• 沒有找到結果。

Gallic acid provokes DNA damage and suppresses DNA repair gene expression in human prostate cancer PC-3 cells

N/A
N/A
Protected

Academic year: 2021

Share "Gallic acid provokes DNA damage and suppresses DNA repair gene expression in human prostate cancer PC-3 cells"

Copied!
19
0
0

加載中.... (立即查看全文)

全文

(1)

Environmental Toxicology Journal

Copy of e-mail Notification

Environmental Toxicology Published by John Wiley & Sons, Inc.

Dear Author,

Your page proofs are now available in PDF format, and are ready for your corrections. John Wiley & Sons has made this article available to you online for faster, more efficient editing. Please follow the instructions below to make your corrections as soon as possible.

Alternatively, if you would prefer to receive a paper proof by regular mail, please contact Prashant/Sankar/Balaji (e-mail: [email protected], phone: +91 (44) 4205-8888 (ext.217)). Be sure to include your article number.

First, make sure you have a copy of Adobe Acrobat Reader software. This is free software and is available on the web (http://www.adobe.com/products/acrobat/readstep.html). Or, if you have the Notes annotation tool (not contained within Acrobat reader), you can make corrections electronically and return them to Wiley as an e-mail attachment (see the Notes tool instruction sheet).

Open your web browser, and enter the following web address: http://115.111.50.156/jw/retrieval.aspx?pwd=4f92526d072b

You will be prompted to log in, and asked for a password. Your login name will be your email address, and your password will be 4f92526d072b

Example:

Login: your e-mail address Password: 4f92526d072b

The site contains one file, containing: . Author Instructions Checklist

. Adobe Acrobat Users - NOTES tool sheet . Reprint Order Information

. Copyright Transfer Agreement . Return fax form

. A copy of your page proofs for your article

Print out this file, and fill out the forms by hand. Read your page proofs carefully, and:

. indicate changes or corrections in the margin of the page proofs . answer all queries (footnotes A,B,C, etc.) on the last page of the PDF proof . proofread any tables and equations carefully . check that any Greek, especially "mu", has translated correctly . check your figure legends for accuracy

(2)

Environmental Toxicology Journal

Copy of e-mail Notification

Within 48 hours, please fax, email or mail to the address given below:

1) Page proofs with corrections

2) TIFF or EPS files of figures for correction (if necessary) 3) Signed Copyright Transfer Agreement

4) Return fax form

Return to:

Production Editor, TOX

Cadmus Professional Communications 300 West Chestnut Street, Suite A Ephrata, PA 17522-1987

Email: [email protected] Fax: 717-738-9478 or 717-738-9479

Technical problems or questions regarding your article? If you experience problems downloading your file or have any questions about the article itself, please contact Prashant/Sankar/Balaji (e-mail: [email protected], phone: +91 (44) 4205-8888 (ext.217)). Be sure to include your article number. REMEMBER TO INCLUDE YOUR ARTICLE NO. ( 11-121.R1 ) WITH ALL CORRESPONDENCE. This will help us address your query most

efficiently.

As this e-proofing system was designed to make the publishing process easier for everyone, we welcome any and all feedback. Thanks for participating in our new e-proofing system!

(3)

111 R

I V E R

S

T R E E T

, H

O B O K E N

, NJ 07030

***IMMEDIATE RESPONSE REQUIRED***

Please follow these instructions to avoid delay of publication. READ PROOFS CAREFULLY

• This will be your only chance to review these proofs.

• Please note that the volume and page numbers shown on the proofs are for position only.

ANSWER ALL QUERIES ON PROOFS (Queries for you to answer are attached as the last page of your proof.)

• Mark all corrections directly on the proofs. Note that excessive author alterations may ultimately result in delay of publication and extra costs may be charged to you.

CHECK FIGURES AND TABLES CAREFULLY

• Check size, numbering, and orientation of figures.

• All images in the PDF are downsampled (reduced to lower resolution and file size) to facilitate Internet delivery. These images will appear at higher resolution and sharpness in the printed article.

• Review figure legends to ensure that they are complete. • Check all tables. Review layout, title, and footnotes.

RETURN PROOFS

CTA (If you have not already signed one)

RETURN WITHIN 48 HOURS OF RECEIPT VIA FAX TO 1-717-738-9478 or 717-738-9479

QUESTIONS?

Production Editor, TOX

E-mail: [email protected]

(4)

Softproofing for advanced Adobe Acrobat Users

-

NOTES tool

NOTE: ACROBAT READER FROM THE INTERNET DOES NOT CONTAIN THE NOTES TOOL USED IN THIS PROCEDURE.

Acrobat annotation tools can be very useful for indicating changes to the PDF proof of your article. By

using Acrobat annotation tools, a full digital pathway can be maintained for your page proofs.

The NOTES annotation tool can be used with either Adobe Acrobat 6.0 or Adobe Acrobat 7.0. Other

annotation tools are also available in Acrobat 6.0, but this instruction sheet will concentrate on how to

use the NOTES tool. Acrobat Reader, the free Internet download software from Adobe, DOES NOT

contain the NOTES tool. In order to softproof using the NOTES tool you must have

the full software suite Adobe Acrobat Exchange 6.0 or Adobe Acrobat 7.0 installed on your computer.

Steps for Softproofing using Adobe Acrobat NOTES tool:

1. Open the PDF page proof of your article using either Adobe Acrobat Exchange 6.0 or Adobe

Acrobat 7.0. Proof your article on-screen or print a copy for markup of changes.

2. Go to Edit/Preferences/Commenting (in Acrobat 6.0) or Edit/Preferences/Commenting (in Acrobat

7.0) check “Always use login name for author name” option. Also, set the font size at 9 or 10 point.

3. When you have decided on the corrections to your article, select the NOTES tool from the Acrobat

toolbox (Acrobat 6.0) and click to display note text to be changed, or Comments/Add Note (in Acrobat

7.0).

4. Enter your corrections into the NOTES text box window. Be sure to clearly indicate where the

correction is to be placed and what text it will effect. If necessary to avoid confusion, you can use your

TEXT SELECTION tool to copy the text to be corrected and paste it into the NOTES text box window.

At this point, you can type the corrections directly into the NOTES text box window. DO NOT correct

the text by typing directly on the PDF page.

5. Go through your entire article using the NOTES tool as described in Step 4.

6. When you have completed the corrections to your article, go to Document/Export Comments (in

Acrobat 6.0) or Comments/Export Comments (in Acrobat 7.0). Save your NOTES file to a place on

your harddrive where you can easily locate it. Name your NOTES file with the article number

assigned to your article in the original softproofing e-mail message.

7. When closing your article PDF be sure NOT to save changes to original file.

8. To make changes to a NOTES file you have exported, simply re-open the original PDF

proof file, go to Document/Import Comments and import the NOTES file you saved. Make changes

and reexport NOTES file keeping the same file name.

9. When complete, attach your NOTES file to a reply e-mail message. Be sure to include your name,

the date, and the title of the journal your article will be printed in.

(5)

Should you wish to purchase additional copies of your article, please

click on the link and follow the instructions provided:

https://caesar.sheridan.com/reprints/redir.php?pub=10089&acro=TOX

Corresponding authors are invited to inform their co-authors of the

reprint options available.

Please note that regardless of the form in which they are acquired,

reprints should not be resold, nor further disseminated in electronic form,

nor deployed in part or in whole in any marketing, promotional or

educational contexts without authorization from Wiley. Permissions

requests should be directed to mail to:

[email protected]

For information about ‘Pay-Per-View and Article Select’ click on the

following link:

wileyonlinelibrary.com/aboutus/ppv-articleselect.html

(6)

COPYRIGHT TRANSFER AGREEMENT

Re: Manuscript entitled________________________________________________________________________________

____________________________________________________________________________________(the “Contribution”)

for publication in ______________________________________________________________________(the “Journal”)

published by Wiley Periodicals, Inc. (“Wiley”).

Dear Contributor(s):

Thank you for submitting your Contribution for publication. In order to expedite the editing and publishing process and enable

Wiley to disseminate your work to the fullest extent, we need to have this Copyright Transfer Agreement signed and returned to

us as soon as possible. If the Contribution is not accepted for publication this Agreement shall be null and void.

A. COPYRIGHT

1.

The Contributor assigns to Wiley, during the full term of copyright and any extensions or renewals of that term, all

copyright in and to the Contribution, including but not limited to the right to publish, republish, transmit, sell, distribute

and otherwise use the Contribution and the material contained therein in electronic and print editions of the Journal and

in derivative works throughout the world, in all languages and in all media of expression now known or later

developed, and to license or permit others to do so.

2.

Reproduction, posting, transmission or other distribution or use of the Contribution or any material contained

therein, in any medium as permitted hereunder, requires a citation to the Journal and an appropriate credit to Wiley

as Publisher, suitable in form and content as follows: (Title of Article, Author, Journal Title and Volume/Issue

Copyright

[year] Wiley Periodicals, Inc. or copyright owner as specified in the Journal.)

B. RETAINED RIGHTS

Notwithstanding the above, the Contributor or, if applicable, the Contributor’s Employer, retains all proprietary rights

other than copyright, such as patent rights, in any process, procedure or article of manufacture described in the

Contribution, and the right to make oral presentations of material from the Contribution.

C. OTHER RIGHTS OF CONTRIBUTOR

Wiley grants back to the Contributor the following:

1.

The right to share with colleagues print or electronic “preprints” of the unpublished Contribution, in form and

content as accepted by Wiley for publication in the Journal. Such preprints may be posted as electronic files on the

Contributor’s own website for personal or professional use, or on the Contributor’s internal university or corporate

networks/intranet, or secure external website at the Contributor’s institution, but not for commercial sale or for any

systematic external distribution by a third party (e.g., a listserve or database connected to a public access server).

Prior to publication, the Contributor must include the following notice on the preprint: “This is a preprint of an

article accepted for publication in [Journal title]

copyright (year) (copyright owner as specified in the Journal)”.

After publication of the Contribution by Wiley, the preprint notice should be amended to read as follows: “This is a

preprint of an article published in [include the complete citation information for the final version of the Contribution

as published in the print edition of the Journal]”, and should provide an electronic link to the Journal’s WWW site,

located at the following Wiley URL: http://www.interscience.Wiley.com/. The Contributor agrees not to update the

preprint or replace it with the published version of the Contribution.

2.

The right, without charge, to photocopy or to transmit online or to download, print out and distribute to a colleague a

copy of the published Contribution in whole or in part, for the colleague’s personal or professional use, for the

Production/Contribution

ID# _______________

Publisher/Editorial office use only

111 River Street Hoboken, NJ 07030 201.748.6000 FAX 201.748.6052

Date:

To:

(7)

advancement of scholarly or scientific research or study, or for corporate informational purposes in accordance with

Paragraph D.2 below.

3.

The right to republish, without charge, in print format, all or part of the material from the published Contribution in

a book written or edited by the Contributor.

4.

The right to use selected figures and tables, and selected text (up to 250 words, exclusive of the abstract) from the

Contribution, for the Contributor’s own teaching purposes, or for incorporation within another work by the

Contributor that is made part of an edited work published (in print or electronic format) by a third party, or for

presentation in electronic format on an internal computer network or external website of the Contributor or the

Contributor’s employer.

5.

The right to include the Contribution in a compilation for classroom use (course packs) to be distributed to students

at the Contributor’s institution free of charge or to be stored in electronic format in datarooms for access by students

at the Contributor’s institution as part of their course work (sometimes called “electronic reserve rooms”) and for

in-house training programs at the Contributor’s employer.

D. CONTRIBUTIONS OWNED BY EMPLOYER

1.

If the Contribution was written by the Contributor in the course of the Contributor’s employment (as a

“work-made-for-hire” in the course of employment), the Contribution is owned by the company/employer which must sign this

Agreement (in addition to the Contributor’s signature), in the space provided below. In such case, the

company/employer hereby assigns to Wiley, during the full term of copyright, all copyright in and to the

Contribution for the full term of copyright throughout the world as specified in paragraph A above.

2.

In addition to the rights specified as retained in paragraph B above and the rights granted back to the Contributor

pursuant to paragraph C above, Wiley hereby grants back, without charge, to such company/employer, its

subsidiaries and divisions, the right to make copies of and distribute the published Contribution internally in print

format or electronically on the Company’s internal network. Upon payment of Wiley’s reprint fee, the institution may

distribute (but not resell) print copies of the published Contribution externally. Although copies so made shall not be

available for individual re-sale, they may be included by the company/employer as part of an information package

included with software or other products offered for sale or license. Posting of the published Contribution by the

institution on a public access website may only be done with Wiley’s written permission, and payment of any

applicable fee(s).

E. GOVERNMENT CONTRACTS

In the case of a Contribution prepared under U.S. Government contract or grant, the U.S. Government may reproduce,

without charge, all or portions of the Contribution and may authorize others to do so, for official U.S. Government

purposes only, if the U.S. Government contract or grant so requires. (U.S. Government Employees: see note at end.)

F. COPYRIGHT NOTICE

The Contributor and the company/employer agree that any and all copies of the Contribution or any part thereof

distributed or posted by them in print or electronic format as permitted herein will include the notice of copyright as

stipulated in the Journal and a full citation to the Journal as published by Wiley.

G. CONTRIBUTOR’S REPRESENTATIONS

The Contributor represents that the Contribution is the Contributor’s original work. If the Contribution was prepared

jointly, the Contributor agrees to inform the co-Contributors of the terms of this Agreement and to obtain their signature

to this Agreement or their written permission to sign on their behalf. The Contribution is submitted only to this Journal

and has not been published before, except for “preprints” as permitted above. (If excerpts from copyrighted works owned

by third parties are included, the Contributor will obtain written permission from the copyright owners for all uses as set

forth in Wiley’s permissions form or in the Journal’s Instructions for Contributors, and show credit to the sources in the

Contribution.) The Contributor also warrants that the Contribution contains no libelous or unlawful statements, does not

infringe upon the rights (including without limitation the copyright, patent or trademark rights) or the privacy of others, or

contain material or instructions that might cause harm or injury.

(8)

CHECK ONE:

[____] Contributor-owned work

________________________________________________________

Type or print name and title

______________________________________ _________________

Co-contributor’s signature

Date

________________________________________________________

Type or print name and title

ATTACHED ADDITIONAL SIGNATURE PAGE AS NECESSARY

[____] Company/Institution-owned work

(made-for-hire in the

course of employment)

______________________________________ _________________

Authorized signature of Employer

Date

[____] U.S. Government work

[____] U.K. Government work (Crown Copyright)

______________________________________ _________________

Contributor’s signature

Date

______________________________________ _________________

Company or Institution (Employer-for-Hire) Date

Note to U.S. Government Employees

A contribution prepared by a U.S. federal government employee as part of the employee’s official duties, or which is an

official U.S. Government publication is called a “U.S. Government work,” and is in the public domain in the United States.

In such case, the employee may cross out Paragraph A.1 but must sign and return this Agreement. If the Contribution was not

prepared as part of the employee’s duties or is not an official U.S. Government publication, it is not a U.S. Government work.

Note to U.K. Government Employees

The rights in a Contribution prepared by an employee of a U.K. government department, agency or other Crown body as part

of his/her official duties, or which is an official government publication, belong to the Crown. In such case, Wiley will

forward the relevant form to the Employee for signature.

(9)
(10)

Gallic Acid Provokes DNA Damage and

Suppresses DNA Repair Gene Expression in

Human Prostate Cancer PC-3 Cells

AQ2 Kuo-Ching Liu,1,2Heng-Chien Ho,3An-Cheng Huang,4Bin-Chuan Ji,5Hui-Yi Lin,6Fu-Shin Chueh,7Jai-Sing Yang,8Chi-Cheng Lu,9Jo-Hua Chiang,9Menghsiao Meng,2Jing-Gung Chung10,11

1

AQ2 Department of Medical Laboratory Science and Biotechnology, China Medical University,

Taichung 404, Taiwan 2

Graduate Institute of Biotechnology, National Chung Hsing University, Taichung 402, Taiwan

AQ1

3

Department of Biochemistry, China Medical University, Taichung 404, Taiwan 4

Department of Nursing, St. Mary’s Medicine Nursing and Management College, Yilan 266, Taiwan 5

Division of Respiratory Care Center, Department of Internal Medicine, Changhua Christian Hospital, Changhua 500, Taiwan

6

School of Pharmacy, China Medical University, Taichung 404, Taiwan 7

Department of Health and Nutrition Biotechnology, Asia University, Taichung 413, Taiwan 8

Department of Pharmacology, China Medical University, Taichung 404, Taiwan 9

Department of Life Sciences, National Chung Hsing University, Taichung 402, Taiwan 10

Department of Biological Science and Technology, China Medical University, Taichung 404, Taiwan 11

Department of Biotechnology, Asia University, Taichung 413, Taiwan

Received 31 March 2011; revised 25 May 2011; accepted 4 June 2011

ABSTRACT: Our earlier studies have demonstrated that gallic acid (GA) induced cytotoxic effects includ-ing induction of apoptosis and DNA damage and inhibited the cell migration and invasion in human cancer cells. However, GA-affected DNA damage and repair gene expressions in human prostate cancer cells are still unclear. In this study, we investigated whether or not GA induces DNA damage and inhibits DNA repair gene expression in a human prostate cancer cell line (PC-3). The results from flow cytometric assay indicated that GA decreased the percentage of viable PC-3 cells in a dose- and time-dependent manner. PC-3 cells after exposure to different doses (50, 100, and 200 lM) of GA and various periods of time (12, 24, and 48 h) led to a longer DNA migration smear (comet tail) occurred based on the single cell gel elec-trophoresis (Comet assay). These observations indicated that GA-induced DNA damage in PC-3 cells, which also confirm by 4,6-diamidino-2-phenylindole dihydrochloride staining and DNA agarose gel elec-trophoresis. Alternatively, results from real-time polymerized chain reaction assay also indicated that GA

J_ID:ZRV Customer A_ID:11-121.R1 Cadmus Art:TOX20752 Date:22-JUNE-11 Stage: I Page: 1

ID:nareshrao Date:22/6/11 Time:13:01 Path:N:/3b2/TOX#/Vol00000/110054/APPFile/JW-TOX#110054 Correspondence to: J.-G. Chung or M. Meng e-mail:

[email protected] or [email protected] Contract grant sponsor: China Medical University. Contract grant number: CMU99-ASIA-23.

Contract grant sponsor: Taiwan Department of Health Clinical Trial and Research Center of Excellence.

Contract grant number: DOH100-TD-B-111-004

Published online in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/tox.20752?

C 2011 Wiley Periodicals, Inc.

(11)

inhibited ataxia telangiectasia mutated, ataxia-telangiectasia and Rad3-related, O6-methylguanine-DNA methyltransferase, DNA-dependent serine/threonine protein kinase, and p53 mRNA expressions in PC-3 cells. Taken together, the present study showed that GA caused DNA damage and inhibited DNA repair genes as well as both effects may be the critical factors for GA-inhibited growth of PC-3 cells in vitro. #2011 Wiley Periodicals, Inc. Environ Toxicol 21: 000–000, 2011.

Keywords: gallic acid; DNA damage; comet assay; DNA repair; human prostate cancer PC-3 cells

INTRODUCTION

Adenocarcinoma of the prostate, the most frequently diag-nosed noncutaneous cancer, is the second leading cause of cancer-related deaths among men in the United States (Wingo et al., 1995; Jemal et al., 2009). In Taiwan, prostate cancer also is the seventh of cancer-related deaths in men and about eight persons per 100,000 die annually from prostate cancer based on 2009 report from the Department of Health, Republic of China (Taiwan) (Liu et al., 2011). So far, the exact molecular mechanisms responsible for the development and progression of prostate cancer in human remain poorly investigated. Currently, there is as yet no effective therapy for human prostate cancer (Grossmann et al., 2001; Nieto et al., 2007). Hence, the understanding of the development in prostate cancer is urgent.

Gallic acid (3,4,5-trihydroxybenzoic acid, GA), a poly-hydroxyphenolic compound and a basic unit of tannic acid, is widely distributed in the natural plants (Atkinson et al., 2004; Ng et al., 2004). GA exhibits various biological prop-erties such as antibacterial (Kang et al., 2008), inflam-matory (Kim et al., 2006), antiviral (Kaur et al., 2009), anti-oxidant (Inoue et al., 2000), and anticancer effects (Kawada et al., 2001; Faried et al., 2007; Ji et al., 2009; Kaur et al., 2009; Lo et al., 2010). Much evidence has shown that GA is able to inhibit proliferation of tumor cells in culture by causing apoptosis and/or cell-cycle arrest (Agarwal et al., 2006; Veluri et al., 2006). In our laboratory, we also found that GA induced apoptosis in human lung cancer NCI-H460 cells via a caspase-3 and mitochondrion-dependent pathway and inhibited the in vivo tumor growth of NCI-H460 cells in xenograft models (Ji et al., 2009). Also, GA-induced DNA damage of lung cancer cells is examined by Comet assay (Ji et al., 2009). GA triggered apoptotic death in human melanoma A375.S2 cells through caspase-de-pendent and -indecaspase-de-pendent pathways (Lo et al., 2010). More-over, GA promoted macrophage phagocytosis in WEHI-3 leukemia mice in vivo (Ho et al., 2009). Recently, it was reported that GA induced cell-cycle arrest at G2/M phase through Chk2-mediated phosphorylation of Cdc25C in a bladder transitional carcinoma cell line (Ou et al., 2010), and this might be a DNA damage response as indicated by Ser-139 phosphorylation of histone H2A.X (Ou et al., 2010).

Until now, there is no available information addressing GA-induced DNA damage in human prostate cancer PC-3 cells. Therefore, in the present study, we focused on thein

vitro GA-induced DNA damage and affected repair gene expression in human prostate cancer PC-3 cells. Results indicated that GA promoted DNA damage and inhibited DNA repair gene expression of PC-3 cellsin vitro.

MATERIALS AND METHODS

Chemicals and Reagents

GA, dimethyl sulfoxide (DMSO), propidium iodide (PI), trypan blue, sodium chloride (NaCl), Tris–HCl, Na2EDTA, Triton X-100, and sodium hydroxide (NaOH) were purchased from Sigma-Aldrich Corp (St. Louis, MO). RPMI-1640 medium, fetal bovine serum (FBS), L

-gluta-mine, penicillin–streptomycin, trypsin-EDTA, and 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) were obtained from Invitrogen Life Technologies (Carlsbad, CA). Tris/borate/EDTA (TBE) buffer was purchased from Amresco (Solon, OH). High-Capacity cDNA Reverse Tran-scription Kit and 2X SYBR Green PCR Master Mix was purchased from Applied Biosystems by Life Technologies (Foster City, CA).

Cell Culture

PC-3 human prostate cancer-cell line was purchased from the Food Industry Research and Development Institute (Hsinchu, Taiwan). The cells were immediately placed onto 75-cm2 tissue culture flasks and grown at 378C under a humidified 5% CO2atmosphere with RPMI-1640 medium with 2 mML-glutamine were adjusted to contain 10% FBS,

100 U/mL penicillin, and 100 lg/mL streptomycin.

Flow Cytometric Assay and a PI Exclusion

Method for the Percentage of Viable PC-3

Cells In Vitro

Cells (2 3 105 cells/well) maintained in 12-well plates were incubated with GA at final concentrations of 0, 50, 100, and 200 lM, and vehicle (1% DMSO) for 48 h, and exposed to 100 lM of GA for 0, 12, 24, and 48 h. Cells from each treatment were harvested and stained with propi-dium iodide (PI, 5 lg/mL) and then were analyzed with a flow cytometer (Becton-Dickinson FACSCalibur, San Jose, CA) equipped with an argon ion laser at 488 nm wave-length and calculated by using BD CellQuest Pro software

J_ID:ZRV Customer A_ID:11-121.R1 Cadmus Art:TOX20752 Date:22-JUNE-11 Stage: I Page: 2

ID:nareshrao Date:22/6/11 Time:13:01 Path:N:/3b2/TOX#/Vol00000/110054/APPFile/JW-TOX#110054

2 LIU ET AL.

(12)

as previously described (Yeh et al., 2000; Chiang et al., 2011).

Comet Assay for DNA Damage in GA-Treated

PC-3 Cells

Cells at a density of 2 3 105cells/well seeded in 12-well plates were exposed to GA (0, 50, 100, and 200 lM) for 48 h and treated with final concentration of 100 lM GA for 12, 24, and 48 h, or vehicle (1% DMSO) in RPMI 1640 me-dium grown at 378C in 5% CO2 and 95% air. Cells were harvested for the examination of DNA damage by using the Comet assay (single-cell gel electrophoresis) according to the procedures of Chen et al. (2003) and Wang et al. (2006) with slight modifications. Briefly, the glass slides were pre-coated with 70 lL containing 0.5% (w/v) of normal melting point (NMP) agarose (Sigma-Aldrich Corp.) and 0.5% (w/ v) low melting point (LMP) agarose (Sigma-Aldrich Corp.) allowed drying on a flat surface of the slides at room tem-perature. Subsequently, about 1 3 104 cells per sample from each treatment were gently mixed with 75 lL of 0.5% (w/v) LMP and rapidly layered onto the slides precoated with the mixtures [0.5% (w/v) of NMP agarose and 0.5% (w/v) LMP agarose] before a coverslip was covered at 48C for 5 min. The coverslip was removed, and cells placed onto a glass slide were immersed in the lysis buffer contain-ing 2.5 M NaCl, 10 mM Tris–HCl, 100 mM Na2EDTA, and 1% (v/v) Triton X-100 and adjusted to pH 10 with NaOH at 48C for 1 h. These slides were washed twice with ice-cold deionized water and transferred to an electrophoresis tank with alkalin buffer (300 mM NaOH and 1 mM Na2EDTA at pH 13) at 48C for 20 min. Thereafter, the electrophoresis was carried out at 30 V and 300 mA for 20 min, before slides were removed and flooded with neutralization buffer (0.4 M Tris–HCl at pH 7.5) at 48C for 15 min. Slides were dried in methanol (Sigma-Aldrich Corp.) for 5 min before staining with 50 lL of PI (2.5 lg/mL), and comets were visualized and photographed by using a fluorescence micro-scope at 2003 magnification as previously described (Chen et al., 2009b; Lu et al., 2010). For the quantification of DNA damage, PI-stained DNA tails were quantified by using CometScore software (Tritek Corp, Sumerduck, VA). It is shown that the comet tail that tends to increase rapidly with the levels of damage calculated from the head center. The data from comet tail length were expressed (fold of control) in mean 6 SD at least three independent samples as described elsewhere (Chiang et al., 2011; Yu et al., 2011).

DAPI Staining in Apoptotic PC-3 Cells After

Exposure to GA

Approximately 2 3 105PC-3 cells/well onto 12-well plates were exposed to 0, 50, 100, and 200 lM of GA were

incu-bated for 48 h under 5% CO2and 95% air at 378C. Cells in each treatment were individually fixed with 3.7% (v/v) formaldehyde (Sigma-Aldrich Corp.) for 15 min and then stained by 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) dye for determining cell chromatin condensation. All samples were examined and photographed by using flu-orescence microscopy as described elsewhere (Chiang et al., 2011; Yu et al., 2011).

DNA Agarose Gel Electrophoresis for

Examining the DNA Damage in PC-3 Cells

After GA Treatment

Cells (1 3 106cells/well) in six-well plates were incubated with 0, 50, 100, 150, and 200 lM of GA for 24-h exposure. At the end of incubation, cells were centrifuged, and DNA was collected by using a Genomic DNA Purification kit (Genemark Technology Co., Tainan, Taiwan) as followed according to the manufacturer’s protocol. The extracted DNA from each treatment was resuspended with 50 lL TBE buffer (0.045 M Tris, 0.045 M boric acid, 1 mM Na2EDTA, and pH8.3 at 258C). Approximately 1 lg/lL (20 lL) of genomic DNA was loaded in each well, and DNA agarose gel electrophoresis was performed using 1.8% agarose (Sigma-Aldrich Corp.). After ethidium bro-mide (EtBr, Sigma-Aldrich Corp.) staining, the DNA was photographed under UV light as described previously (Lai et al., 2010; Chiang et al., 2011).

Total RNA Extraction and Reverse

Transcription Extracted from PC-3 Cells After

Incubation with GA

Cells (1 3 106 cells/well) maintained in six-well plates were maintained in RPMI 1640 medium contained with or without 100 lM of GA and then were incubated for 24 h. Cells were washed twice with PBS and trypsinized, and, subsequently, the cell pellets were collected by centrifuga-tion at 1000 3 g for 5 min at 48C. The total RNA from each treatment was extracted by using the Qiagen RNeasy Mini Kit (Qiagen, Valencia, CA) as previously described (Mozaffarieh et al., 2010; Chiang et al., 2011). The RNA purity was measured the ratio of the absorbance at 260 and 280 nm (A260/A280), where a ratio ranging from 1.8 to 2.0 was considered to be pure for further experiment (Mozaf-farieh et al., 2010). RNA samples from each treatment were then individually reverse-transcribed for 30 min at 428C with High Capacity cDNA Reverse Transcription Kit to made first-strand cDNA according to the standard protocol of the supplier (Applied Biosystems, Carlsbad, CA). The product was aliquoted in equal volumes and stored at 2208C for real-time polymerized chain reaction (PCR) analysis.

J_ID:ZRV Customer A_ID:11-121.R1 Cadmus Art:TOX20752 Date:22-JUNE-11 Stage: I Page: 3

ID:nareshrao Date:22/6/11 Time:13:01 Path:N:/3b2/TOX#/Vol00000/110054/APPFile/JW-TOX#110054

3 AQ1

GA AFFECTS DNA DAMAGE AND REPAIR GENE IN PC-3 CELLS

(13)

Real-Time PCR for Gene Expressions of ATM,

ATR, MGMT, DNA-PK, and p53 in PC-3 Cells

After GA Exposure

Quantitative PCR from each sample was carried out for amplifications included by the condition: 2 min at 508C, 10 min at 958C, 40 cycles of 15 s at 958C, and 1 min at 608C using 1 lL of the cDNA reverse-transcribed as described earlier, 2X SYBR Green PCR Master Mix (Applied Biosys-tems), and 200 nM forward (F) and reverse (R) primers for each gene as shown in Table

T1 I. Finally, each assay was run

on an Applied Biosystems 7300 Real-time PCR system in triplicates, and expression fold-changes were derived using the comparative threshold cycles (CT) method (Heid et al., 1996). Values were shown to normalize the human GAPDH mRNA expression as an endogenous/internal control gene as described elsewhere (Lu et al., 2009; Chiang et al., 2011).

Statistical Analysis

All data were presented as the means (S.D.) and one-way ANOVA followed by Dunnett’s test was used to analyze differences between GA-treated and untreated (control) groups. All the statistical analyses were performed *P \ 0.05, which was considered significant.

RESULTS

GA Decreased the Percentage of Viable

PC-3 Cells

The PC-3 cells were incubated with GA at 0, 50, 100, and 200 lM for 48 h and exposed to 100 lM of GA for 0, 12, 24, and 48 h. The cells were harvested for measuring the

percentage of viable PC-3 cells by flow cytometry, and results are shown in Figure 1, which indicated that GA F1 decreased the viability of PC-3 cells, and these effects are in a dose- and time-dependent manner [Fig. 1(A,B)].

GA-Triggered DNA Damage in PC-3 Cells Was

Examined by Comet Assay

It is shown that GA induced cytotoxic effects (decrease the percentage of viable cells) on PC-3 cells (Fig. 1) to confirm GA whether or not affects DNA damage in PC-3 cells. Thus, the comet assay was selected for determining the DNA dam-age in examined PC-3 cells. The results are shown in Figure

F2 2(A,B), which indicated that GA-induced DNA damage of PC-3 cells in a dose-dependent effect [Fig. 2(A,B)]. The higher concentrations (100–200 lM) of GA led to a longer

J_ID:ZRV Customer A_ID:11-121.R1 Cadmus Art:TOX20752 Date:22-JUNE-11 Stage: I Page: 4

ID:nareshrao Date:22/6/11 Time:13:01 Path:N:/3b2/TOX#/Vol00000/110054/APPFile/JW-TOX#110054

TABLE I. The DNA sequence was evaluated using the primer express software

Primer Name Primer Sequence (50–30)

HumanATM-F TTTACCTAACTGTGAGCTGTCTCCAT

HumanATM-R ACTTCCGTAAGGCATCGTAACAC

HumanATR-F GGGAATCACGACTCGCTGAA

HumanATR-R CTAGTAGCATAGCTCGACCATGGA

HumanMGMT-F CCTGGCTGAATGCCTATTTCC

HumanMGMT-R TGTCTGGTGAACGACTCTTGCT

HumanDNA-PK-F CCAGCTCTCACGCTCTGATATG

HumanDNA-PK-R CAAACGCATGCCCAAAGTC

Humanp53-F GGGTTAGTTTACAATCAGCCACATT

Humanp53-R GGGCCTTGAAGTTAGAGAAAATTCA

HumanGAPDH-F ACACCCACTCCTCCACCTTT

HumanGAPDH-R TAGCCAAATTCGTTGTCATACC

ATM, ataxia telangiectasia mutated; ATR, ataxia-telangiectasia and Rad3-related; MGMT,O6-methylguanine-DNA methyltransferase; DNA-PK, DNA-dependent serine/threonine protein kinase and GAPDH, glycer-aldehydes-3-phosphate dehydrogenase. Each assay was conducted at least twice to ensure reproducibility.

Fig. 1. GA decreased the percentage of viable PC-3 cells. Cells (2 3 105cells/well) seeded in 12-well plates were incu-bated with GA at final concentrations of 0, 50, 100, and 200 lM and vehicle (1% DMSO) for 48 h (A). Cells were treated with 100 lM of GA for 0, 12, 24, and 48 h (B). Cells from each treatment were stained with PI (5 lg/mL) and analyzed by flow cytometry as described in the Materials and Meth-ods section. *P \ 0.05 was considered significant.

4 LIU ET AL.

(14)

DNA comet tail (migration smear). Figure 2(B) indicates that more DNA was damaged in PC-3 cells when compared with the control sample. Alternatively, GA also increased DNA damage in PC-3 cells after exposure to 100 lM of GA for various intervals of time (12–48 h), and there is a time-dependent response as can be seen in Figure 2(C,D).

GA Induced DNA Condensation and

Fragmentation in PC-3 Cells

Results from DAPI-staining analysis indicated that GA increased DNA condensation and break in PC-3 cells [Fig. F3 3(A,B)], and this effect is a dose-dependent response. To con-firm the induction of DNA damage and condensation in GA-treated PC-3 cells, we also used DNA agarose gel

electropho-resis for examining the DNA fragmentation. DNA was isolated from each treatment of PC-3 cells for 24 h, and then DNA fragments were determined by DNA agarose gel electrophore-sis. Results shown in Figure 3(C) indicated that DNA damage, condensation, and fragments were carried out in GA-treated PC-3 cells [Fig. 3(C)]. The higher doses of GA (100–150 lM) led to more DNA damage and fragments in PC-3 cells than that of low dose (50 lM) incubation in the examined cells.

GA Influenced DNA Damage and Repair

Genes Expression on PC-3 Cells by Real-Time

PCR

Results from comet assay, DAPI staining, and DNA aga-rose gel electrophoresis have shown that GA induced

J_ID:ZRV Customer A_ID:11-121.R1 Cadmus Art:TOX20752 Date:22-JUNE-11 Stage: I Page: 5

ID:nareshrao Date:22/6/11 Time:13:01 Path:N:/3b2/TOX#/Vol00000/110054/APPFile/JW-TOX#110054

Fig. 2. GA-induced DNA damage in PC-3 cells was examined by Comet assay. Cells (2 3 105cells/well) were incubated with 0, 50, 100, and 200 lM of GA for 48 h and exposure to 100 lM of GA for 12, 24, and 48 h in PC-3 cells. DNA damage was determined by Comet assay as described in the Materials and Methods section. Representative images of Comet assay for dose-dependent effect (A) and quantification for comet length (fold of control) (B); representative pictures of Comet assay for a time-dependent response (C) and quantifica-tion (D). *P \ 0.05 shows a significant difference between control and treated cells. [Color

figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.] AQ2

5 AQ1

GA AFFECTS DNA DAMAGE AND REPAIR GENE IN PC-3 CELLS

(15)

DNA damage, condensation, and fragments in PC-3 cells. To investigate whether or not GA affects DNA damage and repair genes expressions, PC-3 cells were treated without (untreated control) or with 100 lM GA for 24 h. Thereafter, total RNA was isolated from each treatment, and the associated genes expressions were examined by real-time PCR. The results shown in Figure

F4 4 revealed

that genes expression-associated with DNA damage and repair including ataxia telangiectasia mutated (ATM), ATR, methylguanine DNA methyltransferase (MGMT), DNA-dependent serine/threonine protein kinase (DNA-PK), and p53 mRNA from PC-3 cells after 24-h treatment of GA were suppressed (Fig. 4) when compared with the untreated control group.

DISCUSSION

It is well documented that agents induced DNA damage, which is associated with cytotoxic effects including cell death and inhibition of cell growth (Kondo et al., 2010; Lou et al., 2010; Namdar et al., 2010). Previous studies have shown that GA induced cytotoxic effects in many types of human cancer cell lines (Kawada et al., 2001; Agarwal et al., 2006; Veluri et al., 2006; Faried et al., 2007; Ji et al., 2009; Kaur et al., 2009). However, regarding the effects of GA on DNA damage and repair gene expression in human prostate cancer cells is not well investigated. Thus, in the present study, we found that a dose- and time-dependent increase in DNA damage was observed in PC-3

J_ID:ZRV Customer A_ID:11-121.R1 Cadmus Art:TOX20752 Date:22-JUNE-11 Stage: I Page: 6

ID:nareshrao Date:22/6/11 Time:13:01 Path:N:/3b2/TOX#/Vol00000/110054/APPFile/JW-TOX#110054

Fig. 3. GA-induced DNA condensation and damage in PC-3 cells was examined by DAPI staining and DNA agarose gel electrophoresis. Cells were incubated with 0, 50, 100, and 200 lM of GA for 48 h and then were harvested for DAPI staining (A) and quantification (B). The arrow shows the DNA condensation in PC-3 cells. MFI means mean fluorescence in-tensity. Cells were exposed to 0, 50, 100, 150, and 200 lM of GA for 24 h, and DNA were isolated from each treatment for gel electrophoresis (C) as described in the Materials and Methods section. M, marker. [Color figure can be viewed in the online issue, which is avail-able at wileyonlinelibrary.com.]

6 LIU ET AL.

(16)

cells after exposure to various concentrations of GA (Fig. 2), which was associated with a loss of cell viability (Fig. 1). These results and conclusions showed a significant increase in the tail moment of the comets of PC-3 cells from comet assay (single-cell gel electrophoresis) (Fig. 2). The longer of comet tail meant that the higher DNA dam-age and DNA condensation and fragments from DAPI staining [Fig. 3(A,B)] and DNA agarose gel electrophoresis [Fig. 3(C)], respectively, in GA-treated PC-3 cells.

Numerous studies have been demonstrated that comet assay is a high sensitive technique for DNA damage exami-nation (Pool-Zobel et al., 1994; Ashby et al., 1995). Fur-thermore, Comet assay can be used as a measurement for trend-break formation during the process of excision repair of DNA may also cause DNA migration (Tice et al., 1990). It is well known that some of the major characteristic of ap-optosis are DNA condensation (Chiang et al., 2011) and DNA ladder (DNA fragmentation) of nuclei (Bakshi et al., 2010; Ramachandran et al., 2011). Herein, our results from DAPI staining and DNA agarose gel electrophoresis demonstrated that GA induced DNA condensation and frag-mentation in PC-3 cells (Fig. 3). It was reported that GA induction of apoptosis also part through the reactive oxygen species (ROS) production in mammalian cells (Chen et al., 2009a; You and Park, 2011). Thus, GA-induced DNA dam-age might be mediated through the production of ROS in PC-3 cells. Apparently, further studies are needed to estab-lish the role of the interaction of GA with DNA in carcinogenesis.

It was also reported that in mammalian cells, the DNA damage can be reduced by DNA repair through eliminating DNA lesions (Moeller et al., 2010; Kryston et al., 2011). These ROS, produced either directly by tumors or indi-rectly via inflammatory responses, can cause DNA damage

in healthy neighboring cells as well as distant sites (Kryston et al., 2011). Agents may cause DNA damage by an indirect pathway through promoting oxidative stress and inflamma-tory responses through dysfunction of mitochondria or inflammasomes (Kryston et al., 2011; Nabeshi et al., 2011). It was reported that ROS interacted with the biological mol-ecules and disrupt the normal synthesis and repair of DNA, and this disruption is primarily associated with inhibition/ inactivation of antioxidant key proteins as well as DNA repair enzymes induced by ROS-damage to these biomole-cules (Gillard et al., 2004; Eiberger et al., 2008).

In response to genotoxic agents, cells remained homeo-static via activation of signaling pathways that turn on spe-cific gene expressions; one of crucial guardian of genomic integrity is the checkpoint kinase ATM (Cuadrado et al., 2006). ATM and ATR are two master checkpoint kinases activated by double-stranded DNA breaks (DSBs) (Lavin, 2007). Our results showed that GA inhibited DNA repair genes expression including ATM, ATR, DNA-PK, MGMT, and p53 in PC-3 cells (Fig. 4). In response to DSBs, the ATM kinase phosphorylates and regulates a cascade of downstream effectors such as checkpoint kinase Chk2 and other components of the DNA repair pathways and the cell-cycle check points, in order to minimize the risk of genetic damage (Lavin, 2007; Matsuoka et al., 2007). DNA-PK plays a critical role in DNA damage repair (Mi et al., 2009). TheO6-MGMT reduces cytotoxicity of therapeutic or environmental alkylating agents (Jesien-Lewandowicz et al., 2009).

In conclusion, GA induced DNA damage in PC-3 cells and then followed by inhibiting DNA repair-associated gene expressions including ATM, ATR, MGMT, DNA-PK, andp53 and thereafter led to DNA damage maintain as the

proposed model can be shown in Figure5. F5

J_ID:ZRV Customer A_ID:11-121.R1 Cadmus Art:TOX20752 Date:22-JUNE-11 Stage: I Page: 7

ID:nareshrao Date:22/6/11 Time:13:01 Path:N:/3b2/TOX#/Vol00000/110054/APPFile/JW-TOX#110054

Fig. 5. The possible flow chart for GA-inhibited gene expression of DNA damage and repair in human prostate cancer PC-3 cells. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Fig. 4. GA-affected DNA damage and -inhibited repair genes expression in PC-3 cells was determined by real-time PCR. The total RNA was extracted from the PC-3 cells after treatment without (control) and with 100 lM GA for 24 h, and RNA samples were reverse-transcribed cDNA then for real-time PCR as described in the Materials and Methods sec-tion. The ratios of ATM, ATR, MGMT, DNA-PK, and p53 mRNA/GAPDH are shown in panel. Data represent mean 6 SD of three experiments. *P \ 0.05 is considered significant when compared with the control sample.

7 AQ1

GA AFFECTS DNA DAMAGE AND REPAIR GENE IN PC-3 CELLS

(17)

REFERENCES

Agarwal C, Tyagi A, Agarwal R. 2006. Gallic acid causes inacti-vating phosphorylation of cdc25A/cdc25C-cdc2 via ATM-Chk2 activation, leading to cell cycle arrest, and induces apoptosis in human prostate carcinoma DU145 cells. Mol Cancer Ther 5:3294–3302.

Ashby J, Tinwell H, Lefevre PA, Browne MA. 1995. The single cell gel electrophoresis assay for induced DNA damage (comet assay): Measurement of tail length and moment. Mutagenesis 10:85–90.

Atkinson BL, Blackman AJ, Faber H. 2004. The degradation of the natural pyrethrins in crop storage. J Agric Food Chem 52:280–287.

Bakshi H, Sam S, Rozati R, Sultan P, Islam T, Rathore B, Lone Z, Sharma M, Triphati J, Saxena RC. 2010. DNA fragmentation and cell cycle arrest: A hallmark of apoptosis induced by crocin from kashmiri saffron in a human pancreatic cancer cell line. Asian Pacific J Cancer Prev 11:675–679.

Chen HM, Wu YC, Chia YC, Chang FR, Hsu HK, Hsieh YC, Chen CC, Yuan SS, 2009a. Gallic acid, a major component of Toona sinensis leaf extracts, contains a ROS-mediated anti-can-cer activity in human prostate cananti-can-cer cells. Cananti-can-cer Lett 286:161–171.

Chen JC, Lu KW, Tsai ML, Hsu SC, Kuo CL, Yang JS, Hsia TC, Yu CS, Chou ST, Kao MC, et al. 2009b. Gypenosides induced G0/G1 arrest via CHk2 and apoptosis through endoplasmic reticulum stress and mitochondria-dependent pathways in human tongue cancer SCC-4 cells. Oral Oncol 45:273–283. Chen SC, Kao CM, Huang MH, Shih MK, Chen YL, Huang SP,

Liu TZ. 2003. Assessment of genotoxicity of benzidine and its structural analogues to human lymphocytes using comet assay. Toxicol Sci 72:283–288.

Chiang JH, Yang JS, Ma CY, Yang MD, Huang HY, Hsia TC, Kuo HM, Wu PP, Lee TH, Chung JG. 2011. Danthron, an anthraquinone derivative, induces DNA damage and caspase cascades-mediated apoptosis in SNU-1 human gastric cancer cells through mitochondrial permeability transition pores and Bax-triggered pathways. Chem Res Toxicol 24:20–29.

Cuadrado M, Martinez-Pastor B, Murga M, Toledo LI, Gutierrez-Martinez P, Lopez E, Fernandez-Capetillo O. 2006. ATM regu-lates ATR chromatin loading in response to DNA double-strand breaks. J Exp Med 203:297–303.

Eiberger W, Volkmer B, Amouroux R, Dherin C, Radicella JP, Epe B. 2008. Oxidative stress impairs the repair of oxidative DNA base modifications in human skin fibroblasts and mela-noma cells. DNA Repair (Amst) 7:912–921.

Faried A, Kurnia D, Faried LS, Usman N, Miyazaki T, Kato H, Kuwano H. 2007. Anticancer effects of gallic acid isolated from Indonesian herbal medicine. Phaleria macrocarpa (Scheff.) Boerl, on human cancer cell lines. Int J Oncol 30:605–613. Gillard N, Begusova M, Castaing B, Spotheim-Maurizot M. 2004.

Radiation affects binding of Fpg repair protein to an abasic site containing DNA. Radiat Res 162:566–571.

Grossmann ME, Huang H, Tindall DJ. 2001. Androgen receptor signaling in androgen-refractory prostate cancer. J Natl Cancer Inst 93:1687–1697.

Heid CA, Stevens J, Livak KJ, Williams PM. 1996. Real time quantitative PCR. Genome Res 6:986–994.

Ho CC, Lin SY, Yang JS, Liu KC, Tang YJ, Yang MD, Chiang JH, Lu CC, Wu CL, Chiu TH, et al.. 2009. Gallic acid inhibits murine leukemia WEHI-3 cells in vivo and promotes macro-phage phagocytosis. In Vivo 23:409–413.

Inoue M, Sakaguchi N, Isuzugawa K, Tani H, Ogihara Y. 2000. Role of reactive oxygen species in gallic acid-induced apopto-sis. Biol Pharm Bull 23:1153–1157.

Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. 2009. Cancer statistics, 2009. CA Cancer J Clin 59:225–249.

Jesien-Lewandowicz E, Jesionek-Kupnicka D, Zawlik I, Szybka M, Kulczycka-Wojdala D, Rieske P, Sieruta M, Jaskolski D, Och W, Skowronski W, et al.. 2009. High incidence of MGMT promoter methylation in primary glioblastomas without correla-tion with TP53 gene mutacorrela-tions. Cancer Genet Cytogenet 188:77–82.

Ji BC, Hsu WH, Yang JS, Hsia TC, Lu CC, Chiang JH, Yang JL, Lin CH, Lin JJ, Suen LJ, et al. 2009. Gallic acid induces apo-ptosis via caspase-3 and mitochondrion-dependent pathways in vitro and suppresses lung xenograft tumor growth in vivo. J Agric Food Chem 57:7596–7604.

Kang MS, Oh JS, Kang IC, Hong SJ, Choi CH. 2008. Inhibitory effect of methyl gallate and gallic acid on oral bacteria. J Micro-biol 46:744–750.

Kaur M, Velmurugan B, Rajamanickam S, Agarwal R, Agarwal C. 2009. Gallic acid, an active constituent of grape seed extract, exhibits proliferative, pro-apoptotic and anti-tumorigenic effects against prostate carcinoma xenograft growth in nude mice. Pharm Res 26:2133–2140.

Kawada M, Ohno Y, Ri Y, Ikoma T, Yuugetu H, Asai T, Wata-nabe M, Yasuda N, Akao S, Takemura G, et al. 2001. Anti-tu-mor effect of gallic acid on LL-2 lung cancer cells transplanted in mice. Anticancer Drugs 12:847–852.

Kim SH, Jun CD, Suk K, Choi BJ, Lim H, Park S, Lee SH, Shin HY, Kim DK, Shin TY. 2006. Gallic acid inhibits histamine release and pro-inflammatory cytokine production in mast cells. Toxicol Sci 91:123–131.

Kondo N, Takahashi A, Ono K, Ohnishi T, 2010. DNA damage induced by alkylating agents and repair pathways. J Nucleic Acids 2010:543531.

Kryston TB, Georgiev AB, Pissis P, Georgakilas AG. 2011. Role of oxidative stress and DNA damage in human carcinogenesis. Mutat Res 711:193–201.

Lai TY, Yang JS, Wu PP, Huang WW, Kuo SC, Ma CY, Gibson Wood W, Chung JG. 2010. The quinolone derivative CHM-1 inhibits murine WEHI-3 leukemia in BALB/c mice in vivo. Leuk Lymph 51:2098–2102.

Lavin MF. 2007. ATM and the Mre11 complex combine to recognize and signal DNA double-strand breaks. Oncogene 26:7749–7758. Liu KC, Huang AC, Wu PP, Lin HY, Chueh FS, Yang JS, Lu CC,

Chiang JH, Meng M, Chung JG. 2011. Gallic acid suppresses the migration and invasion of PC-3 human prostate cancer cells via inhibition of matrix metalloproteinase-2 and -9 signaling pathways. Oncol Rep 26:177–184.

Lo C, Lai TY, Yang JH, Yang JS, Ma YS, Weng SW, Chen YY, Lin JG, Chung JG. 2010. Gallic acid induces apoptosis in

J_ID:ZRV Customer A_ID:11-121.R1 Cadmus Art:TOX20752 Date:22-JUNE-11 Stage: I Page: 8

ID:nareshrao Date:22/6/11 Time:13:01 Path:N:/3b2/TOX#/Vol00000/110054/APPFile/JW-TOX#110054

8 LIU ET AL.

(18)

A375.S2 human melanoma cells through caspase-dependent and -independent pathways. Int J Oncol 37:377–385.

Lou JJ, Chua YL, Chew EH, Gao J, Bushell M, Hagen T. 2010. In-hibition of hypoxia-inducible factor-1a (HIF-1a) protein synthe-sis by DNA damage inducing agents. PLoS One 5:e10522. Lu CC, Yang JS, Huang AC, Hsia TC, Chou ST, Kuo CL, Lu HF,

Lee TH, Wood WG, Chung JG. 2010. Chrysophanol induces necrosis through the production of ROS and alteration of ATP levels in J5 human liver cancer cells. Mol Nutr Food Res 54:967–976.

Lu HF, Yang JS, Lai KC, Hsu SC, Hsueh SC, Chen YL, Chiang JH, Lu CC, Lo C, Yang MD, et al. 2009. Curcumin-induced DNA damage and inhibited DNA repair genes expressions in mouse-rat hybrid retina ganglion cells (N18). Neurochem Res 34:1491–1497.

Matsuoka S, Ballif BA, Smogorzewska A, McDonald ER III, Hurov KE, Luo J, Bakalarski CE, Zhao Z, Solimini N, Leren-thal Y, et al. 2007. ATM and ATR substrate analysis reveals extensive protein networks responsive to DNA damage. Science 316:1160–1166.

Mi J, Dziegielewski J, Bolesta E, Brautigan DL, Larner JM. 2009. Activation of DNA-PK by ionizing radiation is mediated by protein phosphatase 6. PLoS One 4:e4395.

Moeller BJ, Arap W, Pasqualini R. 2010. Targeting synthetic lethality in DNA damage repair pathways as an anti-cancer strategy. Curr Drug Targets 11:1336–1340.

Mozaffarieh M, Konieczka K, Hauenstein D, Schoetzau A, Flammer J. 2010. Half a pack of cigarettes a day more than dou-bles DNA breaks in circulating leukocytes. Tob Induc Dis 8:14. Nabeshi H, Yoshikawa T, Matsuyama K, Nakazato Y, Tochigi S, Kondoh S, Hirai T, Akase T, Nagano K, Abe Y, et al. 2011. Amorphous nanosilica induce endocytosis-dependent ROS gen-eration and DNA damage in human keratinocytes. Part Fibre Toxicol 8:1.

Namdar M, Perez G, Ngo L, Marks PA. 2010. Selective inhibition of histone deacetylase 6 (HDAC6) induces DNA damage and sensitizes transformed cells to anticancer agents. Proc Natl Acad Sci USA 107:20003–20008.

Ng TB, He JS, Niu SM, Zhao L, Pi ZF, Shao W, Liu F. 2004. A gallic acid derivative and polysaccharides with antioxidative ac-tivity from rose (Rosa rugosa) flowers. J Pharm Pharmacol 56:537–545.

Nieto M, Finn S, Loda M, Hahn WC. 2007. Prostate cancer: Re-focusing on androgen receptor signaling. Int J Biochem Cell Biol 39:1562–1568.

Ou TT, Wang CJ, Lee YS, Wu CH, Lee HJ. 2010. Gallic acid induces G2/M phase cell cycle arrest via regulating 14–3-3b release from Cdc25C and Chk2 activation in human bladder transitional carcinoma cells. Mol Nutr Food Res 54:1781– 1790.

Pool-Zobel BL, Lotzmann N, Knoll M, Kuchenmeister F, Lam-bertz R, Leucht U, Schroder HG, Schmezer P. 1994. Detection of genotoxic effects in human gastric and nasal mucosa cells isolated from biopsy samples. Environ Mol Mutag 24:23–45. Ramachandran A, Lebofsky M, Weinman SA, Jaeschke H. 2011.

The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA frag-mentation and liver injury during acetaminophen hepatotoxic-ity. Toxicol Appl Pharmacol 251:226–233.

Tice RR, Andrews PW, Singh NP. 1990. The single cell gel assay: A sensitive technique for evaluating intercellular differences in DNA damage and repair. Basic Life Sci 53:291–301.

Veluri R, Singh RP, Liu Z, Thompson JA, Agarwal R, Agarwal C. 2006. Fractionation of grape seed extract and identification of gallic acid as one of the major active constituents causing growth inhibition and apoptotic death of DU145 human prostate carcinoma cells. Carcinogenesis 27:1445–1453.

Wang SC, Chung JG, Chen CH, Chen SC, 2006. 2- and 4-Ami-nobiphenyls induce oxidative DNA damage in human hepa-toma (Hep G2) cells via different mechanisms. Mutat Res 593:9–21.

Wingo PA, Tong T, Bolden S. 1995. Cancer statistics, 1995. CA Cancer J Clin 45:8–30.

Yeh CC, Chung JG, Wu HC, Li YC, Lee YM, Hung CF. 2000. Effects of butylated hydroxyanisole and butylated hydroxyto-luene on DNA adduct formation and arylamines N-acetyltrans-ferase activity in PC-3 cells (human prostate tumor) in vitro. Food Chem Toxicol 38:977–983.

You BR, Park WH. 2011. Gallic acid-induced human pulmonary fibroblast cell death is accompanied by increases in ROS level and GSH depletion. Drug Chem Toxicol 34:38–44.

Yu FS, Yang JS, Yu CS, Lu CC, Chiang JH, Lin CW, Chung JG. 2011. Safrole induces apoptosis in human oral cancer HSC-3 cells. J Dent Res 90:168–174.

J_ID:ZRV Customer A_ID:11-121.R1 Cadmus Art:TOX20752 Date:22-JUNE-11 Stage: I Page: 9

ID:nareshrao Date:22/6/11 Time:13:01 Path:N:/3b2/TOX#/Vol00000/110054/APPFile/JW-TOX#110054

9 AQ1

GA AFFECTS DNA DAMAGE AND REPAIR GENE IN PC-3 CELLS

(19)

AQ1: Kindly check whether the short title is OK as given.

AQ2: Please confirm that all author names are OK and set with first name first and surname last. AQ3 Please check whether the affiliations are OK as typeset.

AQ1: Kindly provide the department/division name for second affiliation.

AQ2: Please confirm whether the color figures should be reproduced in color or black and white in the print version. If the color figures must be reproduced in color in the print version, please fill the color charge form immediately and return to Production Editor. Or else, the color figures for your article will appear in color in the online version only.

J_ID:ZRV Customer A_ID:11-121.R1 Cadmus Art:TOX20752 Date:22-JUNE-11 Stage: I Page: 10

數據

Fig. 1. GA decreased the percentage of viable PC-3 cells.
figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.] AQ25AQ1
Fig. 4. GA-affected DNA damage and -inhibited repair genes expression in PC-3 cells was determined by real-time PCR

參考文獻

相關文件

Laser Microdissection Microdissection for pure DNA, RNA, for pure DNA, RNA, Proteins and Living Cells Proteins and Living

Xofigo is indicated in patients with castration-resistant prostate cancer, symptomatic bone metastases and no known visceral metastatic disease. ü  FDA approval is obtained in

• DNA analysis: cell cycle analysis, tumor monitoring, detection of ploidy,. •

基因編輯技術以人工核酸酶辨識特定 DNA 位置,並於此處切斷雙股 DNA。DNA 斷

“The Connectivity Map: using gene-expression signatures to connect small molecules, genes, and disease.” Science 313(5795):..

assembly of the genome of that species will be far better if read lengths are longer than N... Accurate but

• Next-generation sequencing projects, with their short read lengths and high data volumes, have made these challeng es more difficult.. • We discuss the computational

“The Connectivity Map: using gene-expression signatures to connect small molecules, genes, and disease.” Science 313(5795): 1929–1935.