The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res 62: 1613-1618. 45. Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, et al. (2004) Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 117: 927-939. 46. Eger A, Aigner K, Sonderegger S, Dampier B, Oehler S, et al. (2005) DeltaEF1 is a transcriptional repressor of E-cadherin and regulates epithelial plasticity in breast cancer cells. Oncogene 24: 2375-2385. 47. Comijn J, Berx G, Vermassen P, Verschueren K, van Grunsven L, et al. (2001) The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Mol Cell 7: 1267-1278. 48. Perez-Moreno MA, Locascio A, Rodrigo I, Dhondt G, Portillo F, et al. (2001) A new role for E12/E47 in the repression of E-cadherin expression and epithelial-mesenchymal transitions. J Biol Chem 276: 27424-27431. 49. Hartwell KA, Muir B, Reinhardt F, Carpenter AE, Sgroi DC, et al. (2006) The Spemann organizer gene, Goosecoid, promotes tumor metastasis. Proc Natl Acad Sci U S A 103: 18969-18974. 50. Mani SA, Yang J, Brooks M, Schwaninger G, Zhou A, et al. (2007) Mesenchyme Forkhead 1 (FOXC2) plays a key role in metastasis and is associated with 24.
(33) aggressive basal-like breast cancers. Proc Natl Acad Sci U S A 104: 10069-10074. 51. Hamamori Y, Wu HY, Sartorelli V, Kedes L (1997) The basic domain of myogenic basic helix-loop-helix (bHLH) proteins is the novel target for direct inhibition by another bHLH protein, Twist. Mol Cell Biol 17: 6563-6573. 52. Clark KL, Halay ED, Lai E, Burley SK (1993) Co-crystal structure of the HNF-3/fork head DNA-recognition motif resembles histone H5. Nature 364: 412-420. 53. Hiemisch H, Monaghan AP, Schutz G, Kaestner KH (1998) Expression of the mouse Fkh1/Mf1 and Mfh1 genes in late gestation embryos is restricted to mesoderm derivatives. Mech Dev 73: 129-132. 54. Cederberg A, Gronning LM, Ahren B, Tasken K, Carlsson P, et al. (2001) FOXC2 is a winged helix gene that counteracts obesity, hypertriglyceridemia, and diet-induced insulin resistance. Cell 106: 563-573. 55. Kume T, Deng K, Hogan BL (2000) Murine forkhead/winged helix genes Foxc1 (Mf1) and Foxc2 (Mfh1) are required for the early organogenesis of the kidney and urinary tract. Development 127: 1387-1395. 56. Seo S, Fujita H, Nakano A, Kang M, Duarte A, et al. (2006) The forkhead transcription factors, Foxc1 and Foxc2, are required for arterial specification and lymphatic sprouting during vascular development. Dev Biol 294: 458-470. 57. Hayashi H, Sano H, Seo S, Kume T (2008) The Foxc2 transcription factor regulates angiogenesis via induction of integrin beta 3 expression. J Biol Chem. 58. Baur JA, Sinclair DA (2006) Therapeutic potential of resveratrol: the in vivo evidence. Nat Rev Drug Discov 5: 493-506. 59. Nonomura S, Kanagawa H, Makimoto A (1963) [Chemical Constituents of Polygonaceous Plants. I. Studies on the Components of Ko-J O-Kon. (Polygonum Cuspidatum Sieb. Et Zucc.)]. Yakugaku Zasshi 83: 988-990. 25.
(34) 60. Celotti E, Ferrarini R, Zironi R, Conte LS (1996) Resveratrol content of some wines obtained from dried Valpolicella grapes: Recioto and Amarone. J Chromatogr A 730: 47-52. 61. Saiko P, Szakmary A, Jaeger W, Szekeres T (2008) Resveratrol and its analogs: defense against cancer, coronary disease and neurodegenerative maladies or just a fad? Mutat Res 658: 68-94. 62. Bradamante S, Barenghi L, Villa A (2004) Cardiovascular protective effects of resveratrol. Cardiovasc Drug Rev 22: 169-188. 63. Jang M, Cai L, Udeani GO, Slowing KV, Thomas CF, et al. (1997) Cancer chemopreventive activity of resveratrol, a natural product derived from grapes. Science 275: 218-220. 64. Sinha K, Chaudhary G, Gupta YK (2002) Protective effect of resveratrol against oxidative stress in middle cerebral artery occlusion model of stroke in rats. Life Sci 71: 655-665. 65. Wang Q, Xu J, Rottinghaus GE, Simonyi A, Lubahn D, et al. (2002) Resveratrol protects against global cerebral ischemic injury in gerbils. Brain Res 958: 439-447. 66. Howitz KT, Bitterman KJ, Cohen HY, Lamming DW, Lavu S, et al. (2003) Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature 425: 191-196. 67. Viswanathan M, Kim SK, Berdichevsky A, Guarente L (2005) A role for SIR-2.1 regulation of ER stress response genes in determining C. elegans life span. Dev Cell 9: 605-615. 68. Bauer JH, Goupil S, Garber GB, Helfand SL (2004) An accelerated assay for the identification of lifespan-extending interventions in Drosophila melanogaster. Proc Natl Acad Sci U S A 101: 12980-12985. 26.
(35) 69. Valenzano DR, Terzibasi E, Genade T, Cattaneo A, Domenici L, et al. (2006) Resveratrol prolongs lifespan and retards the onset of age-related markers in a short-lived vertebrate. Curr Biol 16: 296-300. 70. Baur JA, Pearson KJ, Price NL, Jamieson HA, Lerin C, et al. (2006) Resveratrol improves health and survival of mice on a high-calorie diet. Nature 444: 337-342. 71. De Ledinghen V, Monvoisin A, Neaud V, Krisa S, Payrastre B, et al. (2001) Trans-resveratrol, a grapevine-derived polyphenol, blocks hepatocyte growth factor-induced invasion of hepatocellular carcinoma cells. Int J Oncol 19: 83-88. 72. Kozuki Y, Miura Y, Yagasaki K (2001) Resveratrol suppresses hepatoma cell invasion independently of its anti-proliferative action. Cancer Lett 167: 151-156. 73. Mahyar-Roemer M, Katsen A, Mestres P, Roemer K (2001) Resveratrol induces colon tumor cell apoptosis independently of p53 and precede by epithelial differentiation, mitochondrial proliferation and membrane potential collapse. Int J Cancer 94: 615-622. 74. Wolter F, Akoglu B, Clausnitzer A, Stein J (2001) Downregulation of the cyclin D1/Cdk4 complex occurs during resveratrol-induced cell cycle arrest in colon cancer cell lines. J Nutr 131: 2197-2203. 75. Mgbonyebi OP, Russo J, Russo IH (1998) Antiproliferative effect of synthetic resveratrol on human breast epithelial cells. Int J Oncol 12: 865-869. 76. Kim YA, Lee WH, Choi TH, Rhee SH, Park KY, et al. (2003) Involvement of p21WAF1/CIP1, pRB, Bax and NF-kappaB in induction of growth arrest and apoptosis by resveratrol in human lung carcinoma A549 cells. Int J Oncol 23: 1143-1149. 77. Matsuoka A, Furuta A, Ozaki M, Fukuhara K, Miyata N (2001) Resveratrol, a naturally occurring polyphenol, induces sister chromatid exchanges in a Chinese hamster lung (CHL) cell line. Mutat Res 494: 107-113. 27.
(36) 78. Larrosa M, Tomas-Barberan FA, Espin JC (2003) Grape polyphenol resveratrol and the related molecule 4-hydroxystilbene induce growth inhibition, apoptosis, S-phase arrest, and upregulation of cyclins A, E, and B1 in human SK-Mel-28 melanoma cells. J Agric Food Chem 51: 4576-4584. 79. Niles RM, McFarland M, Weimer MB, Redkar A, Fu YM, et al. (2003) Resveratrol is a potent inducer of apoptosis in human melanoma cells. Cancer Lett 190: 157-163. 80. Elattar TM, Virji AS (1999) The effect of red wine and its components on growth and proliferation of human oral squamous carcinoma cells. Anticancer Res 19: 5407-5414. 81. ElAttar TM, Virji AS (1999) Modulating effect of resveratrol and quercetin on oral cancer cell growth and proliferation. Anticancer Drugs 10: 187-193. 82. Opipari AW, Jr., Tan L, Boitano AE, Sorenson DR, Aurora A, et al. (2004) Resveratrol-induced autophagocytosis in ovarian cancer cells. Cancer Res 64: 696-703. 83. Yang SH, Kim JS, Oh TJ, Kim MS, Lee SW, et al. (2003) Genome-scale analysis of resveratrol-induced gene expression profile in human ovarian cancer cells using a cDNA microarray. Int J Oncol 22: 741-750. 84. Zoberi I, Bradbury CM, Curry HA, Bisht KS, Goswami PC, et al. (2002) Radiosensitizing and anti-proliferative effects of resveratrol in two human cervical tumor cell lines. Cancer Lett 175: 165-173. 85. Ciolino HP, Yeh GC (1999) Inhibition of aryl hydrocarbon-induced cytochrome P-450 1A1 enzyme activity and CYP1A1 expression by resveratrol. Mol Pharmacol 56: 760-767. 86. Mutoh M, Takahashi M, Fukuda K, Matsushima-Hibiya Y, Mutoh H, et al. (2000) Suppression of cyclooxygenase-2 promoter-dependent transcriptional activity in 28.
(37) colon cancer cells by chemopreventive agents with a resorcin-type structure. Carcinogenesis 21: 959-963. 87. Clement MV, Hirpara JL, Chawdhury SH, Pervaiz S (1998) Chemopreventive agent resveratrol, a natural product derived from grapes, triggers CD95 signaling-dependent apoptosis in human tumor cells. Blood 92: 996-1002. 88. Dorrie J, Gerauer H, Wachter Y, Zunino SJ (2001) Resveratrol induces extensive apoptosis by depolarizing mitochondrial membranes and activating caspase-9 in acute lymphoblastic leukemia cells. Cancer Res 61: 4731-4739. 89. Hsieh TC, Juan G, Darzynkiewicz Z, Wu JM (1999) Resveratrol increases nitric oxide synthase, induces accumulation of p53 and p21(WAF1/CIP1), and suppresses cultured bovine pulmonary artery endothelial cell proliferation by perturbing progression through S and G2. Cancer Res 59: 2596-2601. 90. Huang C, Ma WY, Goranson A, Dong Z (1999) Resveratrol suppresses cell transformation and induces apoptosis through a p53-dependent pathway. Carcinogenesis 20: 237-242. 91. She QB, Bode AM, Ma WY, Chen NY, Dong Z (2001) Resveratrol-induced activation of p53 and apoptosis is mediated by extracellular-signal-regulated protein kinases and p38 kinase. Cancer Res 61: 1604-1610. 92. Shih A, Davis FB, Lin HY, Davis PJ (2002) Resveratrol induces apoptosis in thyroid cancer cell lines via a MAPK- and p53-dependent mechanism. J Clin Endocrinol Metab 87: 1223-1232. 93. Adhami VM, Afaq F, Ahmad N (2001) Involvement of the retinoblastoma (pRb)-E2F/DP pathway during antiproliferative effects of resveratrol in human epidermoid carcinoma (A431) cells. Biochem Biophys Res Commun 288: 579-585. 94. Ahmad N, Adhami VM, Afaq F, Feyes DK, Mukhtar H (2001) Resveratrol causes 29.
(38) WAF-1/p21-mediated G(1)-phase arrest of cell cycle and induction of apoptosis in human epidermoid carcinoma A431 cells. Clin Cancer Res 7: 1466-1473. 95. Bernhard D, Tinhofer I, Tonko M, Hubl H, Ausserlechner MJ, et al. (2000) Resveratrol causes arrest in the S-phase prior to Fas-independent apoptosis in CEM-C7H2 acute leukemia cells. Cell Death Differ 7: 834-842. 96. Joe AK, Liu H, Suzui M, Vural ME, Xiao D, et al. (2002) Resveratrol induces growth inhibition, S-phase arrest, apoptosis, and changes in biomarker expression in several human cancer cell lines. Clin Cancer Res 8: 893-903. 97. Kuwajerwala N, Cifuentes E, Gautam S, Menon M, Barrack ER, et al. (2002) Resveratrol induces prostate cancer cell entry into s phase and inhibits DNA synthesis. Cancer Res 62: 2488-2492. 98. Liang YC, Tsai SH, Chen L, Lin-Shiau SY, Lin JK (2003) Resveratrol-induced G2 arrest through the inhibition of CDK7 and p34CDC2 kinases in colon carcinoma HT29 cells. Biochem Pharmacol 65: 1053-1060. 99. Draczynska-Lusiak B, Chen YM, Sun AY (1998) Oxidized lipoproteins activate NF-kappaB binding activity and apoptosis in PC12 cells. Neuroreport 9: 527-532. 100. Holmes-McNary M, Baldwin AS, Jr. (2000) Chemopreventive properties of trans-resveratrol are associated with inhibition of activation of the IkappaB kinase. Cancer Res 60: 3477-3483. 101. Manna SK, Mukhopadhyay A, Aggarwal BB (2000) Resveratrol suppresses TNF-induced activation of nuclear transcription factors NF-kappa B, activator protein-1, and apoptosis: potential role of reactive oxygen intermediates and lipid peroxidation. J Immunol 164: 6509-6519. 102. Tsai SH, Lin-Shiau SY, Lin JK (1999) Suppression of nitric oxide synthase and the down-regulation of the activation of NFkappaB in macrophages by resveratrol. Br J Pharmacol 126: 673-680. 30.
(39) 103. Yu R, Hebbar V, Kim DW, Mandlekar S, Pezzuto JM, et al. (2001) Resveratrol inhibits phorbol ester and UV-induced activator protein 1 activation by interfering with mitogen-activated protein kinase pathways. Mol Pharmacol 60: 217-224. 104. Quinones A, Dobberstein KU, Rainov NG (2003) The egr-1 gene is induced by DNA-damaging agents and non-genotoxic drugs in both normal and neoplastic human cells. Life Sci 72: 2975-2992. 105. Ragione FD, Cucciolla V, Criniti V, Indaco S, Borriello A, et al. (2003) p21Cip1 gene expression is modulated by Egr1: a novel regulatory mechanism involved in the resveratrol antiproliferative effect. J Biol Chem 278: 23360-23368. 106. Choi HK, Yang JW, Kang KW (2006) Bifunctional effect of resveratrol on the expression of ErbB2 in human breast cancer cell. Cancer Lett 242: 198-206. 107. El-Mowafy AM, White RE (1999) Resveratrol inhibits MAPK activity and nuclear translocation in coronary artery smooth muscle: reversal of endothelin-1 stimulatory effects. FEBS Lett 451: 63-67. 108. Miloso M, Bertelli AA, Nicolini G, Tredici G (1999) Resveratrol-induced activation of the mitogen-activated protein kinases, ERK1 and ERK2, in human neuroblastoma SH-SY5Y cells. Neurosci Lett 264: 141-144. 109. Aziz MH, Nihal M, Fu VX, Jarrard DF, Ahmad N (2006) Resveratrol-caused apoptosis of human prostate carcinoma LNCaP cells is mediated via modulation of phosphatidylinositol 3'-kinase/Akt pathway and Bcl-2 family proteins. Mol Cancer Ther 5: 1335-1341. 110. Li Y, Liu J, Liu X, Xing K, Wang Y, et al. (2006) Resveratrol-induced cell inhibition of growth and apoptosis in MCF7 human breast cancer cells are associated with modulation of phosphorylated Akt and caspase-9. Appl Biochem Biotechnol 135: 181-192. 111. Stewart JR, Ward NE, Ioannides CG, O'Brian CA (1999) Resveratrol 31.
(40) preferentially inhibits protein kinase C-catalyzed phosphorylation of a cofactor-independent, arginine-rich protein substrate by a novel mechanism. Biochemistry 38: 13244-13251. 112. Stewart JR, Christman KL, O'Brian CA (2000) Effects of resveratrol on the autophosphorylation of phorbol ester-responsive protein kinases: inhibition of protein kinase D but not protein kinase C isozyme autophosphorylation. Biochem Pharmacol 60: 1355-1359. 113. Yoon SH, Kim YS, Ghim SY, Song BH, Bae YS (2002) Inhibition of protein kinase CKII activity by resveratrol, a natural compound in red wine and grapes. Life Sci 71: 2145-2152. 114. Walle T, Hsieh F, DeLegge MH, Oatis JE, Jr., Walle UK (2004) High absorption but very low bioavailability of oral resveratrol in humans. Drug Metab Dispos 32: 1377-1382. 115. Lin MT, Yen ML, Lin CY, Kuo ML (2003) Inhibition of vascular endothelial growth factor-induced angiogenesis by resveratrol through interruption of Src-dependent vascular endothelial cadherin tyrosine phosphorylation. Mol Pharmacol 64: 1029-1036. 116. Tang FY, Su YC, Chen NC, Hsieh HS, Chen KS (2008) Resveratrol inhibits migration and invasion of human breast-cancer cells. Mol Nutr Food Res 52: 683-691. 117. Woo JH, Lim JH, Kim YH, Suh SI, Min DS, et al. (2004) Resveratrol inhibits phorbol myristate acetate-induced matrix metalloproteinase-9 expression by inhibiting JNK and PKC delta signal transduction. Oncogene 23: 1845-1853. 118. Kimura Y, Okuda H (2001) Resveratrol isolated from Polygonum cuspidatum root prevents tumor growth and metastasis to lung and tumor-induced neovascularization in Lewis lung carcinoma-bearing mice. J Nutr 131: 1844-1849. 32.
(41) 119. Kim JB, Islam S, Kim YJ, Prudoff RS, Sass KM, et al. (2000) N-Cadherin extracellular repeat 4 mediates epithelial to mesenchymal transition and increased motility. J Cell Biol 151: 1193-1206. 120. Gronning LM, Cederberg A, Miura N, Enerback S, Tasken K (2002) Insulin and TNF alpha induce expression of the forkhead transcription factor gene Foxc2 in 3T3-L1 adipocytes via PI3K and ERK 1/2-dependent pathways. Mol Endocrinol 16: 873-883. 121. Hayashi H, Kume T (2008) Foxc transcription factors directly regulate Dll4 and Hey2 expression by interacting with the VEGF-Notch signaling pathways in endothelial cells. PLoS ONE 3: e2401. 122. Ivaska J, Nissinen L, Immonen N, Eriksson JE, Kahari VM, et al. (2002) Integrin alpha 2 beta 1 promotes activation of protein phosphatase 2A and dephosphorylation of Akt and glycogen synthase kinase 3 beta. Mol Cell Biol 22: 1352-1359. 123. Polyak K, Weinberg RA (2009) Transitions between epithelial and mesenchymal states: acquisition of malignant and stem cell traits. Nat Rev Cancer 9: 265-273. 124. Bloushtain-Qimron N, Yao J, Snyder EL, Shipitsin M, Campbell LL, et al. (2008) Cell type-specific DNA methylation patterns in the human breast. Proc Natl Acad Sci U S A 105: 14076-14081. 125. Janssens V, Goris J (2001) Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling. Biochem J 353: 417-439. 126. Andjelkovic M, Jakubowicz T, Cron P, Ming XF, Han JW, et al. (1996) Activation and phosphorylation of a pleckstrin homology domain containing protein kinase (RAC-PK/PKB) promoted by serum and protein phosphatase inhibitors. Proc Natl Acad Sci U S A 93: 5699-5704. 33.
(42) 127. Meier R, Thelen M, Hemmings BA (1998) Inactivation and dephosphorylation of protein kinase Balpha (PKBalpha) promoted by hyperosmotic stress. EMBO J 17: 7294-7303. 128. Ory S, Zhou M, Conrads TP, Veenstra TD, Morrison DK (2003) Protein phosphatase 2A positively regulates Ras signaling by dephosphorylating KSR1 and Raf-1 on critical 14-3-3 binding sites. Curr Biol 13: 1356-1364. 129. Young MR (1997) Protein phosphatases-1 and -2A regulate tumor cell migration, invasion and cytoskeletal organization. Adv Exp Med Biol 407: 311-318. 130. Young MR, Liu SW, Meisinger J (2003) Protein phosphatase-2A restricts migration of Lewis lung carcinoma cells by modulating the phosphorylation of focal adhesion proteins. Int J Cancer 103: 38-44.. 34.
(43) Figure1. Resveratrol inhibited the cell metastatic and invasive ability in lung cancer cells. A, for migration assay, cells pretreated by the indicated concentrations of resveratrol for 24h and suspended cells to the upper layer of Transwell (8Pm pore size) and harvested for 24h. B, for invasion assays, cancer cells was suspended to the upper layer of transwell coated with diluted matrigel and incubated for 48h. The indicated concentrations of resveratrol were added to both upper and bottom layers of transwell. Findings were representative of at least three separate experiments. Bars represent meansʳ ± SD. Asterisks denote a significant difference compared with values for untreated control. (***, p<0.001). 35.
(44) Figure2. Resveratrol repressed EMT transition in lung cancer cells. Western blot analyzed the expression of EMT markers with or without resveratrol (10PM) for 48h in different lung cancer cells as indicated. Numbers below lanes show folds of protein expression level. Findings were representative of at least three separate experiments.. 36.
(45) Figure3. Immunofluorescence staining for the effects of resveratrol on the expression of E-cadherin in lung cancer cells. Treatment with 10PM resveratrol A549 cells for 48h were fixed and then stained with anti-E-cadherin antibody (green). The nuclei were stained with DAPI (blue). Scare bars, 20PM. Findings were representative of three independent experiments.. 37.
(46) Figure4.. Treatment. with. resveratrol. changed. cell. morphology. from. mesenchymal-like to epithelial-like in CL1-5 cells. CL1-5 cells were cultured with 10PM resveratrol for 48h and then images were captured by phase-contrast microscopy. Scare bars, 100PM. Findings were representative of three separate experiments. Magnification:ʳ×200.. 38.
(47) Figure5. Cell viability for treatment with resveratrol in CL1-5 cells. Treatment with 10PM resvratrol for 24h and 48h in CL1-5 cells. Bars represent meansʳ± SD.. 39.
(48) Figure6. Effect of resveratrol on EMT-inducing transcription factors in lung cancer cells. Western blotting analyzed the expression of twist, slug, snail and FOXC2 in response to resveratrol (10PM, 48h) in CL1-5 and A549 cells. Numbers below lanes show folds of protein expression level. Findings were reproduced on three separate occasions.. 40.
(49) Figure7. Resveratrol repressed the expression of FOXC2 in lung cancer cells. Western blotting (A) and RT-PCR (B) for analysis the effects of resveratrol (10PM, 48h) on the expression of FOXC2 in different lung cancer cells as indicated. Findings were reproduced on three separate experiments.. 41.
(50) Figure8. Effects of resveratrol on the expression of FOXC2 and E-cadherin in A549 cells. A549 cells were treated with 10PM resveratrol for the indicated times, followed by measurements of FOXC2 and E-cadherin expression by western blot. Findings were representative of three separate experiments.. 42.
(51) Figure9. Effect of resveratrol on FOXC2 promoter activity in CL1-5 cells. A, schematic representation of human FOXC2 promoter construct F6, Within the ~220-bp fragment, a potential Egr-1, AP-2D, NF-NB, MZF-1 and E2F motifs exist. B, luciferase reporter assays using a series of 5’ promoter deletion mutants of the FOXC2 gene (F1-F6). The ~1.9-kb fragment upstream of the start codon contains the transcription factor-binding elements. CL1-5 cells were transfected with these reporter constructs, treated with or without resveratrol (20PM) for 48h and measured the luciferase activity. Bars represent meansʳ± SE from three independent experiments in triplicates. Asterisks denote a significant difference compared with values for untreated control (*, p<0.05; **, p<0.01).. 43.
數據
Outline
相關文件
Incubation with bisphosphonates reduced the cell count, but only became significant for zoledronate at 50 µmol (p=0.028) compared to the control; incubation with 50 µmol
原文題目(出處): Bisphosphonates: restrictions for vasculogenesis and angiogenesis: inhibition of cell function of endothelial progenitor cells and mature endothelial cells
Results of immunohistochemical staining with TTF-1 offered the critical evidence to verify whether the gingival and lung masses were synchronous double primary tumors or the
(E) Varying numbers of tumour cells expressing cancer antigen 125 are present in the lining of tubules (objective magnification ¥10).. The arrowed cells show strong nuclear
The relation between hypoxia-inducible factor (HIF)-1alpha and HIF-2alpha expression with anemia and outcome in surgically treated head and neck cancer. De Schutter H, Landuyt
High pre-treatment serum level of vascular endothelial growth factor (VEGF) is associated with poor outcome in small-cell lung cancer. Telomerase as tumor
patients with stage I/II disease but not in those with stage III disease.43 A high serum level of VEGF is associated with poor survival among patients with small cell lung
Our case highlights an enigmatic presentation of oral submucous fibrosis and its coexistence with oral cancer presenting with unusual neurological disturbance of the inferior