台灣地區劍線蟲Xiphinema elongatum之變異性
16
0
0
全文
(2) 46. 13 Luc. 1. 2004. (20). Southey. (Mauritius) "on the spot" (differentiation) (31). Xu. (Zhangzhou). (cockscomb) X.elongatum (Shenzhen). (2). (30). Wang. 100. 24. (citrus) (22). Pan. (Gulangyu Island). (Xiamen). (Stemi SV 6, ZEISS, Germany) 3. 4 4. (37% aqueous solution, SIGMA, USA). X. elongatum. (replacement. X. elongatum. (6). odontostyle). (3). (intraspecific variation). (25). Robbins. ( Axiolab, ZEISS, Germany) (MC80) (35mm, ISO 100, Elite. X. elongatum (parthenogenesis) (12). (Burundi)(7). Chrome, Kodak, USA) (NOVAMAT 150 AFI-M monitor, BRAUN, Germany) (anal body width). X. elongatum. (spicule). DNA (ribosomal DNA, rDNA) (molecular markers) (copy numbers). (coding region,. 18S, 5.8S, 28S gene). (conserved sequences). (3,6). (universal. 10. primers) (noncoding region, internal transcribed spacer 1 or 2, ITS-1, ITS-2). PCR. rDNA (11). "concerted evolution" (intraspecific). DNA. (interspecific) ITS-1. Xelo1. ITS-2. Xelo3. Xelo8. 3. DNA (1,4,9,10,13,14,15,16,21,23,26,28,29). 50. X. elongatum. 200 DNA. rDNA. [200 mM Tris-HCl, pH8.5, 250mM NaCl, 25 mM EDTA, 10 rDNA ITS-1. ITS-2. % w/v sodium dodecyl-sulphate plus 0.5 (Roche, Mannheim, Germany) 12-14. g/ul proteinase K 37 12000 x g.
(3) 47. Xiphinema elongatum 10 (Wizard. TM. DNA DNA Clean-Up. LB. Promega Cooperation, Madison,. WI, USA). (S-ITS-1. DNA, resin 900. P28S). PCR. rDNA. g. (22-24. ). 2ml. 80. rDNA. (Taipei, Taiwan). 1 spin column. DNA. isopropanol. rDNA. spin column spin column. isopropanol. 65. spin column. 1. 20. rDNA. 25-50. g. Xelo3. 12000 xg. spin column DNA. Xelo1. clone). DNA. 3. -20. (transformated Xelo8. 3. Genetics Computer Group (GCG). SeqWeb 2.1. Pretty program. (multiple sequences alignment) (consensus sequence). rDNA. rDNA (29). Vrain. rDNA. PCR. S-ITS-1. 18S. elongatum. 3'. X.. rDNA 7. 5' TTGATTACGTCCCTGCCCTTT 3' P28S. 28S. 3. 5'. 5'. ITS-1. 5.8S. ITS-2. TTTCACTCGCCGTTACTAAGG 3' rDNA. ITS-1. 18S 50. GAP program. ITS-2. 28S. 5.8S. gap weight = 50, length weight =. PCR. l. 3. 1. M. A. T. PCR. 5.8S (. C. 1. ). G. deoxyribonucleotide (dATP, dTTP dCTP, dGTP) mM. ITS-2. 1.25. Taq polymerase (Yeastern Biotech Co. Taipei, Taiwan) X Taq DNA polymerase buffer. ITS-1. BestFit program. rDNA 0.1. (BioRad iCycler,. Hercules, CA, USA) 94 72. 4. 2. 94. 30. 30. 52. 72. 30. 7. Xiphinema elongatum. PCR. 4. 10. 1 X TBE buffer (40 mM Tris, 20 mM Boric acid, and 1 mM EDTA, pH 8.0). 1.5. agarose gel. 10 X. elongatum (. ). DNA 3. 7. rDNA. (Xelo3) PCR. PCR-M clean up system (Viogene,. Taipei, Taiwan) pGEM-T easy. (Promega, USA). 2.31. PCR. mm. yT&A. (Xelo8). 2.15. 2.50 mm (Xelo10). (Yeastern Biotech. Taipei, Taiwan). 2 2.14. (Escherichia coli, ECOS101,. mm. a. b. c. 10. Yeastern Biotech. Taipei, Taiwan) 100. c'. l IPTG (5-bromo-4-chloro-3-indoyl-. -D-galactoside, 100 mM) -D -galactosidase, 50 mg/ml). 20. l X-gal (isopropylthioampicillin (100. g/ml). V 39.10. 40.42. 2.03 V.
(4) 48. 13. 1. 2004. Xiphinema elongatum Table 1. The list of geographical populations of Xiphinema elongatum investigated in this study Code Locality Host Xelo1 Shinshe Shiang, Taichung County Loquat (Eriobotrya japonica Lindl.) Xelo2 Guoshing Shiang, Nantou County Loquat (Eriobotrya japonica Lindl.) Xelo3 Daya Shiang, Taichung County Bermuda-grass (Cynodon dactylon Pers.) (On green of golf course) Xelo4 Taichung City Bermuda-grass (Cynodon dactylon Pers.) (On green of golf course) Xelo5 Wufeng Shiang, Taichung County Bermuda-grass (Cynodon dactylon Pers.) (On green of golf course) Xelo6 Shinhua Jen, Tainan County Bamboo (Bambusa sp.) Xelo7 Taichung City Bamboo (Bambusa sp.) Xelo8 Tsautuen Jen, Nantou County Sweet orange (Citrus sinensis Osb.) Xelo9 Dahu Shiang, Miaoli County Plum (Prunus salicina Lindl.) Xelo10 Taitung City, Taitung County Sugar apple (Annona squamosa L.). X. elongatum ( ) A, B, 2 C, D, E F, (F ) G, H, I J 90 Fig. 1. X. elongatum (female and juvenile) from Taiwan: A, Female habitus; B, Anterior region of two females; C, D, E and F, Female tails (F is abnormal); G, H, I and J, Tails of the first, second, third and fourth stage of juveniles, respectively. Scale bar = 90 m..
(5) 5.88 0.47 (5.06-7.21) 36.35 2.73 (30.88-42.80). 39.44 1.22 (37.50-42.40) 145.47 3.17 (140.00-153.30). 54.00 3.00 (48.00-58.00) 22.00 1.00 (20.00-23.00). 6.03 0.36 (5.23-6.74). 2.76 38.27 (32.61-46.22). 2.37 0.23 (1.87-3.00). 39.96 1.17 (37.30-42.70). 3.07 147.44 (140.80-155.80). 90.09 2.44 (85.00-96.60). 57.35 1.96 (51.70-61.70). 53.00 5.00 (43.00-69.00). 1.00 22.00 (19.00-23.00). b. c. c'. V%. Total stylet ( m). Functional odontostyle ( m). Odontophore ( m). Tail ( m). Anal body width ( m). 56.61 1.50 (53.30-60.80). 88.85 2.53 (84.20-93.40). 2.49 0.19 (2.22-2.85). 55.53 4.11 (48.65-68.67). 55.74 2.75 (49.19-61.71). a. 1.97 0.13 (1.72-2.18). 2.02 0.111 (1.82-2.25). L (mm). 23.00 1.00 (22.00-25.00). 59.00 3.00 (54.00-64.00). 58.78 1.61 (56.70-62.50). 87.47 3.20 (80.00-93.30). 146.25 3.57 (140.80-153.00). 39.55 1.43 (36.30-41.90). 2.56 0.12 (2.35-2.78). 39.30 1.87 (36.45-43.04). 6.96 0.36 (6.31-7.78). 60.11 2.39 (55.90-64.10). 2.31 0.09 (2.15-2.50). 23.00 1.00 (22.00-24.00). 57.00 4.00 (48.00-68.00). 59.53 1.41 (57.50-62.50). 87.96 2.39 (84.10-92.50). 147.48 2.82 (141.70-155.00). 40.40 1.25 (38.00-43.50). 2.47 0.17 (2.09-2.96). 38.81 2.20 (34.71-44.58). 6.38 0.35 (5.83-7.10). 55.58 2.72 (50.25-61.62). 2.19 0.11 (1.89-2.36). 22.00 1.00 (20.00-25.00). 59.00 3.00 (52.00-63.00). 58.04 1.98 (51.70-60.80). 87.05 2.78 (81.70-93.30). 145.09 3.28 (138.30-150.80). 40.88 1.46 (37.90-43.30). 2.63 0.15 (2.33-3.00). 37.39 2.24 (32.54-42.41). 6.57 0.49 (5.64-8.03). 61.64 4.31 (52.56-69.39). 2.19 0.11 (1.99-2.41). 22.00 1.00 (20.00-24.00). 56.00 3.00 (51.00-63.00). 56.73 1.60 (55.00-61.70). 88.34 2.43 (83.30-92.50). 145.07 3.19 (140.00-151.70). 39.59 1.25 (36.30-42.70). 2.55 0.17 (2.30-2.86). 35.65 1.92 (31.00-40.00). 5.99 0.28 (5.47-6.42). 57.65 4.87 (47.84-65.76). 2.00 0.11 (1.77-2.17). Table 2. Comparisons on morphometrics of X. elongatum female populations isolated from Taiwan, Zaire, Thailand, Philippines, and Mainland China Locality (Code) Host Character Shinshe (Xelo1) Guoshing (Xelo2) Daya (Xelo3) Taichung (Xelo4) Wufeng (Xelo5) Shinhua (Xelo6) Loquat Loquat Bermuda-grass Bermuda-grass Bermuda-grass Bamboo n 27 30 28 25 29 25. X. elongatum. 22.00 1.00 (19.00-25.00). 58.00 4.00 (51.00-64.00). 56.71 1.70 (51.70-60.00). 86.90 2.79 (83.30-91.60). 143.62 3.44 (137.50-149.20). 39.29 1.07 (37.00-41.10). 2.61 0.16 (2.26-2.90). 35.56 1.93 (32.22-40.86). 6.56 0.61 (5.27-7.90). 56.93 5.89 (47.03-72.33). 2.06 0.15 (1.74-2.37). Taichung (Xelo7) Bamboo 23. Xiphinema elongatum 49.
(6) 40.42 1.99 (37.10-44.60) 146.22 3.33 (140.80-154.20) 89.15 2.50 (85.00-93.30) 57.07 1.62 (54.20-61.70) 58.00 5.00 (48.00-68.00). 37.74 2.67 (33.16-42.04). 2.50 0.19 (2.13-2.89). 1.20 40.03 (37.10-41.70). 145.83 1.96 (141.70-150.00). 1.74 88.65 (85.90-93.30). 57.18 1.27 (55.00-60.00). 3.00 53.00 (47.00-57.00). 21.00 1.00 (19.00-23.00). c. c'. V%. Total stylet ( m). Functional odontostyle ( m). Odontophore ( m). Tail ( m). Anal body width ( m). 2. Measurements in the form: mean SD (range), "-" = No data. Reference: Tarjan A. C. & Luc, M., 1963 (27) 3 Reference: Luc, M. & Southey, J. F. 1980 (20) 4 Reference: Wang, et al., 1996 (30). 23.00 1.00 (21.00-25.00). 21.00 2.00 (19.00-23.00). 54.00 3.00 (50.00-58.00). 56.91 1.80 (55.00-59.20). 85.93 1.62 (84.10-89.10). 142.84 2.76 (140.80-148.30). 39.10 0.65 (38.10-40.10). 2.63 0.14 (2.41-2.80). 35.21 1.51 (32.98-37.60). 6.03 0.36 (5.66-6.55). -. 59. 59. 94. 153. 40. 2.3. 35. 6.1. 49. 2.089. -. 59.5 (54-64). 56 (54-59). 91.5 2.0 (89-94). 147.5 (146-151). 38.2 (36.9-39.5). 2.5 (2.3-2.6). 35.7 (32.7-40.3). -. 51.9 (48.3-56.9). 2.15 (2.03-2.24). -. 61.5 (58-65). 57 1.6 (55-59). 93 1.8 (91-95). 150 2.2 (147-153). 38.4 (35.1-40.5). 2.6 (2.5-2.8). 37.4 (37.9-39.6). -. 51.3 (47.9-55.7). 2.30 (2.15-2.45). -. 64 (n = 8) (58-70). 61 2.3 (56-65). 91 2.0 (89-97). 152 1.5 (149-154). 39.9 1.6 (37.0-43.0). 2.8 0.2 (2.6-3.2). 34 (n = 8) (32-37). -. 56.1 4.3 (49.8-68.2). 2.47 0.18 (2.11-2.72). 20, 22. 57, 61. 57, 62. 87, 88. 145, 149. 39, 39. 2.8, 2.9. 33, 37. 5.5, -. 56, 72. 2.0, 2.1. 1. 35.14 2.59 (30.00-40.20). 6.25 0.46 (5.44-7.09). 55.77 4.41 (50.81-62.67). 1.91 0.07 (1.81-2.03). 13. 1. 2.58 0.22 (2.13-3.09). 5.71 0.30 (5.14-6.30). b. 56.17 4.67 (50.00-64.24). 59.53 3.60 (49.50-66.33). a. 2.03 0.13 (1.74-2.27). 2.00 0.08 (1.85-2.14). L (mm). X. elongatum ( ) Table 2. Comparisons on morphometrics of X. elongatum female populations isolated from Taiwan, Zaire, Thailand, Philippines, and Mainland China (Cont'd) Locality (Code) Host Character Tsautuen (Xelo8) Dahu (Xelo9) Taitung (Xelo10) Zaire (holotype)2 Thailand3 Thailand3 Philippines3 Shenzhen, China4 Sweet orange Plum Sugar apple Unknown Asparagus Carnation Sugarcane Citrus n 21 19 7 1 8 5 20 2. 50 2004.
(7) 51. Xiphinema elongatum. X. elongatum (Xelo4) A, B, C, D E, (E ) 90 Fig. 2. X. elongatum (male) from Taiwan (Xelo4): A, Male habitus; B, Anterior region of male; C, D and E, Tails of males (E is abnormal); Scale bar = 90 m.. 53. 59. m. Xelo3. X. elongatum. (. A). ( (conoid). Xelo7. Xelo8. B). Xelo8. 2. 3. (anus). 2.5. (. C, D, E). (. (. F). , G, H, I, J) (anal body width). X. elongatum 10. Xelo10 9 (. 4 ). 10. X. elongatum X. elongatum (Xelo4). Xelo3. Xelo4. Xelo5 7. 10. 8. (. ). 3 a. b. c. c'. (. , A). (spicule) 3. (supplements)( 4. , C, D, E) (. , E). 4.
(8) 4.05 0.29 (3.57-4.53) 16.88 1.12 20.33 0.71 (15.66-19.11) (19.27-22.24) 3.65 0.22 (3.29-4.08). 14.15 0.68 17.38 1.01 20.55 1.15 27.77 2.00 13.87 0.73 (13.13-15.26) (15.77-19.59) (18.42-22.60) (22.63-30.74) (13.02-15.13). 3.70 0.37 (3.17-4.60). 62.86 1.53 (60.80-66.70). c. c'. Total stylet ( m). 2.63 0.14 (2.41-2.94). 3.96 0.29 (3.54-4.30). 61.73 1.95 75.64 2.11 (58.30-66.70) (71.70-80.80) 49.00 3.00 54.00 3.00 (45.00-53.00) (49.00-62.00) 14.00 1.00 16.00 1.00 (12.00-15.00) (14.00-18.00). Replacement 46.36 1.01 62.33 2.09 73.61 6.98 91.97 2.03 45.68 0.80 odontostyle (45.00-48.30) (59.20-67.50) (69.20-77.50) (87.50-95.00) (44.20-46.70) ( m). 43.00 3.00 49.00 1.00 54.00 3.00 54.00 2.00 43.00 2.00 (38.00-48.00) (47.00-52.00) (48.00-58.00) (50.00-58.00) (39.00-47.00). Anal body 12.00 1.00 14.00 1.00 17.00 1.00 21.00 1.00 11.00 1.00 width ( m) (10.00-13.00) (13.00-17.00) (15.00-19.00) (18.00-23.00) (10.00-13.00). Tail ( m). 36.24 0.76 42.14 1.10 (35.00-38.30) (40.00-45.00). 101.79 2.24 (97.50-106.70). Odontophore 29.09 0.90 36.41 1.31 42.40 1.28 49.94 1.01 28.87 0.85 ( m) (28.30-30.80) (34.20-38.30) (40.00-45.00) (48.30-51.70) (27.50-30.00). 82.34 1.68 (80.00-86.70). 3.38 0.19 (2.94-3.73). 4.35 0.25 (3.81-5.13). 46.10 1.50 59.65 1.48 (44.10-48.40) (56.70-62.50). 103.05 2.28 124.59 2.75 63.04 1.27 (99.20-107.50) (119.20-129.20) (61.70-65.00). 3.26 0.22 (2.94-3.63). 3.55 0.31 (3.11-4.06). Functional 33.76 1.38 46.16 1.42 60.65 1.67 74.64 2.19 34.16 1.02 odontostyle (32.50-37.50) (43.40-48.40) (58.30-65.00) (70.90-78.40) (32.50-35.80) ( m). 82.56 2.12 (79.20-85.80). 3.52 0.26 (2.94-4.00). 4.95 0.42 (4.23-5.59). 3.80 0.27 (3.33-4.40). 14.63 0.84 (13.64-16.84). 3.72 0.20 (3.41-4.25). 19.00 1.00 (17.00-20.00). 56.00 3.00 (50.00-63.00). 91.33 3.15 (85.80-98.30). 49.12 1.67 (45.00-51.70). 73.35 2.24 (69.20-79.10). 1.13 0.07 (1.03-1.27). 4.62 0.42 (3.55-5.38). 98.90 3.03 (93.30-105.00). 3.34 0.25 (2.94-3.73). 50.00 3.00 54.00 2.00 (44.00-53.00) (51.00-60.00). 57.11 2.71 71.20 4.20 (51.70-64.20) (65.00-78.30). 34.92 1.44 40.83 1.40 (31.70-36.70) (38.30-43.30). 45.77 2.79 58.07 2.37 (42.50-55.90) (52.50-63.30). 80.69 3.14 (77.50-91.70). 3.68 0.24 (3.27-4.08). 16.83 0.98 20.98 1.24 (15.29-19.02) (18.91-23.40). 4.03 0.24 (3.67-4.55). 41.55 2.74 48.08 2.92 (38.50-50.00) (44.29-54.29). 0.83 0.06 (0.76-0.97). 12.00 1.00) 14.00 1.00 16.00 1.00 (10.00-13.00 (12.00-16.00) (14.00-18.00). 44.00 3.00 (37.00-48.00). 45.08 1.29 (41.70-47.50). 29.12 1.30 (25.80-31.70). 32.91 1.73 (30.00-35.90). 122.47 2.93 62.03 1.91 (118.30-130.80) (58.30-65.00). 2.97 0.18 (2.63-3.32). 26.23 1.41 (23.45-29.26). 4.84 0.34 (4.21-5.55). 34.42 1.95 (30.53-38.13). 0.64 0.03 (0.58-0.68). J3 18. 19.00 1.00 (18.00-21.00). 58.00 3.00 (52.00-64.00). 88.02 2.37 (82.50-92.50). 48.61 1.79 (45.00-50.80). 73.01 3.02 (68.40-79.20). 121.62 2.53 (116.70-125.80). 3.07 0.17 (2.76-3.39). 26.58 1.84 (24.38-30.51). 5.04 0.47 (4.24-6.00). 53.63 2.99 (48.33-58.00). 1.54 0.12 (1.42-1.80). J4 18. 1. 4.12 0.29 (3.73-4.63). 49.98 3.34 (44.06-56.96). 1.48 0.10 (1.29-1.68). J4 25. Daya (Xelo3) Bermuda-grass J1 J2 23 19. 13. 4.36 0.31 (3.89-5.00). 3.67 0.30 (3.00-4.25). b. 1.10 0.05 (1.03-1.23). 39.53 2.83 45.18 4.02 (34.17-44.74) (39.26-52.00). 0.83 0.04 (0.76-0.90). 31.67 2.33 40.34 2.42 43.56 3.56 48.90 3.42 35.28 4.05 (27.00-34.12) (34.44-44.00) (38.15-50.43) (43.00-55.33) (30.00-45.38). 0.60 0.04 (0.54-0.69). a. 1.50 0.11 (1.29-1.66). 1.11 0.04 (1.03-1.16). 0.85 0.05 (0.79-0.96). J3 21. 0.61 0.041 (0.54-0.68). J4 18. L (mm). Stages n. J3 15. Guoshing (Xelo2) Loquat J1 J2 14 16. Shinshe (Xelo1) Loquat J1 J2 14 16. Character. Locality (Code) Host. Table 3. Comparisons on morphometrics of the 4 juvenile stages of X. elongatum isolated from Taiwan and Philippines. X. elongatum. 52 2004.
(9) (. ). 27.44 2.06 (23.93-30.18) 2.82 0.21 (2.39-3.39). 13.88 0.74 16.47 0.89 20.83 1.37 (12.44-15.61) (15.45-18.26) (18.62-22.80). 3.86 0.25 (3.42-4.50). 62.58 1.17 80.74 1.41 102.06 2.85 124.45 1.91 61.78 1.43 (60.00-64.70) (79.20-83.30) (95.00-107.50) (120.80-128.30) (59.20-63.30). c. c'. Total stylet ( m). 50.40 1.25 (47.50-52.50) 90.43 2.49 (85.00-95.00) 58.00 2.00 (55.00-64.00) 21.00 1.00 (18.00-23.00). Odontophore 29.71 1.03 36.21 1.22 43.25 1.54 (28.30-31.70) (34.20-38.30) (40.80-45.80) ( m). Replacement 45.91 1.18 60.19 1.74 75.43 2.67 odontostyle (44.20-48.30) (57.50-63.30) (71.70-83.30) ( m). 43.00 2.00 50.00 2.00 56.00 4.00 (40.00-49.00) (46.00-55.00) (50.00-61.00). Anal body 11.00 1.00 14.00 1.00 17.00 1.00 width( m) (10.00-13.00) (12.00-16.00) (15.00-19.00). Tail ( m). 70.05 1.65 (71.70-77.50). Functional 32.87 1.16 45.09 2.45 58.81 2.19 odontostyle (30.80-35.00) (42.50-45.80) (54.20-63.30) ( m). 3.70 0.25 (3.20-4.25). 3.32 0.26 (2.89-3.81). 5.23 0.40 (4.59-6.21). 4.43 0.33 (3.89-5.17). 3.94 0.20 (3.71-4.26). 3.51 0.25 (3.17-4.06). b. 11.00 1.00 (10.00-13.00). 42.00 3.00 (37.00-45.00). 44.84 1.04 (43.30-46.70). 28.46 1.13 (25.80-30.00). 33.33 1.12 (30.80-35.00). 3.83 0.43 (3.08-4.50). 14.86 1.18 (13.26-17.11). 3.62 0.25 (3.32-4.06). 34.54 3.82 (30.50-46.15). 50.12 3.55 (43.85-57.67). 31.53 1.84 37.80 2.39 45.51 3.32 (29.00-34.71) (33.60-43.00) (40.00-51.90). a. 0.62 0.03 (0.57-0.69). 1.60 0.13 (1.34-1.82). 1.16 0.08 (1.03-1.32). 0.83 0.04 (0.78-0.89). 0.60 0.04 (0.56-0.69). L (mm). 13.00 1.00 (12.00-15.00). 49.00 3.00 (43.00-53.00). 58.11 2.12 (54.20-61.70). 35.16 0.84 (33.30-36.70). 44.13 2.09 (40.00-47.50). 79.29 2.49 (75.00-83.30). 3.70 0.28 (3.07-4.08). 16.87 0.65 (15.92-18.75). 4.07 0.28 (3.60-4.55). 41.12 2.38 (37.89-46.47). 0.83 0.06 (0.72-0.91). 3.07 0.18 (2.75-3.33). 26.85 1.70 (23.64-29.29). 5.06 0.40 (4.06-5.73). 55.62 3.01 (48.15-59.64). 1.56 0.10 (1.30-1.72). 3.88 0.27 (3.33-4.50). 14.02 0.62 (12.86-15.26). 3.53 0.23 (3.22-4.07). 33.89 2.41 (29.47-38.82). 0.59 0.03 (0.54-0.66). 16.00 2.00 (13.00-19.00). 56.00 5.00 (50.00-68.00). 73.92 2.60 (68.30-78.30). 41.14 1.56 (38.30-44.20). 57.94 3.15 (51.60-63.40). 19.00 1.00 (18.00-21.00). 58.00 3.00 (54.00-62.00). 88.87 2.77 (85.00-95.80). 48.56 1.20 (46.70-50.00). 71.61 2.53 (66.70-75.80). 11.00 1.00 (10.00-12.00). 42.00 2.00 (38.00-46.00). 44.42 0.88 (43.30-45.80). 28.94 0.81 (27.50-30.00). 33.38 1.36 (30.80-35.80). 14.00 1.00 (13.00-15.00). 49.00 2.00 (43.00-52.00). 60.75 2.47 (55.80-64.20). 35.65 1.35 (33.30-38.30). 45.64 1.23 (43.30-48.30). 81.29 2.04 (78.30-85.00). 3.57 0.22 (3.20-3.85). 16.42 1.07 (14.68-18.16). 3.84 0.15 (3.62-4.22). 38.20 2.70 (31.74-42.11). 0.80 0.06 (0.69-0.89). Shinhua (Xelo6) Bamboo J1 J2 18 21. 99.08 3.15 120.17 3.26 62.32 1.30 (90.80-104.20) (115.00-125.80) (60.00-64.20). 3.50 0.44 (2.89-4.85). 20.54 1.76 (17.46-24.55). 4.54 0.37 (3.92-5.27). 49.10 3.48 (41.20-56.67). 1.15 0.09 (1.02-1.35). Table 3. Comparisons on morphometrics of the 4 juvenile stages of X. elongatum isolated from Taiwan and Philippines (Cont'd 1) Locality (Code) Host Character Taichung (Xelo4) Wufeng (Xelo5) Bermuda-grass Bermuda-grass Stages J1 J2 J3 J4 J1 J2 J3 J4 n 22 18 21 23 20 15 17 15. X. elongatum. 1.49 0.12 (1.26-1.68). J4 26. 4.85 0.22 (4.48-5.32). 2.94 0.22 (2.50-3.50). 16.00 1.00 19.00 1.00 (15.00-17.00) (18.00-22.00). 53.00 2.00 57.00 4.00 (48.00-57.00) (47.00-63.00). 72.90 2.33 89.97 3.38 (70.00-76.70) (80.00-95.80). 40.89 1.52 48.75 1.78 (38.30-43.30) (44.20-51.70). 58.07 2.08 73.02 1.77 (53.30-62.50) (70.80-76.70). 98.96 2.93 121.77 2.79 (92.50-104.20) (116.70-126.70). 3.39 0.15 (3.12-3.67). 20.04 1.28 26.20 1.78 (18.46-23.21) (23.77-29.46). 4.20 0.24 (3.88-4.78). 46.79 3.08 51.41 2.38 (41.74-52.50) (46.97-56.79). 1.06 0.07 (0.96-1.23). J3 15. Xiphinema elongatum 53.
(10) (. ). 25.42 2.04 (21.06-28.68) 3.01 0.28 (2.45-3.50). 48.73 1.14 (46.70-50.80) 89.57 3.36 (85.00-97.50) 58.00 5.00 (49.00-66.00) 19.00 1.00 (18.00-23.00). 3.75 0.24 (3.58-4.18). 62.03 2.64 79.74 1.05 100.87 2.54 121.48 2.34 62.83 1.46 80.16 1.90 101.58 3.27 (58.30-66.70) (78.30-81.70) (96.70-106.70) (118.30-125.80) (60.80-65.00) (76.70-83.30) (97.50-108.30) 72.75 2.06 (69.10-75.80). 14.29 0.97 16.02 0.64 19.64 1.13 (12.39-15.35) (15.10-17.11) (17.68-21.60). 33.60 2.32 43.78 1.16 59.62 2.40 (31.60-38.40) (41.60-45.80) (55.00-64.20). 28.43 1.20 35.95 0.95 41.25 1.21 (26.70-30.80) (35.00-38.30) (38.30-44.20). 45.24 0.79 60.91 3.23 75.17 4.61 (44.20-46.70) (57.50-69.20) (69.20-89.20). 44.00 1.00 50.00 2.00 55.00 3.00 (43.00-46.00) (45.00-53.00) (48.00-63.00). c. c'. Total stylet ( m). Functional odontostyle ( m). Odontophore ( m). Replacement odontostyle ( m). Tail ( m). Anal body 12.00 0.00 13.00 1.00 16.00 2.00 width ( m) (11.00-12.00) (12.00-15.00) (15.00-19.00). 3.71 0.17 (3.36-4.00). 3.38 0.26 (2.78-3.87). 5.01 0.38 (4.50-6.08). 4.34 0.40 (3.48-5.00). 3.90 0.43 (3.35-4.89). 4.20 0.27 (3.77-4.68). 3.76 0.36 (3.44-4.80). 3.54 0.24 (3.12-3.87). 10.00 1.00 13.00 1.00 16.00 1.00 (10.00-13.00) (10.00-16.00) (15.00-17.00). 42.00 3.00 49.00 3.00 55.00 2.00 (38.00-47.00) (43.00-55.00) (52.00-58.00). 46.14 1.32 61.68 4.29 74.84 1.65 (43.30-48.30) (56.70-75.80) (72.50-77.50). 28.96 0.71 35.89 2.00 41.93 0.87 (27.50-30.00) (33.30-41.70) (40.00-43.30). 33.86 1.46 45.48 3.89 59.65 3.20 (31.60-36.70) (40.90-59.10) (55.80-65.80). 4.03 0.37 (3.38-4.70). 14.25 1.21 16.96 1.58 20.52 1.12 (12.56-16.32) (13.73-21.13) (18.62-22.41). 3.37 0.21 (3.06-3.76). 1.14 0.08 (1.03-1.31). 4.10 0.47 (3.43-4.89). 4.51 0.46 (3.76-5.46). 3.85 0.39 (3.45-4.60). 3.71 0.30 (3.24-4.17). 3.50 0.26 (3.00-3.93). 14.83 0.95 16.48 0.76 19.65 0.95 (13.26-16.32) (15.09-17.76) (17.76-21.13). 3.60 0.29 (3.39-4.24). 3.09 0.26 (2.48-3.67). 25.87 1.26 (23.77-28.21). 5.12 0.29 (4.55-5.72). 51.69 3.64 (44.69-57.60). 1.58 0.09 (1.43-1.74). J4 26. 18.00 1.00 (17.00-20.00). 55.00 4.00 (48.00-64.00). 89.81 3.42 (82.50-95.00). 48.82 1.46 (46.70-50.80). 72.55 3.36 (65.90-78.40). 11.00 1.00 14.00 2.00 17.00 1.00 (10.00-13.00) (12.00-17.00) (15.00-18.00). 43.00 4.00 52.00 3.00 58.00 3.00 (38.00-48.00) (48.00-61.00) (51.00-63.00). 46.81 1.47 60.31 1.81 75.53 3.41 (44.20-49.20) (57.50-63.30) (70.00-84.20). 29.26 1.22 35.61 1.59 42.05 1.31 (28.30-30.80) (31.70-38.30) (39.20-45.00). 34.56 1.27 45.09 2.14 59.57 1.37 (32.50-35.90) (40.00-48.30) (56.70-61.70). 20.00 1.00 (18.00-23.00). 61.00 4.00 (52.00-69.00). 90.48 2.52 (85.00-95.00). 49.93 1.66 (46.70-54.20). 73.23 1.88 (69.10-76.70). 121.38 3.96 63.81 1.66 80.71 2.21 101.62 2.43 123.17 2.79 (114.20-126.70) (60.80-65.80) (75.80-85.80) (97.50-106.70) (118.30-129.20). 3.00 0.19 (2.75-3.37). 27.25 1.51 (24.55-29.25). 5.00 0.39 (4.45-5.59). 0.86 0.07 (0.77-1.00). J3 19. 35.67 0.96 40.82 2.61 46.22 3.89 (33.68-36.47) (37.14-45.50) (39.26-52.17). 0.63 0.04 (0.60-0.72). J2 14. 1. 3.82 0.27 (3.35-4.16). 3.78 0.19 (3.44-4.06). b. 53.89 3.54 (48.13-58.40). 1.50 0.10 (1.35-1.66). J4 17. Dahu (Xelo9) Plum J1 7. 13. 32.69 2.43 41.21 4.52 47.63 3.95 (27.00-36.88) (33.91-53.33) (44.17-55.00). 51.73 4.23 (43.75-61.74). 1.13 0.04 (1.06-1.21). 34.21 3.42 38.38 1.67 44.84 3.68 (31.00-41.33) (35.22-40.95) (37.41-54.00). 0.83 0.10 (0.70-1.12). a. 0.59 0.03 (0.54-0.64). J3 10. 1.47 0.08 (1.34-1.66). J4 23. 1.08 0.08 (0.99-1.29). 0.79 0.04 (0.74-0.87). J3 22. Tsautuen (Xelo8) Sweet orange J1 J2 14 17. 0.63 0.03 (0.57-0.66). Taichung (Xelo7) Bamboo J1 J2 7 13. L (mm). Stages n. Character. Locality (Code) Host. Table 3. Comparisons on morphometrics of the 4 juvenile stages of X. elongatum isolated from Taiwan and Philippines (Cont'd 2). X. elongatum. 54 2004.
(11) 55. Xiphinema elongatum X. elongatum ( ) Table 3. Comparisons on morphometrics of the 4 juvenile stages of X. elongatum isolated from Taiwan and Philippines (Cont'd 3) Locality (Code) Host. Character. J4 14. Philippines2 Sugarcane J1 9. J2 13. J3 15. J4 14. 1.05 0.08 (0.98-1.18). 1.36 0.06 (1.23-1.48). 0.66 0.06 (0.53-0.72). 0.87 0.04 (0.81-0.94). 1.29 0.11 (1.19-1.64). 1.79 0.26 (1.32-2.17). 35.49 3.00 (32.94-39.33). 48.21 3.63 (42.61-51.43). 54.98 6.17 (41.00-62.86). -. -. -. -. b. 3.46 0.16 (3.29-3.76). 4.13 0.21 (3.92-4.37). 4.66 0.25 (4.30-5.19). -. -. -. -. c. 13.85 0.66 (12.73-14.55). 19.32 0.54 (18.85-20.20). 25.55 1.33 (23.04-27.92). -. -. -. -. c'. 4.18 0.17 (4.00-4.40). 3.64 0.30 (3.25-4.07). 3.14 0.15 (2.94-3.50). 4.4 0.1 (4.2-4.5). 4.4 0.6 (3.5-5.0). 3.6 0.3 (3.1-4.1). 3.5 0.3 (3.1-4.0). Total stylet ( m). 62.08 1.25 (60.00-63.30). 99.86 2.73 (96.70-104.20). 119.05 3.12 (114.20-124.20). -. -. -. Functional odontostyle ( m). 32.92 0.46 (32.50-33.40). 60.86 3.98 (58.30-67.50). 71.11 2.19 (66.70-75.00). 34 1.9 (31-37). 46 1.3 (44-47). 62 1.9 (59-65). 74 2.8 (71-78). Odontophore ( m). 29.17 1.06 (27.50-30.00). 39.00 2.96 (35.00-41.70). 47.94 1.75 (44.20-50.00). 29 2.2 (25-31). 37 1.5 (35-40). 44 1.6 (41-47). 51 2.3 (47-53). Replacement odontostyle ( m). 45.27 1.46 (43.30-47.50). 74.16 2.86 (71.70-78.30). 86.53 2.09 (80.80-88.30). 46 1.4 (44-47). 63 2.4 (59-68). 79 2.3 (75-83). 93 3.7 (86-97). Tail ( m). 43.00 2.00 (40.00-44.00). 54.00 5.00 (49.00-61.00). 53.00 3.00 (49.00-58.00). -. -. -. -. Anal body width ( m). 10.00 0.00 (10.00-11.00). 15.00 2.00 (13.00-17.00). 17.00 1.00 (16.00-18.00). -. -. -. -. Taitung (Xelo10) Sugar apple J1 J3 6 5. L (mm). 0.59 0.03 (0.56-0.64). a. Stages n. 1 2. Measurements in the form: mean SD (range), "-" = No data Reference: Luc, M. & Southey, J. F. 1980 (20). X. elongatum Xelo1. Xelo3. PCR. GenBank. rDNA. Xelo8 rDNA 2083. (base pair, bp). AY524971. ITS-1. 2078. 5.8S. Xiphinema elongatum. 2083. (12,20). ITS-2 10. 3 Xelo3 5. ITS-2. (Xelo3, 4, 5). ITS-1 0.55. ITS-2. 1.34. 5.8S. elongatum. Xelo3. 2.41. 1 0.63. 18S. (. ) ITS-1. X. elongatum 5.8S. 10. 28S ITS-2. rDNA. 2.50 mm. X..
(12) 56. 13. 1. 2004. X. elongatum. 10. Table 4. Comparisons on morphometrics of males of X. elongatum isolated from Taiwan, South Africa and Brundi Locality (code) Host Character Taichung (Xelo4) South Africa1 Brundi2 Bermuda-grass Unknown Maize n 8 3 1 L (mm). 2.01 0.163 (1.78-2.24). 2.59, 2.29, 2.30. 2.45. a. 55.68 5.39 (48.11-63.33). 47, 57, 43. 61. b. 6.06 0.73 (5.24-7.54). 7.0, 6.7, 8.2. 5.8. c. 42.21 6.90 (33.58-52.37). 52, 46, 46. 41.1. c'. 1.88 0.19 (1.52-2.04). 1.5, 2.0, 1.6. 1.9. Total stylet ( m). 146.56 2.10 (144.20-150.00). 158, 148, 150. 168. Functional odontostyle ( m). 89.15 1.86 (87.50-91.60). 101, 92, 94. 102. Odontophore ( m). 57.41 0.93 (56.70-59.20). 57, 56, 56. Tail ( m). 48.00 6.00 (38.00-53.00). 50, 51, 50. 53. Anal body width( m). 26.00 1.00 (25.00-27.00). -. 27.5. Spicule ( m). 47.06 2.89 (42.50-50.00). 50, 47, 53. 53.5. (Xelo3, 4, 5. X. elongatum. 2. Xelo1, 2, 6, 7, 8, 9, 10). 2. 4 2 Xelo1, 8. 3. Xelo3 rDNA. 2. Xelo3. Xelo1. Xelo8. ITS-1. 1085 bp ITS-2. 0.55. 5.8S. Xelo3. 2. ITS-1. Xelo3 4. rDNA 10 X. elongatum. (5). X. elongatum a. 66. (. ). Luc. Southey. (20). 22 48 164. 54. m. m 59. 67. 161 10. 1. Reference: Heyns, J. 1974, (12) 2 Reference: Coomans, et al., 1990, (7) 3 Measurements in the form: mean SD (range), "-" = No data.. X.. "short-tailed". elongatum. m. m. X. elongatum. 4. a. X. elongatum. (. 4. (7). (12). ). X. elongatum. 10. 25. 25. 2.35 mm 7. 2.78 mm 178. rDNA. Xelo3, 4, 5. (144. m) 2.73 mm. 3. Razak. Loof (24). 3. 6 (138. 7. m). 177.
(13) 57. Xiphinema elongatum. X. elongatum rDNA (ITS-1, 5.8S, ITS-2) Table 5. The size of rDNA ITS-1, 5.8S, ITS-2 and the pairwise percentage nucleotide dissimilarities among the three geographical populations of X. elongatum in Taiwan ITS-1. Population (Code) Xelo1 Xelo3 Xelo8. 5.8S. No. of bases. Xelo1. Xelo3. 1085 1085 1085. 0.55 0.55. 0.00. 84. 110. m. 54. 67. (30). Wang. ITS-2. No. of bases. Xelo1. Xelo3. 160 160 160. 0.63 0.00. 0.63. No. of bases. Xelo1. Xelo3. 530 525 530. 1.34 0.76. 0.57. m 2. 4. X. 5. elongatum (22). (. ). 3. X. elongatum. Luc. Pan. Xelo4. 5 3. 4 rDNA (ITS-1. Southey. ITS-2) PCR Xelo1. 2 (1.82, 1.84 mm) (2.2,2.1). 6 (. c' (90, 92. (53, 51 (50, 50. Xelo8. Xelo3. m). ). 2. 3. m). rDNA. (0. 1.34%). X. elongatum. m). rDNA. X. elongatum X. elongatum (20). 4. (. 10. ). 3. c'. X. elongatum. rDNA. 4 X.. 4 elongatum (Xelo4). X.. elongatum (2.01. 2.19 mm). m). c'. (1.88. (26. 23. 2.47). (48. rDNA. 57. X. elongatum. m). Xelo4. 3. 4. X.. 1.. . 2003.. elongatum. rDNA-RFLP 3. 3. X. elongatum. (12). .. 12: 235-241. 2.. . 1972. .. (. ). 61. 3. Alkemada, J. R. M., and Loof, P. A. A. 1989.. (7). Observations on the ontogeny of some Xiphinema species 168. m. 143. 158.5. m. (Nematoda: Dorylaimida). Med. Fac. Landbouww..
(14) 58. 13. 1. 2004. Rijksuniv. Gent. 54: 1177-1186.. Phenotypic variations and genetic characterization of. 4. Bulman, S. R., and Marshall, J. W. 1997. Differentiation of Australasian potato cyst nematode (PCN) populations using the polymerase chain reaction (PCR). New Zealand J. Crop and Horti. Sci. 25, 123-129.. Xiphinema populations from Slovakia (Nematoda: Dorylaimida). Nematol. Medit. 27: 261-275. 17. Loof, P. A. A., and Maas, P. W. Th. 1972. The genus Xiphinema (Dorylaimida) in Surinam. Nematologica. 5. Cohn, E., and Sher, S. A. 1972. A contribution to the taxonomy of the genus Xiphinema Cobb, 1913. J. Nematol. 4:36-65.. 18:92-119. 18. Loof, P. A. A., and Sharma, R. D. 1979. Plant parasitic nematodes from Bahia State, Brazil: The genus. 6. Coomans, A., and De Coninck, L. 1963. Observations on spear-formation in Xiphinema. Nematologica 9:85-96.. Xiphinema Cobb, 1913 (Dorylaimoidea). Nematologica 25:111-127.. 7. Coomans, A., Rashid, F. M., and Luc, M. 1990.. 19. Luc, M., and Dalmasso, A. 1975. Considerations on the. Observation on Xiphinema vitis Heyns, 1974, X.. genus Xiphinema Cobb, 1913 (Nematoda, Longidoridae). elongatum Schuurmans Stekhoven & Teunissen, 1938, X.. and a "lattice" for the identification of species. Cah.. fatikae fatikae Bos & Loof, 1985, and description of X. fatikae eburnense subsp. n. (Nemata: Longidoridae), from Africa. Revue Nematol. 13:239-248.. ORSTOM, Ser. Biol. 10:303-327. 20. Luc, M., and Southey, J. F. 1980. Study of biometrical variability in Xiphinema insigne Loos, 1949, and X.. 8. Ferraz, L. C. C. B. 1980. Observations on some. elongatum Schuurmans Stekhoven & Teunissen, 1938;. Xiphinema species found in Brazil (Nematoda:. description of X. savanicola n. s.p (Nematoda:. Dorylaimoidea). Nematol. Medit. 8:141-151.. Longidoridae) and comments on thelytokous species.. 9. Ferris, V. R., Ferris, J. M., and Faghihi, J. 1993. Variation. Revue Nematol. 3:243-269.. in spacer ribosomal DNA in some cyst-forming species of. 21. Newton, L. A., Chilton, N. B., Beveridge, I., and Gasser,. plant parasitic nematodes. Fund. Appl. Nematol. 16: 177-. R. B. 1998. Genetic evidence indicating that Cooperia. 184.. surnabada and Cooperia oncophora are one species. Int.. 10. Ferris, V. R., Ferris, J. M., Faghihi, J., and Ireholm, A.. J. Parasitol. 28: 331-336.. 1994. Comparisons of isolates of Heterodera avenae. 22. Pan, C., Zheng, J., Zhou, X., Neilson, R., and Brown, D.. using 2-D PAGE protein patterns and ribosomal DNA. J.. J. F. 2000. Preliminary assessment of the occurrence of. Nematol. 26: 144-151.. longidorid and trichodorid nematodes (Nematoda:. 11. Gerbi, S. A. 1986. The evolution of eukaryotic ribosomal DNA. BioSystems 19: 247-258.. Longidoridae and Trichodoridae) in Xiamen, Fujian Province, China. Russian J. Nematol. 8:153-159.. 12. Heyns, J. 1974. The genus Xiphinema in South Africa II.. 23. Powers, T. O., Todd, T. C., Burnell, A. M., Murray, P. C.. X. elongatum-group (Nematoda: Dorylaimida).. B., Fleming, C. C., Szalanski, A. L., Adams, B. A., and. Phytophylactica 6: 249-260.. Harris, T. S. 1997. The rDNA internal transcribed spacer. 13. Hoste, H., Chilton, N. B., Beveridge, I., and Gasser, R. B. 1998. Differences in the first internal transcribed spacer of. ribosomal. DNA. among. five. species. of. Trichostrongylus. Int. J. Parasitol. 28: 1251-1260. 14. Hoste, H., Chilton, N. B., Gasser, R. B., and Beveridge, I.. region as a taxonomic marker for nematodes. J. Nematol. 29: 441-450. 24. Razak, A. R., and Loof, P. A. A. 1998. The genus Xiphinema Cobb, 1913 (Nematoda: Longidoridae) in western Malaysia. Fund. Appl. Nematol. 21:413-428.. 1995. Differences in the second internal transcribed. 25. Robbins, R. T., Brown, D. J. F., Halbrendt, M., and Vrain,. spacer (ribosomal DNA) between five species of. T. C. 1996. Compendium of juvenile stages of Xiphinema. Trichostrongylus (Nematoda: Trichostrongylidae). Int. J.. species (Nematoda: Longidoridae). Russian J. Nematol.. Parasitol. 25: 75-80.. 4:163-171.. 15. Ibrahim, S. K., Baldwin, J. G., Roberts, P. A., and Hyman,. 26. Szalanski, A. L., Sui, D. D., Harris, T. S., and Powers, T.. B. C. 1997. Genetic variation in Nacobbus aberrans: an. O. 1997. Identification of cyst nematodes of agronomic. approach toward taxonomic resolution. J. Nematol. 29:. and regulatory concern with PCR-RFLP of ITS-1. J.. 241-249.. Nematol. 29: 255-267.. 16. Lamberti, F., Sabova, M., DE Luca, F., Molinari, S.,. 27. Tarjan, A. C., and Luc, M. 1963. Observations on. Agostinelli, A., Coiro, M. I., and Valocka, B. 1999.. Xiphinema insigne Loos, 1949 and Xiphinema elongatum.
(15) Xiphinema elongatum Schuurmans Stekhoven & Teunissen, 1938 (Nematoda: Dorylaimidae). Nematologica 9:163-172.. 59. americanum group. Fund. Appl. Nematol. 15: 563-573. 30. Wang, S., Chiu, W. F., Yu, C., Li, C., and Robbins, R. T.. 28. Thiery, M., and Mugniery, D. 1996. Interspecific rDNA. 1996. The occurrence and geographical distribution of. restriction fragment length polymorphism in Globodera. longidorid and trichodorid nematodes associated with. species, parasites of Solanaceous plants. Fund. Appl.. vineyards and orchards in China. Russian J. Nematol.. Nematol. 19: 471-479.. 4:145-153.. 29. Vrain, T. C., Wakarchuk, D. A., Levesque, C. A., and. 31. Xu, J., Fu, P., and Cheng, H. 1995. A taxonomic study on. Hamilton, R. I. 1992. Intraspecific rDNA restriction. species of Xiphinema from seven provinces of China. fragment length polymorphism in the Xiphinema. (Nemata: Longidoridae). J. Nanjing Agri. Uni.18: 37-42..
(16) 60. 13. 1. 2004. ABSTRACT Chen, D. Y1, Ni, H. F.2, Yen, J. H.3 ,Cheng, Y. H.2, and Tsay, T. T.4, 5. 2004. Variability within Xiphinema elongatum populations in Taiwan. Plant Pathol. Bull. 13: 45-60. ( 1 Plant Pathology Division, Taiwan Agricultural Research Institute, Wufeng, Taichung, Taiwan, R.O.C.; 2 Department of Plant Protection, Chia Yi Agricultural Experiment Station, TARI, Taiwan; R.O.C.; 3Agricultural Extension Center, National Chung Hsing University, Taichung, Taiwan, R.O.C.; 4 Department of Plant Pathology, National Chung Hsing University, Taichung, Taiwan, R.O.C.; 5 Corresponding author, E-mail: [email protected], Fax: +886-422876712) Ten geographical populations of X. elongatum were collected successively from different area in Taiwan using modified Baermann funnel method during 1998 to 2002. Comparing the morphometrics of female and juveniles among these 10 populations, only the length item of female and the third and fourth stage of juveniles isolated from the Bermuda-grass were longer than the other population, however, the rest of morphometrics were almost identical. Based on the matchable length of the replacement odontostyle and functional odontostyle, and also the evident gap of the replacement odontostyle and total stylet length, between the four successive stages of juveniles and its female in each population, it assured that each population was not mix with other morphologically similar Xiphinema species. Most parts of the morphometrics of male were identical with female, the only difference showed in the tail shape with more variance. The dissimilarity within each population (except for Xelo3) and between the three representative populations (Xelo1, 3, 8) of the rDNA (ITS-1 & ITS-2) sequence alignment was not evident (only from 0 to 1.34 %); therefore, it was feasible to develop the species-specific primers. Taiwan, the southeast part of Mainland China, and the Southeast Asia were geographically close, the morphometrics of X. elongatum, according to the worldwide reported data, of these areas were more similar to each other than to that of X. elongatum of the South Africa and South America. Whether the variance occurred among the above areas belongs to the intraspecific or interspecific variation, more morphometric data of the juveniles, males and the sequences of rDNA were needed, so we could be more acknowledged about the variability of this cosmopolitan species. Key words: Variability, Xiphinema elongatum, ribosomal DNA, rDNA, internal transcribed spacer, ITS-1, ITS-2.
(17)
相關文件
The importation should conform to the regulations of "Consolidated List of Conditional Import Items of Mainland China Origin and Regulations Governing Import of Mainland
由於現代測繪科技之發展日新月異，地籍測量所用之儀器與方法
of Korea Japan Thailand Philippines Singapore Malaysia Others Japão Tailândia Filipinas
This article is for the founding of the modern centuries of Buddhist Studies in Taiwan, the mainland before 1949, the Republic of China period (1912～1949), and Taiwan from
With regard to spending structure, visitors from Mainland China spent 60% of the per-capita spending on shopping, whereas those from Hong Kong and Taiwan, China spent 79% and 74% of
With regard to the spending structure, visitors from Mainland China spent 63% of their per- capita spending on shopping, whereas those from Hong Kong and Taiwan, China spent 79% and
of Korea Japan Thailand Philippines Singapore Malaysia Others Japão Tailândia Filipinas
of Korea Japan Thailand Philippines Singapore Malaysia Others Japão Tailândia Filipinas
