• 沒有找到結果。

No association of cytokine gene polymorphisms in Chinese patients with atopic dermatitis

N/A
N/A
Protected

Academic year: 2021

Share "No association of cytokine gene polymorphisms in Chinese patients with atopic dermatitis"

Copied!
5
0
0

加載中.... (立即查看全文)

全文

(1)

No association of cytokine gene polymorphisms in Chinese patients

with atopic dermatitis

Y. T. Chang,*† W. R. Lee,‡ C. W. Yu,* H. N. Liu,*†§ M. W. Lin,–** C. H. Huang,*† C. C. Chen,*† D. D. Lee,*† W. J. Wang,*† C. H. Hu‡ and S. F. Tsai††‡‡

*Department of Dermatology and –Department of Medical Research and Education, Taipei Veterans General Hospital, Taipei; †Department of Dermatology, **Faculty of Medicine, and ††Institute of Genetics, National Yang-Ming University, Taipei; ‡Department of Dermatology and Graduate Institute of Medical Sciences, Taipei Medical University Hospital, Taipei; §Department of Dermatology, National Defence Medical Centre, Taipei; and ‡‡Division of Molecular and Genomic Medicine, National Health Research Institutes, Taipei, Taiwan

Summary

Background. Atopic dermatitis (AD) is a common chronically relapsing skin disease

associated with the activation of T-helper 2 cells. Recent studies have shown that polymorphisms in the genes for interleukin (IL)-4, the IL-4 receptor, IL-13, and signal transducer and activator 6 (STAT6) may contribute to susceptibility of AD. To date, no cytokine gene polymorphism study has been conducted on Chinese patients with AD. Aims. To determine whether genetic polymorphisms of the cytokine genes might influence the development of AD.

Methods. DNA samples were obtained from 94 patients and 186 control subjects. Using direct sequencing and microsatellite genotyping, we examined 22 polymor-phisms in eight cytokine genes including the genes for IL-4, -10, -12B and -13, the IL-4 receptor, tumour necrosis factor (TNF)-a, STAT6, and interferon (IFN)-c.

Results. No significantly different allelic and genotypic distributions of the cytokine gene polymorphisms could be found between patients and controls. Moreover, no association was observed with disease onset, gender, the presence of elevated serum total IgE level or blood eosinophilia.

Conclusion. Our study suggests that the analysed genetic polymorphisms of cytokine genes do not appear to be associated with AD susceptibility in our Chinese population.

Introduction

Atopic dermatitis (AD) is a common chronically relap-sing skin disease that occurs most commonly during early infancy and childhood.1 AD is frequently associ-ated with elevassoci-ated serum IgE levels and a personal or family history of AD, allergic rhinitis or asthma.1 Although the pathogenesis of AD remains obscure, it probably results from a polygenic inheritance pattern that involves cytokine gene activation.2

Evidence from several studies have shown an increased frequency of circulating allergen-specific interleukin (IL)-4 and IL-5-secreting T-helper (Th) 2 cells in AD, and the activation of Th2-like cells appears to be central to the immune dysregulation in AD.3 In addition, high levels of IL-4, -5, -10, -12 and -13, and interferon (IFN)-c have been detected in skin lesions and sera of patients with AD.4–6

Cytokine gene polymorphisms may affect constitutive and inducible cytokine production and contribute to the disease-associated cytokine imbalance. Recent studies have shown that polymorphisms in the genes encoding for IL-4, the IL-4 receptor (IL-4R), IL-13, and signal transducer and activator 6 (STAT6) may contribute to susceptibility for AD.7–11Although cytokine gene poly-morphisms have been studied extensively in patients with AD in other populations, no report about cytokine Correspondence: Han-Nan Liu, MD, Department of Dermatology, Taipei

Veterans General Hospital, no. 201, Section 2, Shih-Pai Road, Taipei, Taiwan, 11217, Republic of China.

E-mail: [email protected] Conflict of interest: none declared. Accepted for publication 12 January 2006

(2)

gene polymorphisms in Chinese AD patients has, to our knowledge, been published in the literature.

In order to investigate whether cytokine gene poly-morphisms play a role in the pathogenesis of Chinese patients with AD, we performed a case–control associ-ation study by genotyping the polymorphisms of cyto-kine genes [genes encoding for IL-4, -10, -12B and -13, IL-4R, tumour necrosis factor (TNF)-a, STAT6, and IFN-c] in a Chinese population.

Materials and methods

Patients and controls

In total, 94 patients with AD were recruited from the dermatological clinic at the Taipei Veterans General Hospital and Taipei Medical University Hospital. Their clinical records were reviewed by dermatologists spe-cialized in AD. All patients were Chinese, residing in Taiwan, and genetically unrelated to each other. The diagnosis of AD was made according to diagnostic criteria for AD by Hanifin and Rajka, and patients having three or more major diagnostic criteria plus three or more minor features were enrolled in the study.12 The control group comprised 186 healthy individuals (volunteer blood donors and hospital staff). The control subjects were selected to maximize match-ing for gender and geographical origin. Informed

consent was obtained from each participant, under protocols approved by the research ethics boards of the hospitals.

Genotyping of cytokine genes

Genomic DNA was extracted from 5 mL of whole blood using a DNA isolation kit (Gentra Systems, Minneapolis, MN, USA). The genotyping of single nucleotide poly-morphisms (SNPs) of the cytokine genes (IL-4, IL-10, IL-12B, IL-13, IL-4R and TNF-a) of the study subjects were determined by direct sequencing. Their primer sequence and methods of genotyping are listed in Table 1. Firstly, the DNA sequence of cytokine genes was amplified by PCR. The amplified PCR products were then subjected to sequencing reaction using fluorescent-dye-terminator cycle chemistry (ABI Prism, PE Biosys-tems, CA, USA) in a 10lL reaction. Sequences were obtained from both ends using the same primers used in the PCR reaction. The products of sequencing reactions were run on a DNA analyser (3730XL; ABI⁄ Hitachi, Tokyo, Japan).

The short tandem repeats of the STAT6 and IFN-c genes were determined by the fluorescence-labelling technique. The forward primer was fluorescently labelled (with FAM) and the amplified PCR products were mixed with form-amide containing a stop buffer, denatured for 5 min at 95C, and run on a performance optimized polymer 6

Table 1 Methods and primers used in genotyping of cytokine genes. Gene polymorphism

Genotyping

method Primers

IL-4 –590T–C, +33T–C Sequencing F: ACTAGGCCT CACCTGATACG R:: CACTTGTGTCCGTGGACAAAG IL-10 –1082 A–G,)819T–C, Sequencing F: ATCCAAGACAACACTACTAA

)592A–C R:: TAAATATCCTCAAAGTTCC

IL-12B +4237G–A, +4496A–G, Sequencing F: ACCATCTGGAGAGCTTAAGAACC

+4510G–A R:: TGCCTTACATTTGACTGAGGATT

Il-13)1111C–T Sequencing F: ATGCCTTGTGAGGAGGGTCAC R:: CCAGTCTCTGCAGGATCAACC

+ 4464G–A Sequencing F: TGGCGTTCTACTCACGTGCT

R:: CAGCACAGGCTGAGGTCTAA IL-4R*E375A, L389L, C406R, Sequencing F: CAGCATGGTGCCCAGTGGAG

S503P, Q576R R:: CTGCTGGCAAGCAGGCTTGA

TNF-a)1031T–C, )863C–A, Sequencing F: TGGACTCACCAGGTGAGGCC

)857C–T R:: TCACTCCCTGGGGCCCTCTA

)308G–A, )238G–A Sequencing F: CAAACACAGGCCTCAGGACTC R:: AGGGAGCGTCTGCTGGCTG STAT6: STR at exon 1 Microsatellite F: GAGGGACCTGGGTAGAAGGA

genotyping R:: CACCCCCATGCACTCATAG IFN-c: STR at first intron Microsatellite F: AGACATTCACAATTGATTTTATTCTTAC

genotyping R:: CCTTCCTGTAGGGTATTATTATACG STR, short tandem repeats; F, forward; R, reverse.

(3)

(POP6) gel in a DNA analyser (3700; ABI⁄ Hitachi). Fragment sizes were determined using Genescan (version 3.1) and Genotyper (version 2.5) software.

Statistical analysis

The differences of the allele and genotype frequencies between the case and control subjects were assessed using the v2 test or Fisher’s exact test. Odds ratios, confidence intervals, and significance values were calculated using the Epi Info program (version 3.3; CDC, Atlanta, GA, USA). The CLUMP program (D. Curtis, London Statistical Genetics Group, UK) was used to assess significance of case–control association studies with multiallelic markers. Hardy–Weinberg equilibrium was also tested using thev2test.

Results

Characteristics of patients with AD

The 94 AD patients included 52 male and 42 female patients, with a mean age of 26.9 years (range 3 months to 81 years). Of these, 77 patients (81.9%) had the onset of AD before the age of 18 years and 17 patients (18.1%) had onset at 19 years or older (adult-onset AD).13 Forty-five patients (47.9%) had concomitant manifestation of allergic rhinitis or asthma. Elevated serum total IgE level was detected in 76 patients (80.9%) and blood eosinophilia occurred in 31 (33%). Fifty-six patients (60%) reported a family history of AD, allergic rhinitis or asthma.

Frequencies of cytokine gene polymorphisms

The allele frequencies of the investigated cytokine gene polymorphisms are shown in Table 2. The genotype frequencies of all polymorphisms in the patients with AD and in the control subjects were in Hardy–Weinberg equilibrium (P > 0.05). There was complete linkage disequilibrium between the)590C and +33C alleles of the IL-4 gene, between the)819C and )592C alleles of the IL-10 gene, and between the A375, L389, R406 and P503 alleles of the IL-4R gene. No significantly different allelic and genotypic distributions of the analysed cytokine gene polymorphisms were found between the patients with AD and controls. No associ-ation was observed with disease onset (infant⁄ childhood or adult-onset) (Table 3), gender, or the presence of elevated serum total IgE level or blood eosinophilia (data not shown).

Discussion

AD is one of the most common chronic disorders in childhood and its occurrence has increased steadily in industrialized countries over the past few decades.14The

prevalence of AD in children ranges between 10 and 37% in white populations to 21% in the Chinese population.14,15Twin studies in white populations have shown that the concordance rate of AD in monozygotic twins is 72–86% compared with 21–23% in dizygotic twins, and the heritability is 0.96–1.4.16 In our study, 60% of Chinese patients with AD reported a family

Table 2 Cytokine gene polymorphisms in patients with atopic dermatitis and control subjects.

Polymorphism Patients (n ¼ 188) Controls (n ¼ 372) P-value IL-4 )590C 40 (21.3%) 81 (21.8%) 0.98 +33C 40 (21.3%) 81 (21.8%) 0.98 IL-10 )1082G 14 (7.4%) 28 (7.5%) 0.89 )819C 56 (29.8%) 122 (32.8%) 0.53 )592C 56 (29.8%) 122 (32.8%) 0.53 IL-12B +4237 A 33 (17.6%) 51 (13.7%) 0.28 +4496G 91 (48.4%) 181 (48.7%) 0.97 +4510 A 82 (43.6%) 172 (46.2%) 0.62 Il-13 )1111T 38 (20.2%) 63 (16.9%) 0.4 +4464 A 69 (36.7%) 125 (33.6%) 0.53 IL-4R* A375 15 (8%) 21 (5.6%) 0.38 L389 15 (8%) 21 (5.6%) 0.38 R406 15 (8%) 21 (5.6%) 0.38 P503 15 (8%) 21 (5.6%) 0.38 R576 28 (14.9%) 46 (12.4%) 0.48 TNF-a )1031C 39 (20.7%) 76 (20.4%) 0.98 )863 A 38 (20.2%) 64 (17.2%) 0.45 )857T 22 (11.7%) 35 (9.4%) 0.48 )308 A 22 (11.7%) 36 (9.7%) 0.55 )238 A 1 (0.5%) 7 (1.9%) 0.28 STAT6 13R (327 bp) 60 (31.9%) 95 (25.5%) 0.13 14R (329 bp) 4 (2.1%) 1 (0.3%) 15R (331 bp) 114 (60.6%) 244 (65.6%) 16R (333 bp) 10 (5.3%) 31 (8.3%) 17R (335 bp) 0 (0%) 1 (0.3%) IFN-c 11R (122 bp) 26 (13.8%) 63 (16.9%) 0.88 12R (124 bp) 75 (39.9%) 133 (35.8%) 13R (126 bp) 4 (2.1%) 6 (1.6%) 14R (128 bp) 71 (37.8%) 147 (39.5%) 15R (130 bp) 4 (2.1%) 7 (1.9%) 16R (132 bp) 1 (0.5%) 2 (0.5%) 17R (134 bp) 7 (3.7%) 14 (3.8%)

(4)

history of AD, allergic rhinitis or asthma. This indicated the presence of strong genetic factors underlying the development of AD.

Acute skin lesions in AD patients showed a higher number of IL-4, -5 and -13 mRNA-expressing cells whereas chronic AD skin lesions contained a larger number of cells expressing IL-12 and IFN-c mRNA.17,18 Therefore, a biphasic T-cell response in the skin (Th2 cells in acute AD and Th1 cells in chronic AD) has been proposed.1 Because the aber-rant cytokine expression could be important in the pathogenesis of AD, functional relevant cytokine gene polymorphisms might affect cytokine production and

therefore could determine disease susceptibility of AD. Previous studies have shown that the IL-4–590T, IL-13 +4464A, IL-4R*R576, STAT6*13R, IL-12B +4237A, and TNF-a )308A alleles are strongly associated with AD or atopic disease in white and Japanese populations.7–11,19,20 However, other studies

revealed contradictory results.21,22 In the present study, no significantly different allelic or genotypic distributions of the analysed cytokine gene polymor-phisms were found between our AD patients and controls. Moreover, no association with disease onset, gender, elevated serum total IgE level or blood eosinophilia was observed. It has been suggested that AD is a multifactorial disease that results from the interactions between susceptibility genes, environmen-tal factors, defective skin barrier function and immuno-logical responses.1 Whether a particular gene or mutation causes AD depends on the overall genetic background of the host and may vary substantially in different ethnic groups. Although the case number in our series is limited, our results indicated that the analysed cytokine gene polymorphisms do not appear to be associated with AD susceptibility in a Chinese population. In fact, it is not yet clear whether the genetic contribution for AD could be explained by variation in a limited number of genes.2

Genome-wide linkage studies in white populations revealed highly significant evidence for linkage on chromosomes 1, 3, 5, 13, 15, 17, 18 and 20.23–25 However, no such study has been conducted in Chinese populations. Although the present case–control candi-date gene study did not support cytokine genes as important susceptibility genes of AD in the Chinese population, large-scale genome-wide screens for AD in Chinese families is still warranted to unravel the genetic base of AD.

In conclusion, our study did not find association between the examined genetic polymorphisms of cyto-kine genes and AD in our Chinese population.

Acknowledgements

The authors would like to thank J. J. Shiue and C. R. Wang for their technical assistance. This study was supported by a grant from the National Science Council, Executive Yuan, Taiwan (93–2314-B-010– 017).

References

1 Leung DY, Boguniewicz M, Howell MD et al. New insights into atopic dermatitis. J Clin Invest 2004; 113: 651–7.

Table 3 Cytokine gene polymorphisms in infant⁄ childhood-onset patients with atopic dermatitis and control subjects.

Polymorphism Patients (n ¼ 154) Controls (n ¼ 372) P-value IL-4 )590C 30 (19.5%) 81 (21.8%) 0.64 +33C 30 (19.5%) 81 (21.8%) 0.64 IL-10 )1082G 7 (4.5%) 28 (7.5%) 0.29 )819C 43 (28%) 122 (32.8%) 0.32 )592C 43 (28%) 122 (32.8%) 0.32 IL-12B +4237 A 28 (18.2%) 51 (13.7%) 0.24 +4496G 71 (46.1%) 181 (48.7%) 0.66 +4510 A 70 (45.5%) 172 (46.2%) 0.95 Il-13 )1111T 31 (20.1%) 63 (16.9%) 0.46 +4464 A 55 (35.7%) 125 (33.6%) 0.72 IL-4R* A375 11 (7.1%) 21 (5.6%) 0.65 L389 11 (7.1%) 21 (5.6%) 0.65 R406 11 (7.1%) 21 (5.6%) 0.65 P503 11 (7.1%) 21 (5.6%) 0.65 R576 22 (14.3%) 46 (12.4%) 0.65 TNF-a )1031C 34 (22.1%) 76 (20.4%) 0.76 )863 A 33 (21.4%) 64 (17.2%) 0.31 )857T 21 (13.6%) 35 (9.4%) 0.2 )308 A 18 (11.7%) 36 (9.7%) 0.59 )238 A 1 (0.6%) 7 (1.9%) 0.45 STAT6 13R (327 bp) 50 (32.5%) 95 (25.5%) 0.14 14R (329 bp) 3 (1.9%) 1 (0.3%) 15R (331 bp) 91 (59.1%) 244 (65.6%) 16R (333 bp) 10 (6.5%) 31 (8.3%) 17R (335 bp) 0 (0%) 1 (0.3%) IFN-c 11R (122 bp) 20 (13%) 63 (16.9%) 0.46 12R (124 bp) 67 (43.5%) 133 (35.8%) 13R (126 bp) 4 (2.6%) 6 (1.6%) 14R (128 bp) 57 (37%) 147 (39.5%) 15R (130 bp) 1 (0.6%) 7 (1.9%) 16R (132 bp) 1 (0.6%) 2 (0.5%) 17R (134 bp) 4 (2.6%) 14 (3.8%)

(5)

2 Hoffjan S, Epplen JT. The genetics of atopic dermatitis: recent findings and future options. J Mol Med 2005; 83: 682–92.

3 van Reijsen FC, Bruijnzeel-Koomen CA, Kalthoff FS et al. Skin-derived aeroallergen-specific T-cell clones of Th2 phenotype in patients with atopic dermatitis. J Allergy Clin Immunol 1992; 90: 184–93.

4 Renz H, Jujo K, Bradley KL et al. Enhanced IL-4 production and IL-4 receptor expression in atopic dermatitis and IL-4 receptor expression in atopic dermatitis and their modu-lation by interferon-gamma. J Invest Dermatol 1992; 99: 403–8.

5 Kallmann BA, Kolb H, Huther M et al. Interleukin-10 is a predominant cytokine in atopic dermatitis. Arch Dermatol 1996; 132: 1133–4.

6 Grewe M, Gyufko K, Schopf E, Krutmann J. Lesional expression of interferon-gamma in atopic eczema. Lancet 1994; 343: 25–6.

7 Kawashima T, Noguchi E, Arinami T et al. Linkage and association of an interleukin 4 gene polymorphism with atopic dermatitis in Japanese families. J Med Genet 1998; 35: 502–4.

8 Oiso N, Fukai K, Ishii M. Interleukin 4 receptor alpha chain polymorphism Gln551Arg is associated with adult atopic dermatitis in Japan. Br J Dermatol 2000; 142: 1003–6. 9 Tsunemi Y, Saeki H, Nakamura K et al. Interleukin-13

gene polymorphism G4257A is associated with atopic dermatitis in Japanese patients. J Dermatol Sci 2002; 30: 100–7.

10 Novak N, Kruse S, Kraft S et al. Dichotomic nature of atopic dermatitis reflected by combined analysis of monocyte immunophenotyping and single nucleotide polymorphisms of the interleukin-4⁄ interleukin-13 receptor gene: the dichotomy of extrinsic and intrinsic atopic dermatitis. J Invest Dermatol 2002; 119: 870–5.

11 Tamura K, Arakawa H, Suzuki M et al. Linkage and association studies of STAT6 gene polymorphisms and allergic diseases. Int Arch Allergy Immunol 2003; 131: 33– 8.

12 Hanifin JM, Rajka G. Diagnostic features of atopic derma-titis. Acta Derm Venereol 1980; 92: 44S–7S.

13 Ozkaya E. Adult-onset atopic dermatitis. J Am Acad Der-matol 2005; 52: 579–82.

14 Dotterud LK, Kvammen B, Lund E, Falk ES. Prevalence and some clinical aspects of atopic dermatitis in the community of Sor-Varanger. Acta Derm Venereol 1995; 75: 50–3. 15 Tay YK, Kong KH, Khoo L et al. The prevalence and

des-criptive epidemiology of atopic dermatitis in Singapore school children. Br J Dermatol 2002; 146: 101–6. 16 Larsen FS, Holm NV, Henningsen K. Atopic dermatitis. A

genetic–epidemiologic study in a population-based twin sample. J Am Acad Dermatol 1986; 15: 487–94. 17 Hamid Q, Boguniewicz M, Leung DY. Differential in situ

cytokine gene expression in acute versus chronic atopic dermatitis. J Clin Invest 1994; 94: 870–6.

18 Hamid Q, Naseer T, Minshall EM et al. In vivo expression of IL-12 and IL-13 in atopic dermatitis. J Allergy Clin Immunol 1996; 98: 225–31.

19 Randolph AG, Lange C, Silverman EK et al. The IL12B gene is associated with asthma. Am J Hum Genet 2004; 75: 709–15.

20 Li Kam Wa TC, Mansur AH, Britton J et al. Association between)308 tumour necrosis factor promoter poly-morphism and bronchial hyperreactivity in asthma. Clin Exp Allergy 1999; 29: 1204–8.

21 Elliott K, Fitzpatrick E, Hill D et al. The)590C ⁄ T and )34C ⁄ T interleukin-4 promoter polymorphisms are not associated with atopic eczema in childhood. J Allergy Clin Immunol 2001; 108: 285–7.

22 Noguchi E, Shibasaki M, Arinami T et al. Lack of associ-ation of atopy⁄ asthma and the interleukin-4 receptor al-pha gene in Japanese. Clin Exp Allergy 1999; 29: 228–33. 23 Lee YA, Wahn U, Kehrt R et al. A major susceptibility locus for atopic dermatitis maps to chromosome 3q21. Nat Genet 2000; 26: 470–3.

24 Beyer K, Nickel R, Freidhoff L et al. Association and linkage of atopic dermatitis with chromosome 13q12–14 and 5q31–33 markers. J Invest Dermatol 2000; 115: 906–8. 25 Bradley M, Soderhall C, Luthman H et al. Susceptibility loci

for atopic dermatitis on chromosomes 3, 13, 15, 17 and 18 in a Swedish population. Hum Mol Genet 2002; 11: 1539– 48.

參考文獻

相關文件

g and j show CIFC, blue arrow and yellow arrow points to abnormal mineralization or OtD in the root pulp chamber, j–l shows abnormal tooth root development and cementum formation,

The new intervention methods in HIV management and prevention target gene-based therapies, interference with HIV receptor and coreceptor interactions, the use of effective innate

pylori in pathogenesis of oral mucosal lesions or ulcerations is still unclear, it seems that patients with oral lesions as leukoplakia and oral lichen planus, and concurrent

Genetic study of the BRAF gene reveals new variants and high frequency of the V600E mutation among Iranian ameloblastoma patients.. Maryam Soltani 1 | Mohammad Amin Tabatabaiefar 2,3

Abu-Ghanem S, Yehuda M, Carmel NN, et al: Elective neck dissection vs observation in early-stage squamous cell carci- noma of the oral tongue with N0 clinically apparent lymph

13 According to Kim et al., 8 positive patch tests for dental materials were found in 70.5% of patients, mostly in oral lichen planus (75%), cheilitis (75%), and BMS (25%); the

Kristensen et al., “Prevalence of psoriatic arthritis in patients with psoriasis: a systematic review and meta-analysis of observational and clinical stud- ies, ” Journal of

Kurokawa et al., “Severe destruction of the temporomandibular joint with complete resorption of the condyle associated with synovitis, acne, pustulosis, hyper- ostosis, and