• 沒有找到結果。

1. Introduction

1.4 Resveratrol

Resveratrol (trans-3, 5, 4’-trihydroxystilbene) is a polyphenols which was first isolated from white hellebore (Veratrum grandiflorum O. Loes) in 1940, and since

then have been also found in various plants including grapes, peanuts, mulberries [58].

In 1963, the root in Polygonum Caspidatum used in traditional Chinese and Japanese medicine called Ko-jo-kon[59] found the existence of resveratrol. The sources of resveratrol was from red wine and red grape [60] which was synthesized in the leaf epidermis and in the grape skins [61]. Resveratrol can prevent or slow the progression of illnesses including cardiovascular [62], cancer [63] and ischemic injury [64,65] . There are studies shown that resveratrol could extend lifespan by silent information regulator 2 (Sir2)-dependent mechanisms in Saccharomyces cerevisiae cerevisiae [66], Caenorhabditis elegans [67] and Dorsophila melanogaster [68], and also extend

lifespan of short-lived fish Nothobrachius furzen [69]. Resveratrol is an activator of SIRT1 which has the ability to prolong survival of calorie restriction mice treated with high-calorie diet [70].

The effects of resveratrol are dependent on the cell type, cellular condition, and concentrations and it can have opposing activities [61]. Because resveratrol has the ability to inhibit cancer formation at initiation, promotion and progression, it is shown to have chemoprevention ability [61]. Recently studies shows that resveratrol have chemoprevention functions in liver cancer [71,72], colon cancer [73,74], breast cancer [75], lung cancer [76,77], melanoma [78,79], head and neck squamous cell carcinoma [80,81] and ovarian and cervical carcinoma [82,83,84]. Resveratrol down-regulates the enzyme activity and transcriptional activity of cytochrome P-450 1A1 (CYP1A1) which is a carcinogen-activating enzyme, indicated that resveratrol can inhibit tumor progression at initiation stage [85] and resveratrol also can inhibit tumor formation by down-regulating the expression of cyclooxygenase 2 (COX2) [86]. Treatment with resveratrol could promote apoptosis through FasL pathway [87] , mitochondria pathway [88], p53 activation pathway [89,90,91,92] and Rb-E2F/DP pathway [93].

Resveratrol mediates cell-cycle arrest at difference stages in different cells

[89,94,95,96,97,98]. Some transcription factors are inhibited by resveratrol, including NF-NB [99,100,101,102], AP-1 [103], Egr-1 [104,105], and AP-2D>@ and also down-regulate protein kinases such INBD[100], JNK, MAPK, ERK1/2 [91,92,107,108], Akt [109,110], PKC [111], PKD [112] and CKII [113].

Pharmacokinetic studies shows that in human, resveratrol has rapid metabolism (~8 to 14 min) and converted to sulfate and glucuronide conjugate within ~30 min at liver and kidney [114]. Resveratrol inhibits vascular endothelial growth factor (VEGF)-induced angiogenesis in HUVECs [115] and also inhibits cancer cells invasion and migration in breast cancer [116]. Recently studies shown that resveratrol inhibits the invasion of tumor cells through repression of MMP-2 [116] or MMP-9 [117]. Resveratrol has the effect on prevention tumor growth and metastasis to lung in Lewis Lung Carcinoma-Bearing Mice [118]. Now, treatment with resveratrol in human colon cancer and colorectal cancer have several clinical trials at phase I stage [58].

Thus, we examined the signaling pathway involve in resveratrol-mediated cell metastasis in human lung cancer cells. These data showed that resveratrol induced the activation of serine/threonine protein phosphatase 2A, PP2A/C, in turn, down-regulation the signaling pathway PI3K/Akt-FOXC2. In this study, we found that inactivation of PP2A/C increase the expression of FOXC2 through up-regulation of Akt. These data also found the forkhead protein, FOXC2, was involved in resveratrol-mediated inhibition of metastasis in lung cancer and it may suggest to be a biomarker to early diagnosis in lung cancer. We provide evidence that resveratrol would be a critical therapeutic strategy for lung cancer.

2. Materials and Methods

2.1 Reagents. Resveratrol ʻЇ99% purify) was purchased from Sigma-Aldrich (St.

Louis, MO, USA). A stock solution of resveratrol was made in dimethyl sulfoxide (DMSO, Sigma-Aldrich) at a concentration of 5mM and stored at -8˃к LY294002 (2-(4-Morpholino)-8-phenyl-4H-1-benzopyran-4-one), and okadaic acid (OA) was

purchased from Sigma-Aldrich. UO126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) was purchased from

Calbiochem (Nottingham, U.K.) Anti-E-cadherin, anti-fibronectin, and anti-N-cadherin were purchased from BD biosciences (San Jose, CA, USA).

Anti-FOXC2 was from Abcam (Cambridge, MA, USA) and Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-PP2A C subunit was from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-PP2A C subunit (52F8), anti-phospho-Akt (Ser473), anti-Akt, anti-phospho-extracellular signal-regulated kinase (ERK) 1/2, and anti-ERK were all purchased from Cell Singling Technology (Beverly, MA, USA). Anti-vimentin was purchased from Neomarker (Fremont, CA, USA). Anti-twist, anti-slug, and anti-snail were from Santa Cruz. Anti-D-tubulin was from Sigma-Aldrich (St. Louis, MO, USA).

2.2 Cell culture. GP+E86 and PA317 cell lines were cultured in Dulbeco’s Nodified Eagle Medium (DMEM, GIBCO, Invitrogen, Carlsbad, CA, USA). Lung cancer cell lines CL1-5, A549, H322, H1435, and 293T cells were supplement with DME/F12 (1:1) (Hyclone Laboratories, Logan, Utah, USA). NCI-H520 cells were maintained in RPMI-1640 (Hyclone Laboratories, Logan, Utah, USA). The A549 overexpression FOXC2 cells and A549 and CL1-5 knockdown PP2A/C expression cells were cultured in DME/F12 containing 2Pg/mL puromycin (Sigma-Aldrich). All of medium contained 10% fetal bovine serum and antibiotics (100IU/ml penicillin G and 100Pg/ml streptomycin). Cell culture were maintained at 37к in humidified 5% CO2

atmosphere. For treatment, the resveratrol was diluted in medium and added to cultures to give the desired final concentrations. Untreated cultures received the same amount of the carrier solvent DMSO.

2.3 Western blotting analysis. Resveratrol-treated cells were examined by Western blot analysis at the indicated time. The whole cell extracts were prepared by lysing cell in NETN lysis buffer (150mM NaCl, 20mM Tris-HCl pH8.0, 0.5% NP40 and 1mM EDTA) containing protease inhibitor cocktail (Sigma-Aldrich). After electrophoresis, the proteins were electrotransferred to PVDF membrane (Millipore Corporation, Bedford, MA, USA), blocked by 5% non-fat milk, and probed with the indicated antibodies at 4°C overnight. The blots were than washed, exposed to horseradish peroxidase-conjugated secondary antibodies (Abcam) 1:5000 dilution for 1hr at room temperature, and then detected by chemiluminescence reagent (Millipore).

2.4 Migration and invasion assays. For migration assay, cells pretreated by the indicated concentrations of resveratrol for 24h and suspended 5Ø104 cells to layered in the upper compartment of a Transwell an 8-Pm-diameter polycarbonate filter (8Pm pore size) which was from Corning Incorporated (Corning, NY, USA), and incubated at 38±C for 24h. For invasion assays, 5Ø104 cells was suspend to the upper layer which coated with 30PL diluted matrigel (BD biosciences) and then treated the indicated concentrations of resveratrol for 48h. Each chamber was washed with PBS, cells were fixed by cold-methanol, stained by 0.05% crystal violet, removed noninvaded cells on the top of transwell with cotton swab, and then counted cell with three different fields under light microscope.

2.5 Cell viability by MTS assay. MTS assays were performed according to the manufacturer's instructions (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Promega, Madison, WI, USA). 5×104cells were treated with resveratrol for the

indicated time in 24-well tissue culture plate with 1000µL of medium.

2.6 Colony formation assay. 500 cells were seeded in 6-well tissue culture plate and treated with resveratrol for 48h, replaced fresh medium and incubated for 4 days until colonies were visible. Cells were fixed with 3.7% formaldehy/PBS and were stained by 0.05% crystal violet. The total number of colonies formed on each well were counted.

2.7 Reverse transcriptase–polymerase chain reaction (RT-PCR). Total RNA was isolated using Trizol reagent (Invitrogen) and reverse transcribed into single-stranded cDNA with moloney murine leukemia virusreverse transcriptase (MMLV-RT;

Invitrogen) as manufacturer’s instructions. The primer sequences for FOXC2 were:

5’-GCCTAAGGACCTGGTGAAGC-3’ (forward) and 5’-TTGACGAAGCACTCGTTGAG-3’ (reverse); for human E-actin were:

5’-GCTCGTCGTCGACAACGGCTC-3’ (forward) and 5’-CAAACATGATCTGGGTCATCTTCTC-3’ (reverse). The reaction mixture was

first denatured at 9ˇк for 5 min. For FOXC2, the PCR condition was 94к for 30 sec, 56к for 30 sec, and 72к for 30 sec for 35 cycles; forE-actin was 94к for 30 sec, 55к for 30 sec, and 72к for 30 sec for 22cycles followed by 72к for 10 min.

2.8 Immunofluorescence staining. Treatment with resveratrol for 48h, cells were fixed in 4% paraformaldehyde/PBS for 15min at room temperature and then permeabilized with 0.1% Triton X-100/PBS for 10min at room temperature.

Nonspecific binding sites were block with 5% BSA/PBS and then the cells were incubated with in 1:100 polyclonal antibodies for E-cadherin (Cell Signaling, MA, USA) overnight at 4к and then at room temperature for 1h. After slide was rinsed, primary antibody was detection by Alex Fluoro 488-FITC (Molecular Probes, Eugene, OR, USA) for 1h at room temperature. The nuclei were counterstained with 4', 6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) for 10min at room temperature.

Images were capture with ZEISS fluorescence microscope using software program Axio Vision 4.7.2.

2.9 Establish stable cell line by retrovirus infection. The human FOXC2 cDAN was subcloned into the pBabe-Puro vector and was obtained from Addgene (Cambridge, MA, USA). Retroviral vector expressing FOXC2 gene or the control vector was transfected 4Pg plasmid into an ecotropic packaging cell line by using lipofectaminTM LTX (Invitrogen), GP+E86 containing 4Ø105cells in 6-cm-diameter dish, and harvested overnight. Before infection to a second generation packaging cell line, PA317, the medium of GP+E86 containing polybrene (8µg/mL) were filtered by 0.22PM filter, and added 3mL medium to the 10-cm-diameter dish containing 5Ø105 cells of PA317. After 2h, added the complete medium to 10mL in PA317 and harvested overnight. Packaging cells then were selected with 2µg/mL of puromycin until a confluent 10-cm-diameter dish of resistant cells was obtained. Amphotropic virus were collected from the medium of PA317 to infect cultured cells as described above, and then these cultured cells were selected with 2Pg/mL puromycin. After selection, these cell lines dilute with 1:1000 to obtain single clone about four weeks.

2.10 Construction of luciferase reporters. The FOXC2 promoter (nucleotides -1990 to the Nru site +6) was amplification by PCR (sense: 5’- tgctcgagtgcccaaccagaccagcaac, and antisense: 3’- actaagcttctgcgtgctgcttccgagac) using FOXC2 BAC clone (Invitrogen) as template. The PCR produce was inserted into the cutting site at XhoI and HindIII of pGEM T-easy vector (Promega). The fragment after confirming sequence was subsequently inserted into pGL3-basic reporter (Promega). For a series of deletion constructs was down by described above.

For FOX2-promoter from -1990 to -984, the primers are (sense: 5’- tgctcgagtgcccaaccagaccagcaac, and antisense: 3’-tgctcgagcctgccattccaatccagcg); for -984 to +6 using primers (sense: 5’- actaagcttcgcttggattggaatggcagg, and antisense:

3’- actaagcttctgcgtgctgcttccgagac); from -215 to +6 using primers for (sense:

5’-tgctcgagatccgcccggtccgctgaag, and antisense: 3’- actaagcttctgcgtgctgcttccgagac).

By restriction enzyme BlpI digested FOXC2-promoter from -984 to +6 to generate FOXC2-promoter from -984 to -460 and from -460 to +6.

2.11 Transfection and reporter assay. Transfection of plasmid DNA (pcDNA3.1 and myr-Akt) was performed using Lipofectamine TM LTX or Lipofectamine 2000 for reporter assay according to the manufacturer’s instructions (Invitrogen). For luciferase reporter assays, firefly luciferase activities were normalized to total protein concentrations. After transfection, resveratrol were treated for 48hr. Luciferase assays were carried out using the Luciferase Assay System (Promega) according to manufacturer’s protocol.

2.12 The PP2A immunoprecipitation phosphatase activity. A549 cells were treated with resveratrol at the indicated times and lysed by NETN lysis buffer containing aprotinin, PMSF. Equal amount of 500Pg proteins were used to assay phosphatase activity according to manufacturer’s instructions (Millipore). Briefly, adding 2Pg anti-PP2A C subunit to lysate, rotated at ˇ̓C for overnight and then washed. Added phosphopeptide to lysate, incubated at 30̓C for 10min, and then added malachite green detection solution to lysate incubation for 10 min at room temperature and detected activity for OD650.

2.13 Construction and Production of shRNA in Lentiviral Vector. shPP2A E1 (TRCN000002486) clone, shPP2A C1 (TRCN000002484) clone, pLKO.1-shLuc vector (shRNA against luciferase, act as a control), pMD.G plasmid and pCMVdeltaR8.91 plasmid were obtained form National RNAi Core Facility at the Genomics Research Center (Academia Sinica, Taipei, Taiwan). Recombinant lentiviruses were produced by co-transfecting 293T cells with the lentivirus expression plasmid, the lentivirus packaging vectors pCMVdeltaR8.91, and the

vesicular stomatitis virus G glycoprotein (VSVG) expression vector pMD.G using the LipofectamineTM LTX according to

ʳ

manufacturer’s instructions. The viruses were collected from the culture supernatants on 2 days post-transfection and filtered by 0.45PM filter. Cultured cells were incubated with lentivirus ccontating 8 µg/mL polybrene for 24h, replaced medium and incubated for another 2 days. For stable clone, cells were then selected with 2µg/mL puromycin for 1 week.

2.14 Statistical analysis.

Results are expressed as mean ± SD or SE, as indicated. One-tailed student’s t test was used to compare the intergroup; p < 0.05 was considered statistically significant.

3. Results

3.1 Resveratrol inhibits epithelial-mesenchymal transition in lung cancer cells.

There were many studies shown epithelial-mesenchymal transition (EMT) plays an important role in regulating invasion and migration of cancer cells. To elucidate whether resveratrol inhibited cell mobility of lung cancer cells, CL1-5 and A549 lung carcinoma cells were treated with various concentrations of resveratrol, and cell mobility were determined by migration and invasion assay. Treatment with the indicated concentrations of resveratrol decreased the migration and invasion ability of lung cancer cells in a dose-dependent manner (Fig.1). During EMT transition, cancer cells lose the expression of E-cadherin which regulating cell-cell contact and acquired mesenchymal markers such as vimentin, fibronectin, and N-cadherin [21,31,119]. To examine that the effects of resveratrol in lung cancer cells would abolish EMT transition, lung cancer cells treated with 10PM resveratrol for 48h and then analyzed E-cadherin and mesenchymal markers expression by western blotting analysis.

Resveratrol increased the expression of E-cadherin and decreased the expression of mesenchymal markers such as fibronectin, N-cadherin and vimentin in lung cancer cells (Fig.2). To confirm resveratrol-inhibited EMT with up-regulation of the expression of E-cadherin, immunnofluorescence staining was preformed. The expression of E-cadherin was induced in resveratrol-treated A549, but not in control cells (Fig.3). The cell morphology of CL1-5 cells changed from spindle-shaped mesenchymal type to less-elongated epithelial cell morphology after treatment with resveratrol (Fig.4). The effect of resveratrol on cell viability of CL1-5 cells was down by MTS assay. Treatment with resveratrol for the indicated time had no effect on cell viability (Fig.5). These data indicated that treatment with resveratrol decreased cell mobility through down-regulation EMT and changed cell morphology from spindle-shaped to epithelial characteristics of lung cancer cells.!

3.2 Resveratrol significantly inhibits EMT-inducing transcription factor, FOXC2, at transcriptional level in lung cancer cells.

To elucidated how resveratrol-inhibited EMT, EMT-inducing transcription factors, FOXC2, twist, slug and snail were analysis by western blot analysis in lung cancer cell lines. Resveratrol significantly decreased the expression of FOXC2 in CL1-5 and A549 cells, but had less effect on twist and slug (Fig.6). Inhibition the expression of FOXC2 by resveratrol had the same result in other lung cancer cell lines (Fig.7). To examine that resveratrol-mediated inhibition of FOXC2 was through down-regulation of gene expression, RT-PCR was performed. Fig.7 revealed that resveratrol inhibited the expression of FOXC2 was at transcriptional level in lung cancer cells. The inhibition ability of FOXC2 in response to resveratrol was for 48h and resveratrol enhanced E-cadherin expression was at time-dependent manner (Fig.8).

To determine the regulatory mechanism underlying the transcription of FOXC2 gene by resveratrol, we analyzed the promoter region of human FOXC2 gene. Within the ~1.9-kb fragment of upstream the start codon, there were several transcription factor binding sites. To identify the resveratrol-response elements, a series of 5’

promoter deletion mutants of the FOXC2 gene (F1-F6) were constructed. The F1, F3, F5 and F6 reporter constructs were down-regulated by resveratrol about 40-50%

which indicating that resveratrol-response elements lie between -215 and +6 (F6) (Fig.9). These observations suggest that resveratrol-inhibition EMT were through down-regulated the expression of FOXC2 in human lung cancer cells.

3.3 Ectopic expression of FOXC2 reverses resveratrol-mediated cell mobility and EMT.

To investigate whether the expression of FOXC2 involved in resveratrol-mediated repression of cell mobility in lung cancer cells, FOXC2 was

ectopic expressed in A549 lung cancer cells. Overexpression of FOXC2 in A549 decreased the levels of E-cadherin and up-regulated mesenchymal markers, fibronectin, N-cadherin and vimentin expression (Fig.10). It was therefore of interest to determine whether resveratrol-inhibited EMT transition were exerted through the regulation of forkhead protein. Western blot and immunofluorescence staining experiments were preformed. Stable expressed cells with FOXC2 increased the migration and invasion ability in vitro study, and rescued resveratrol-reduced cell mobility and resveratrol-inhibited the expression of EMT markers (Fig.11-13).

Treatment with resveratrol had no effect on cell viability in A549 overexpression of FOXC2 cells (Fig.14-15). These results indicated that resveratrol-mediated repression of EMT transition through down-regulated the expression of FOXC2 in lung cancer cells.

3.4 PI-3K/Akt activity is required to increase the expression of FOXC2 in A549 cells.

Activation of FOXC2 is involved in phosphatidylinositol 3-kinase (PI3K) and ERK1/2 signaling pathways in adipocytes [120] and endothelial cells [121] but the role of FOXC2 in cell mobility and EMT in lung cancer cells is not clear. To address this issue, A549 cells were treated with PI-3K/Akt inhibitor, LY294002 and dual inhibitor of MEK1 and MEK2, U0126, and then FOXC2 expression were analyzed by western blot and by reporter assay. Fig.16 revealed that PI-3K/Akt inhibitor, LY294002, but not MEPK inhibitor, U0126, reduced the expression of FOXC2 and FOXC2 promoter activities (F1). To confirm this observation, we used another approach to test the role of Akt in regulating FOXC2 expression by transfected constitutively activate myristoylated Akt, myr-Akt, in A549 cells with or without resveratrol. These results revealed that constitutive activation of Akt induced up-regulation FOXC2 expression, and rescued resveratrol-mediated inhibition of

FOXC2. Overexpression of Akt in cancer cells led to EMT induction and rescued resveratrol-mediated EMT markers expression (Fig.17). These data suggest the possible involvement of PI-3K/Akt, rather than MAPK signaling pathway, in the regulation of FOXC2 expression and EMT transition in lung cancer cells.

3.5 Protein serine/threonine phosphatase 2A catalytic subunit C (PP2A/C) acts as an up-regulator of resveratrol-inhibited FOXC2 expression.

Many researchers have showed that PP2A, a serine/threonine phosphatase, interacts with Akt and thus down-regulates Akt activity by dephosphorylating Akt [122]. To examine that involvement of PP2A/C in resveratrol-mediated inhibition of PI-3K/Akt, A549 human lung cancer cells were treated with resveratrol with different concentrations or at different time and then analyzed the expression of PP2A/C and PP2A activity. Treatment with resveratrol increased the expression of PP2A/C and up-regulated the expression of PP2A/C in a time-dependent manner as well as PP2A activities (Fig.18). To determine the role of PP2A/C in regulating the expression of FOXC2 through dephosphorylated Akt, A549 cells were treated with resveratrol in the presence of okadaic acid (OA), a PP2A inhibitor. Data from western blot confirmed that decreased the expression of PP2A/C by PP2A inhibitor significantly increased FOXC2 and phospho-Akt expression and decreased resveratrol-induced PP2A activation (Fig.19). To further confirm this observation, we used another approach to test the role of PP2A/C by expression shLuc and shPP2A/C targeted knockdown control or PP2A/C by lentivirus infection, respectively. These results support those obtained above that down-regulation of PP2A/C increased the expression of FOXC2 and phospho-Akt by transient or stable infection (Fig.20). To ascertain the role of FOXC2 in resveratrol-mediated PP2A/C up-regulation, we knockdown PP2A/C and then treated with resveratrol. Down-regulated PP2A/C expression rescued resveratrol-inhibited FOXC2 and phosphorylated Akt expression and increased

resveratrol-inhibited cell mobility (Fig.21-22). These findings provided evidence that resveratrol-inhibited FOXC2 activation and cell mobility through down-regulation of Akt that inhibited by up-regulation the expression of PP2A/C.

4. Discussions

Recent reports have shown that resveratrol is a potent cancer chemoprevention agent [63] that prevent, inhibits by either reducing angiogenesis [115], cancer cell metastasis [116,117] or inducing cancer cell apoptosis [87,88]. In this study, we verified that the regulation of the signaling pathway from protein serine/threonine phosphatase, PP2A/C, to subsequent Akt-mediated FOXC2 activation was critical for resveratrol-inhibited metastasis in human lung cancer cells.

The EMT program plays a role in cancer-related mortality: progression to distant metastatic disease and acquisition of therapeutic resistance and link to generation of cancer cells with stem cell-like properties [123]. To the best of our knowledge, there are currently no reports on EMT transition being involved in resveratrol-mediated inhibition of metastatic ability of cancer cells. In the present study, resveratrol inhibited the EMT transition and cell mobility in different lung cancer cells (Fig.1-3).

We also showed that resveratrol significantly decreased FOXC2 expression but slightly on other EMT-related transcription factors, such as twist and slug (Fig.6-8).

We also showed that resveratrol significantly decreased FOXC2 expression but slightly on other EMT-related transcription factors, such as twist and slug (Fig.6-8).

相關文件