Additions and Corrections
Vol. 272 (1997) 13772–13778
Purification and cloning of carp nephrosin, a secreted zinc endopeptidase of the astacin family.
Ching-Hsiang Hung, Hon-Ren Huang, Chang-Jen Huang, Fore-Lien Huang, and Geen-Dong Chang
Page 13374, Table II: This table was printed incorrectly. The correct table is shown below:
TABLE II
Digestion of synthetic peptide substrates by nephrosin
Substrates Sequencesa Hydrolysis
Tosyl-GPK-NA GPK NDb Suc-AAPF-NA AAPF NDb Suc-AAPL-NA AAPL NDb Cbz-GGL-NA GGL NDb Substance P RPKPQQ 2 Ff FGLM-NH2 Complete Lys-bradykinin KRPPG 2 Ff SPFR Complete Bradykinin 1–5 RPPGF NDb Bradykinin 1–6 RPPGFS NDb Bradykinin 1–7 RPPG 2 FSP Partial des-Arg-bradykinin PPGF 2 SPFR Complete a
2 indicates bonds cleaved by carp nephrosin, andf indicates major cleavage site.
bND, nondetectable in 60 min.
We suggest that subscribers photocopy these corrections and insert the photocopies at the appropriate places where the article to be corrected originally appeared. Authors are urged to introduce these corrections into any reprints they distribute. Secondary (abstract) services are urged to carry notice of these corrections as prominently as they carried the original abstracts.
19632
at National Taiwan University on May 4, 2009
www.jbc.org
Purification and Cloning of Carp Nephrosin, a Secreted Zinc
Endopeptidase of the Astacin Family*
(Received for publication, October 25, 1996, and in revised form, January 24, 1997)
Ching-Hsiang Hung‡§, Hon-Ren Huang§
¶, Chang-Jen Huang
i, Fore-Lien Huang
¶i,
and Geen-Dong Chang‡**
From the ‡Graduate Institute of Biochemical Sciences and¶Department of Zoology, National Taiwan University, Taipei 10098 and theiInstitute of Biological Chemistry, Academia Sinica, Taipei 115, Taiwan
We have purified a secreted proteinase of 23 kDa from carp head kidney by sequential column chromatogra-phy on a Reactive Blue 72-agarose dye affinity column and an FPLC Mono-P column. The secretion of this pro-teinase from carp head kidney can be stimulated by high concentrations of potassium. Since the carp proteinase is present mainly in the head kidney, kidney, and spleen (all of which are lymphohematopoietic organs), it is named nephrosin. The carp nephrosin is most sensitive to metal chelators, but not to inhibitors specific for other classes of proteinases. A cDNA clone has been isolated from a carp head kidney cDNA library by im-munoscreening with a polyclonal antiserum raised against purified nephrosin. The cloned cDNA is 1086 base pairs in length and has an open reading frame encoding a protein of 273 amino acids, including a 19-amino acid signal peptide and 56-19-amino acid propep-tide. The deduced amino acid sequence shows moderate levels of identity to medaka HCE1 (52.5%), medaka LCE (50.7%), crayfish astacin (33.2%), murine meprin-a (34%), and murine meprin-b (33.5%), all members of the astacin family of zinc endopeptidases. Nephrosin is the first member of the astacin family found in lymphohemato-poietic tissues.
Teleost head kidney consists of interrenal tissue (1–3) ho-mologous to the adrenal cortex, chromaffin cells (4, 5) respon-sible for epinephrine and norepinephrine secretion, immune cells (6 –9) responsible for immunoglobulin M secretion, and hematopoietic cells (6, 10, 11). Bone marrow is not present in fish, whereas hematopoietic tissues and lymphatic tissues co-exist in the lymphohematopoietic organs. In addition to the head kidney, spleen and kidney are also lymphohematopoietic organs in teleost fish (6).
The presence of four different types of cells (neurons, endo-crine cells, immune cells, and hematopoietic cells) in the head kidney prompted us to study the secreted proteins from head kidney since these cells are all active in secretion. Interacting molecules may be secreted by one cell type in a paracrine mode to exert its effects on neighboring cells or on the extracellular
matrix (ECM).1Therefore, we attempted to purify the secreted proteins from carp head kidney and eventually to understand the functions of the secreted molecules. Here, we report the purification and cloning of one secreted protein, nephrosin. Nephrosin is a zinc metalloproteinase and is present mainly in the gill, kidney, head kidney, and spleen. We have also dem-onstrated that secretion of nephrosin can be stimulated by high concentrations of extracellular potassium. Amino acid se-quence analysis reveals that nephrosin is most closely related to medaka hatching enzymes, members of the astacin family (12). However, our evidence suggests that nephrosin is proba-bly not a hatching enzyme.
EXPERIMENTAL PROCEDURES
Perfusion of Carp Head Kidney—Common carp (Cyprinus carpio) purchased from a local fish market were held in plastic tanks (403 453 80 cm) under natural temperature and photoperiod for 1 day before experiments. Fish were decapitated between 10 and 11 a.m. The head kidney was carefully removed and placed in the normal perfusion buffer consisting of 125 mMNaCl, 5 mMKCl, 1.5 mMCaCl2, 0.9 mM MgSO4, 10 mM glucose, and 10 mM NaPO4, pH 7.4. The setup of perfusion system was essentially the same as described (13). Following a 90-min stabilization period, perfusate samples were collected for eight 10-min intervals. For the control group, tissue was perfused with the normal perfusion medium throughout the perfusion period, whereas for the experimental group, a high potassium perfusion medium (50 mM potassium, 80 mMNaCl, 1.5 mMCaCl2, 0.9 mMMgSO4, 10 mMglucose, and 10 mMNaPO4, pH 7.4) was administered for 20 min starting from collection interval two. Perfusate samples were then frozen at220 °C until use for immunoblot, zymographic (see below), and lactate dehy-drogenase assay (14).
Purification of Nephrosin—Carp head kidneys (20 g) were homoge-nized in 200 ml of 20 mMTris-HCl containing 5 mMEDTA, pH 8.0, by a glass homogenizer. The supernatant was collected by centrifugation at 12,0003 g for 30 min, and 0.3MNaCl was added to the supernatant. The sample was then applied onto a Reactive Blue 72-agarose column (2.53 10 cm; Sigma) equilibrated with 0.3MNaCl in the homogeniza-tion buffer and eluted stepwise by 0.3M, 0.6M, and 1.0MNaCl in the homogenization buffer. All three elution steps would desorb nephrosin from the column but the 0.6MNaCl fractions contained nephrosin activity of the highest purity. The 0.6 MNaCl fractions were pooled, lyophilized, and dissolved in 25 mMimidazole/HCl buffer, pH 7.1, and applied to an FPLC Mono P HR5/5 column (Pharmacia Biotech Inc.). Purification was achieved by a 10-min elution with 25 mMimidazole, pH 7.1, and a 40-min elution with 10% Polybuffer, pH 4.0 (Pharmacia Biotech Inc.) at a constant flow rate of 0.8 ml/min. The active fractions were pooled, dialyzed against 100 mMammonium bicarbonate, and lyophilized. Proteolytic activities of nephrosin during each purification step were monitored with the proteolytic zymographic assay (see be-low). Protein concentrations were determined by a Coomassie Blue binding assay with bovine serum albumin (BSA) as the standard (15). Gel Electrophoresis—Gel electrophoresis was performed using a * This work was supported by Grants NSC-83-0203-B-001-119 and
NSC-84-2311-B-001-073 from the National Science Council of Taiwan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted
to the GenBankTM/EBI Data Bank with accession number(s) U62621.
§ Both authors contributed equally to this paper.
** To whom correspondence should be addressed: Graduate Institute of Biochemical Sciences, National Taiwan University, P. O. Box 23-106, Taipei 10098, Taiwan, ROC. Tel.: 2-362-0261 (ext 4121); Fax: 886-2-363-5038; E-mail: [email protected].
1The abbreviations used are: ECM, extracellular matrix; PAGE, polyacrylamide gel electrophoresis; RCM, reduced and carboxymethyl-ated; BSA, bovine serum albumin; PBS, phosphate-buffered saline; DIG, digoxigenin; MOPS, 4-morpholinepropanesulfonic acid; bp, base pair(s); NA, nitroanilide; Tricine, N-tris(hydroxymethyl)methylglycine.
© 1997 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.
This paper is available on line at http://www-jbc.stanford.edu/jbc/
13772
at National Taiwan University on May 4, 2009
www.jbc.org
Tricine SDS-PAGE system as described previously (16). The gel con-centration was 7.5%, and the bisacrylamide to acrylamide ratio was 6%. For proteolytic zymographic assay, Tricine SDS-polyacrylamide gel was prepared as described (17, 18), except that the gel contained 0.1% reduced and carboxymethylated BSA (RCM-BSA). After electrophore-sis, the gel was incubated for 1 h at 27 °C with 2% Triton X-100 in 20 mMTris-HCl, pH 8.0 once and Tris buffer containing 0.1 mMZnCl2 twice, each for 90 min. The gel was then stained with 0.2% Coomassie Blue R250 in 40% methanol, 7% acetic acid and destained with 30% methanol, 7% acetic acid.
Effects of Proteinase Inhibitors—The effects of various inhibitors against nephrosin were examined using RCM-BSA as a substrate. The enzyme samples (0.1mg in 10 ml) were preincubated with a particular inhibitor or buffer alone (mock) on ice for 10 min, and the reaction was initiated by the addition of 20ml of substrate solution (30 mg of RCM-BSA in 20 mMTris-HCl containing 15mMZnCl2, pH 8.0). The reaction was maintained at 27 °C for 1 h and stopped by the addition of 30ml of 23 concentrated SDS sample buffer without 2-mercaptoethanol. The reaction mixture was then boiled for 3 min. Fourml of the sample were analyzed by SDS-PAGE, and the amounts of residual RCM-BSA was calculated using an Imaging Densitometer (Bio-Rad GS-670). For each treatment, the amounts of RCM-BSA digested (total RCM-BSA minus residual RCM-BSA) were calculated and compared with those of mock treatment.
Hydrolysis of Small Peptides—The peptides (10mg in 40 ml) were
dissolved in 20 mMammonium bicarbonate containing 15mMZnCl2. The reaction was started by adding 10ml of enzyme solution (0.1 mg/ml) in 20 mMammonium bicarbonate, and the mixture was incubated at 27 °C for 1 h. The reaction mixture was then lyophilized, dissolved in 0.1% trifluoroacetic acid, and separated on a reverse-phase C18column eluted with a linear gradient of acetonitrile in 0.1% trifluoroacetic acid. Each peak was collected, lyophilized, and subjected to amino acid se-quencing (model 477A; Applied Biosystems, Forest City, CA).
Chromogenic Assay with Peptide-p-nitroanilide Substrates—The pro-teolytic activities of nephrosin was determined by using the synthetic peptides, N-tosyl-Gly-Pro-Arg-p-nitroanilide, N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide, N-carbobenzoxy-Gly-Gly-Leu-p-nitroanilide, and N-succinyl-Ala-Ala-Pro-Leu-p-nitroanilide, respectively (19), as substrates.
Immunization and Immunoblot Analysis—The Mono-P fraction was dissolved in phosphate-buffered saline (PBS) and thoroughly mixed with an equal volume of Freund’s complete adjuvant for the first tion or Freund’s incomplete adjuvant for the second and third injec-tions. Approximately 100mg of nephrosin was injected subcutaneously into the back of a guinea pig during each immunization, biweekly. Ten days after the third injection, the blood was collected by heart puncture and serum stored at 4 °C. Western blotting was carried out using guinea pig anti-nephrosin antiserum (1:2000 dilution) and horseradish peroxidase-conjugated second antibody (1:1000 dilution) after
electro-transfer to nitrocellulose paper (0.22mm, Sartorius). Immunoreactive bands were detected by the NiCl2enhancement method (20).
Artificial Insemination—Female carp were injected twice at the base of pectoral fin with PBS homogenate of one pituitary, each 6 h apart. Ovulation occurred 12 h after the first injection (21). Ovulated eggs were collected and mixed with spontaneously spermiated milt for 5 min and then dispersed with tap water. Fertilized eggs were then allowed to develop at 25 °C with constant compressed air bubbling, and water was replaced twice a day. Embryos were harvested between 70 and 72 h after fertilization and frozen in liquid nitrogen. Hatching liquid was collected at 82 h when more than 80% of the embryos completed hatch-ing, and then frozen at270 °C.
General Methods in Molecular Biology—Standard procedures in mo-lecular biology were used for preparation of plasmid DNA, restriction enzyme digestion, DNA agarose gel electrophoresis, DNA ligation, and the transformation of bacteria (22).
Immunoscreening of a Carp Head Kidney cDNA Library—A carp head kidney cDNA library prepared from poly(A)-enriched RNA by unidirectional insertion of cDNA intol-ZAP II (23) was purchased from Stratagene (La Jolla, CA). Thel-ZAP phages were plated at a density of 53 104plaques/agar plate (150 mm, inner diameter). A total of 60 plates was screened. After incubation for 3 h at 42 °C, the plates were overlaid with nitrocellulose filters (pore size, 0.45mm; Micron Separa-tions, Westboro, MA) that had been impregnated with 10 mM isopropyl-1-thio-b-D-galactopyranoside. Incubation was continued overnight at 37 °C. The filters were then removed, washed with PBS at room
tem-FIG. 1. Secretion of proteins from carp head kidney perfused
in vitro. After tissue was equilibrated with fish saline for 90 min,
samples of perfusate were collected for eight 10-min intervals. Perfu-sion medium was changed from normal fish saline to that containing 50 mMpotassium for 20 min at the beginning of interval 2. The perfusate samples were analyzed by SDS-PAGE and silver staining.
FIG. 2. A and B, elution profiles of nephrosin from Reactive Blue 72-agarose (A) and Mono-P columns (B). Head kidney extract (200 ml) was chromatographed on a Reactive Blue 72-agarose column. Fractions of 6 ml were collected at a flow rate of 25 ml/h. Proteins obtained from the first column (80mg) were chromatographed on a Mono-P column equilibrated with 20 mMimidazole, pH 7.1, and eluted with 10% Polybuffer, pH 4.0. Fractions containing nephrosin were collected as indicated by bar on the figure. Crude extract (lane 1) and samples from the Reactive Blue 72-agarose column (lane 2) and from Mono-P column (lane 3) were analyzed by SDS-PAGE and silver staining (C).
Isolation and Sequence of Carp Nephrosin
13773
at National Taiwan University on May 4, 2009
www.jbc.org
perature, and blocked with 3% skim milk in PBS for 1 h at room temperature. Following blocking, filters were probed with a polyclonal antiserum specific for carp nephrosin at a 1:500 dilution in PBS con-taining 3 mg/ml bovine serum albumin, 1 mMEDTA, and 0.4% Triton X-100 at 4 °C for 16 h. The filters were then washed three times at room temperature in PBS and incubated with horseradish peroxidase-conju-gated anti-guinea pig IgG (Sigma) for 1 h at room temperature. After three washes with PBS, the immune complexes were incubated in PBS containing 0.2 mg/ml diaminobenzamidine and revealed by adding H2O2(10ml in 10 ml of PBS). Phages displaying stronger signals were isolated for secondary screening. One positive clone was isolated after screening 33 106plaques, and pBluescript plasmids containing cDNA inserts were obtained by in vivo excision according to the protocols provided by Stratagene.
DNA Sequencing and Sequence Analysis—Plasmids carrying cDNA inserts were sequenced in both directions using the T7 Sequenase version 2.0 (U.S. Biochemical Corp.) and the dideoxy chain termination method (24). A search for related sequences in GenBank™, EMBL, SWISS-PROT, and Protein Identification Resource was carried out with an IFIND program using the FASTA algorithm of Pearson and Lipman (25). Alignment of the deduced amino acid sequences with known mem-bers of the astacin family was accomplished with the Clustal W multi-ple alignment program (26).
Northern Blot Analysis—Total RNA was isolated from carp blood cells, brain, gill, heart, head kidney, intestine, kidney, liver, ovary, spleen, and late embryos with the RNAzol B kit (Biotecx, Houston, TX). Twenty mg of total RNA from each tissue was fractionated on 1% formaldehyde-agarose gel in MOPS buffer and transferred onto a Hy-bond-N membrane (Amersham Corp.). Following prehybridization for 1 h in 50% formamide, 53 SSC, 2% blocking reagent (Boehringer Mannheim), 0.1% N-laurylsarcosine, 0.02% SDS at 50 °C for 1 h, blots were hybridized with a polymerase chain reaction-generated digoxige-nin (DIG)-labeled cDNA probe for 20 h under identical conditions. Blots were washed twice for 5 min with 23 SSC containing 0.1% SDS at room temperature and twice for 15 min at 68 °C with 0.13 SSC containing 0.1% SDS. Detection of DIG signals was accomplished using the DIG luminescent detection kit (Boehringer Mannheim). The cDNA probe used for Northern blotting was synthesized by the polymerase chain reaction DIG probe synthesis kit (Boehringer Mannheim) with two primers derived from nephrosin sequence; F1, CGGAGCCGTCCTGTT-GAGGA (nucleotides 75–94) and R1, CCCCGTAAAGGAGTTTAGGCC (nucleotides 378 –397).
RESULTS
Purification of Nephrosin—During the perfusion of carp head kidney, the spontaneous release of proteins or leakage of proteins due to handling damage of the tissue tended to de-crease with time (data not shown). However, in response to a 50 mM potassium stimulation, higher amounts of protein were released by the carp head kidney (Fig. 1). The amounts of protein of 15, 23 (p23), 28, 64, and 70 kDa in the perfusate samples following the potassium treatment were elevated for 20 –30 min and then returned to a lower level. Using a zymo-graphic assay, we found that a proteinase activity was associ-ated with the electrophoretic mobility of p23. Therefore, we attempted to purify this secreted proteinase from carp head kidney. By sequential chromatography on a Reactive Blue 72-agarose (Fig. 2A) and a FPLC-Mono P column (Fig. 2B), we purified the 23-kDa proteinase to near homogeneity (Fig. 2C and Table I). N-terminal protein sequencing of this protein revealed a single sequence: NADPXTARRXKWRKSRNGLV-. The low recovery of nephrosin by the purification procedures was because we collected the fraction with the highest purity (0.6 M NaCl) only. However, by this purification scheme, the whole procedure can be accomplished within 10 days.
Substrate Specificity of Nephrosin—The proteolytic activity of nephrosin could be demonstrated using SDS-PAGE zymog-raphy with gelatin, RCM-BSA, or RCM-fibrin as a substrate-(data not shown). To determine the preference of cleavage sites by nephrosin, we examined various peptide-nitroanilides and peptides. None of the peptide-nitroanilides, including tosyl-GPK-NA, succinyl-AAPF-NA, succinyl-AAPL-NA and N-carbo-benzoxy-GGL-NA, were digested by nephrosin (Table II). Ob-viously, nephrosin did not hydrolyze the amide bond of these nitroanilides. However, nephrosin cleaved certain peptide bonds of synthetic substance P and Lys-bradykinin. When bra-dykinin derivatives of different length were tested for their digestion by nephrosin, it was found that there is a length TABLE I
Summary of purification of nephrosin from carp head kidney
Step Volume Protein Activitya Specific activity Yield Purification
ml mg units units/mg % -fold
Extractb 200 2207 119.2 0.054 100 1
Dye column 48 0.376 6.28 16.70 5.27 172
Mono-P 4 0.098 1.78 18.16 1.49 187
aOne unit of activity is defined as the amount of nephrosin causing the same proteolytic activity as 1 unit of chymotrypsin in the RCM-BSA
zymographic assay.
bA total of 20 g of carp head kidney was used in this preparation.
TABLE II
Digestion of synthetic peptide substrates by nephrosin
Substrates Sequencesa Hydrolysis
Tosyl-GPK-NA GPK NDb Suc-AAPF-NA AAPF NDb Suc-AAPL-NA AAPL NDb Cbz-GGL-NA GGL NDb Substance P RPKPQQ2FsFGLM-NH2 Complete Lys-Bradykinin KRPPG2FsSPFR Complete Bradykinin 1–5 RPPGF NDb Bradykinin 1–6 RPPGFS NDb Bradykinin 1–7 RP2PGFSP Partial Des-Arg-bradykinin PP2GFSPFR Complete
a2 indicates bonds cleaved by carp nephrosin, and s indicates major
cleavage site.
bND, nondetectable in 60 min.
TABLE III
Effect of proteinase inhibitors on the enzymatic activities of nephrosin The purified enzyme was preincubated with each reagent at the indicated concentration for 10 min at 0 °C and then with RCM-BSA for 1 h at 27 °C. Residual enzyme activities were calculated as the ratio of the amount of RCM-BSA digested in the presence of inhibitor to that in the absence of inhibitor.
Inhibitor Concentration Residual activity
mM % None 100 1,10-Phenanthroline 5 8.2 1.25 19 EDTA 5 26 2.5 35 Captopril 5 15 2.5 61 Diethyldithiocarbamate 5 6.2 2.5 23 Pepstatin 20 mg/ml 90 PMSF 5 100 Iodoacetate 10 70 5.5 67
at National Taiwan University on May 4, 2009
www.jbc.org
requirement for being a substrate. Nephrosin did not cleave the terminal peptide bonds of bradykinin 1–5 and bradykinin 1– 6. Among the digestible substrates, nephrosin cleaved at the Gln-Phe and Gln-Phe-Gln-Phe bonds of substance P and at the Gly-Gln-Phe and Phe-Ser bonds of bradykinin derivatives with a preference for phenylalanine at the P1 position and proline at the P2/P3/P4 position. Therefore, nephrosin mainly functions as an endopep-tidase with little exopependopep-tidase or amidase activity.
Effects of Proteinase Inhibitors—Various inhibitors were tested for their effects on nephrosin with RCM-BSA as a sub-strate (Table III). The chelating agents including 1,10-phenan-throline, EDTA, captopril, and diethyldithiocarbamic acid in-hibited the proteolytic activity of nephrosin to a great extent, especially 1,10-phenanthroline and diethyldithiocarbamic acid. Inhibitors of other classes of proteinases were ineffective. The results indicate that nephrosin is a metalloproteinase.
cDNA Cloning of Nephrosin—After screening 3 3 106 plaques with a polyclonal antiserum raised against purified nephrosin, one positive clone was isolated. The nucleotide se-quence and the deduced amino acid sese-quence are shown in Fig. 3. The clone has an insert of 1086 bp including 32 bp of the 59-untranslated region, an open reading frame of 821 bp, and 232 bp of the 39-untranslated region. The putative initiating ATG codon, which agrees with Kozak’s rule (27), is at nucleo-tide 33. The open reading frame is predicted to encode a protein of 273 amino acids, including a 19-amino acid signal peptide and a 56-amino acid propeptide. The N-terminal 20 amino acid residues determined from purified nephrosin matched with the deduced amino acid sequence. The deduced amino acid se-quence also confirms the presence of a propeptide sese-quence (see also sequence comparison data). The theoretical molecular mass of the mature protein is 23089.35 Da, which is close to the
estimated molecular mass from SDS-PAGE analysis.
Sequence Homology—The deduced amino acid of nephrosin shows moderate sequence identity (29 –52.5%) with members of the astacin family (Fig. 4) such as medaka HCE1 (52.5%), LCE (50.7%; Ref. 28), crayfish astacin (33.2%; Ref. 29), murine me-prin-a (34%; Ref. 30), and murine meprin-b (33.5%; Ref. 31). The N-terminal regions, including the signal peptide and propeptide sequences, are most variable. All members are likely to be secreted and further processed as evidenced by the presence of the signal and propeptide sequences. The junction for the propeptide and mature protein in nephrosin is at a similar position to that in other members. Stretches of highly conserved sequences were found, especially in the unique zinc binding motif, HEXXHALGFXHEXXRXDRD. From x-ray structural analyses of crayfish astacin (32), zinc ion is ligated by three histidine residues, one tyrosine residue, and one water molecule H-bonded to a glutamic acid residue. Five residues involved in the penta-coordination of zinc are conserved in all members. Most members of the family have extra domains C-terminal to the proteinase domain except crayfish astacin, medaka hatching enzymes, and carp nephrosin, which consist of only;200 amino acid residues in the mature forms.
Tissue Distribution—The presence of nephrosin in different tissues was examined by immunoblotting (Fig. 5) with a poly-clonal antiserum against purified nephrosin and by Northern blotting (Fig. 6) with nephrosin partial cDNA as a probe. Only samples of gill, kidney, head kidney, and spleen contained an immunoreactive protein of a similar molecular mass. Because of the limited distribution of nephrosin in the kidney, head kidney, and spleen, it was named nephrosin herein until we discover the true physiological functions of this metalloprotein-ase. The DIG-labeled cDNA probe for nephrosin hybridized FIG. 3. Nucleotide sequence and
predicted amino acid sequence of ne-phrosin. The open reading frame
en-codes a protein of 273 amino acids, includ-ing a 19-amino acid signal peptide and a 56-amino acid propeptide. Amino acid res-idues in boldface match with those deter-mined from purified protein. Potential N-glycosylation sites are indicated by squares.
Isolation and Sequence of Carp Nephrosin
13775
at National Taiwan University on May 4, 2009
www.jbc.org
with a single 1.2-kilobase band in all samples except intestine and ovary, and with highest levels in head kidney and kidney. This size of mRNA is in good agreement with that of nephrosin clone (1086 bp). The lack of a protein signal in heart extract is unusual, since its mRNA level was similar to that of spleen.
Absence of Nephrosin in Carp Embryos—Due to the highest sequence identity to medaka hatching enzymes (HCE2, HCE1, and LCE), we wish to determine whether nephrosin is a carp hatching enzyme. Soluble proteins and total RNA were pre-pared from 70-h embryos (a 80-h hatching procedure) and subjected to immunoblot and Northern blot analysis (Fig. 7). In addition, hatching liquid was also harvested after most em-bryos completed hatching. Using a comparable amount of pro-tein and RNA, both propro-tein and mRNA signals were observed in head kidney, but not in carp embryos or hatching liquid. Therefore, the data suggest that nephrosin is unlikely to be a hatching enzyme analogue, and that carp embryos at this stage expressed very little nephrosin, if any.
Secretion of Nephrosin—Release of immunoassayable ne-phrosin from carp head kidney fragments was measured us-ing an in vitro perfusion system. Fig. 8 shows the effect of potassium-induced secretion of nephrosin. Nephrosin and a degraded product of nephrosin were detected by immunoblot-ting following a 50 mM potassium treatment (Fig. 8, upper panel). The release of nephrosin was almost instantly follow-ing induction. The identity of nephrosin in the perfusate samples was confirmed by SDS-PAGE zymography (Fig. 8, lower panel). The release of nephrosin was not due to damage of the perfused tissue since lactate dehydrogenase activities in the perfusate samples were not changed during the perfu-sion experiment (data not shown). The results suggest that nephrosin is secreted by excitable cells in the head kidney in response to membrane depolarization caused by the potas-sium treatment.
DISCUSSION
Nephrosin is a new member of the astacin family of metal-loproteinases based on the following observations: First, the activity of nephrosin is inhibited by metal chelators but not by
inhibitors of other classes of proteinases, suggesting that it is a metalloproteinase. Second, cDNA encoding the purified protein was isolated from a carp head kidney cDNA library. One seg-ment of the deduced amino acid sequence matches perfectly with the first 20 amino acids determined from the purified nephrosin. Bacterially expressed protein encoded by the cloned cDNA can be recognized by the same antiserum used for im-munoscreening. In addition, the polyclonal antiserum raised against this recombinant protein recognized native nephrosin.2 Finally, the deduced primary structure of nephrosin resembles members of the astacin family. The most distinguished zinc-binding motif, HEXXHXXGFXHEXXRXDR, is also present in nephrosin. Astacin family members are all secreted proteinases containing a proteinase domain of approximately 200 amino acid residues (23 kDa). Most of the known members contain one or more copies of interaction domains such as EGF (epidermal growth factor)-like or CUB (complement/sea urchin EGF/ BMP-1) that are C-terminal to the proteinase domain (12). However, the mature form of nephrosin does not contain any extra sequences C-terminal to the proteinase domain as with astacin and hatching enzymes (HCE1, HCE2, and LCE).
From sequence comparisons, nephrosin is most closely re-lated to medaka hatching enzymes with .50% identity in amino acid sequence. Hatching enzymes are expressed in late stages of embryos in anticipation of hatching and can therefore be harvested from late embryos and hatching liquid (28, 33). However, we were not able to detect nephrosin in late embryos (mRNA and protein) or hatching liquid (protein). Therefore, the high degree of identity between nephrosin and medaka hatch-ing enzymes most likely results from the fact that they are the only sequences from teleost in the astacin family, but not that nephrosin represents a carp hatching enzyme.
Most members of the astacin family are involved in develop-mental processes. They are hatching enzymes of medaka in-volved in degrading the egg shell of embryos (28, 33, 34), hydra HMP1 in head regeneration and tentacle differentiation (35),
2H.-R. Huang and G.-D. Chang, unpublished results.
FIG. 4. Sequence comparison of members of the astacin family. Sequences of the proteinase domain of the astacin family members were aligned by Clustal W, version 1.6 (26). Alignments highlight residues that are in the majority for all sequences. Nep, nephrosin; LCE, medaka low choriolytic enzyme; HCE-1, medaka high choriolytic enzyme-1; QuCAM-1, quail chorioallantoic metalloproteinase-1; MuMep-a, mouse meprin-a; MuMep-b, mouse meprin-b; DrTlr-1, Drosophila Tolloid-related-1; DrTld, Drosophila Tolloid; HuBMP-1, human bone morphogenetic protein-1; SpAN, sea urchin SpAN; BP10, sea urchin blastula protease-10; HMP1, hydra metalloproteinase 1; astacin, crayfish astacin. The degree of overall identity to carp nephrosin is shown at the end.
at National Taiwan University on May 4, 2009
www.jbc.org
human BMP-1 in bone formation (36, 37), Drosophila Tolloid in dorsal-ventral pattern formation (38), and sea urchin BP10 and SpAN in differentiation of ectodermal lineages (39, 40). Few members of the astacin family are expressed in mature orga-nisms in a tissue-specific manner. For examples, crayfish as-tacin is synthesized in the crayfish hepatopancreas and func-tions as a digestive enzyme (41). Mammalian meprins are expressed as dimeric proteins (42, 43) in the brush border membranes of kidney and intestine (44, 45). Along with these limited precedents, nephrosin is expressed in the gill, head kidney, kidney, and spleen of mature carp. Although nephrosin and meprins are all present in the kidney, they are not iden-tical as suggested by differences in the primary structure and in the forms of mature protein (dimeric membrane protein versus monomeric soluble protein). In addition, meprin exhibits an arylamidase activity toward peptide-p-nitroanilide sub-strates (43) that are shown to be very poor subsub-strates for nephrosin.
Our data show that nephrosin is secreted from carp head kidney and its secretion can be regulated by manipulation of the membrane potentials. The fact that nephrosin is present in the kidney, head kidney, and spleen suggests a role of phrosin in the lymphohematopoietic system. Whether ne-phrosin is expressed by the immune system and/or by the hematopoietic system requires critical examinations. We are currently preparing antisera against proteins derived from both systems as cell type markers. Along with the antiserum against nephrosin, we may be in a better position to solve this problem by immunohistochemical staining procedures.
We speculate that expression of nephrosin at high levels in the lymphohematopoietic tissues suggests that the proteinase may function in ECM remodeling. One most striking feature pertaining to the tissues is the frequent migration of cells out of and into these sites (46). ECM proteins provide multiple inter-action domains mediating adhesion of cells and ECM (47). Although studies on proteolytic remodeling of ECM have been focused largely on matrix metalloproteinases (48), meprin (49), and HMP1 (35) of the astacin family are also effective in de-FIG. 5. Tissue distribution of nephrosin as revealed by
immu-noblotting. Proteins from various tissue extracts (10mg) were
electro-phoresed on a SDS-polyacrylamide gel and subjected to immunoblotting with an antiserum against purified nephrosin.
FIG. 6. Tissue distribution of nephrosin as revealed by
North-ern blotting. Total RNA (20mg) from different tissues were
fraction-ated on a 1% formaldehyde-agarose gel and blotted onto a Hybond-N membrane. The blot was hybridized with a DIG-labeled nephrosin cDNA probe and visualized with luminescent detection.
FIG. 7. Absence of nephrosin in the carp embryos. Protein (10 mg) from head kidney, 70-h embryos, and hatching liquid were electro-phoresed on a 7.5% gel and detected by immunoblotting (left panel). Total RNA (20mg) from head kidney and 70-h embryos were subjected to formaldehyde-agarose electrophoresis in the presence of ethidium bromide (middle panel), transferred to a Hybond-N membrane, and probed with a DIG-labeled nephrosin cDNA probe (right panel).
FIG. 8. Secretion of nephrosin from carp head kidney perfused
in vitro. After tissue was equilibrated with fish saline for 90 min, the
perfusate samples were collected for nine 10-min intervals. Perfusion medium was changed from normal fish saline to that containing 50 mM potassium for 20 min at the beginning of interval 2. The perfusate samples were analyzed by immunoblotting (upper panel) and by pro-teolytic zymograph (lower panel).
Isolation and Sequence of Carp Nephrosin
13777
at National Taiwan University on May 4, 2009
www.jbc.org
grading ECM proteins. In a preliminary experiment,3we also found that nephrosin was able to degrade mammalian fibronec-tin, but not laminin or type IV collagen. In addition, nephrosin can degrade mammalian gelatin in a SDS-PAGE zymographic assay. We are now repeating these experiments using carp ECM as substrates.
Acknowledgment—We are indebted to Dr. Chung-Ho Chang for crit-ical comments on this manuscript.
REFERENCES
1. Huang, F.-L., Ke, F.-C., Huang, J.-J., and Lo, T.-B. (1983) Arch. Biochem. Biophys. 225, 512–517
2. Balm, P. H., Lambert, J. D., and Wendelaar Bonga, S. E. (1989) Gen. Comp. Endocrinol. 76, 53– 62
3. Sangalang, G. B., and Uthe, J. F. (1994) Gen. Comp. Endocrinol. 95, 273–285 4. Gallo, V. P., Civinini, A., Mastrolia, L., Leitner, G., and Porta, S. (1993) Gen.
Comp. Endocrinol. 92, 133–142
5. Imagawa, T., Kitagawa, H., and Uehara, M. (1996) Anatomy 188, 149 –156 6. Zapata, A. (1979) Dev. Comp. Immunol. 3, 55– 65
7. Bengten, E., Leanderson, T., and Pilstrom, L. (1991) Eur. J. Immunol. 21, 3027–3033
8. Imagawa, T., Hashimoto, Y., Kon, Y., and Sugimura, M. (1991) Fish Shellfish Immunol. 1, 173–185
9. Koumans-van Diepen, J. C., Egberts, E., Peixoto, B. R., Taverne, N., and Bombout, J. H. (1995) Dev. Comp. Immunol. 19, 97–108
10. Imagawa, T., Hashimoto, Y., Kon, Y., and Sugimura, M. (1990) J. Fish Biol. 37, 357–366
11. Verburg-van Kemenade, B. M. L., Groeneveld, A., van Rens, B. T. T. M., and Rombout, J. H. W. M. (1994) J. Exp. Biol. 187, 143–158
12. Bond, J. S., and Beynon, R. J. (1995) Protein Sci. 4, 1247–1261 13. Levine, J. E., and Ramirez, V. D. (1986) Methods Enzymol. 124, 466 – 494 14. Koh, J. Y., and Choi, D. W. (1987) J. Neurosci. Methods 20, 83–90 15. Bradford, M. M. (1976) Anal. Biochem. 72, 248 –254
16. Scha¨gger, H., and von Jagow, G. V. (1987) Anal. Biochem. 166, 368 –379 17. Heussen, C., and Dowdle, E. B. (1980) Anal. Biochem. 102, 196 –202 18. Haspal, J., Bushell, G., and Ghosh, P. (1983) Anal. Biochem. 132, 288 –293 19. Huang, C.-J., Chen, C.-C., Chen, H.-J., Huang, F.-L., and Chang, G.-D. (1995)
J. Neurochem. 64, 1715–1720
20. Harlow, E., and Lane, D. (eds) (1988) Antibodies, pp. 471–510, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
21. Tsai, Y.-J., Chang, G.-D., Huang, C.-J., Chang, Y.-S., and Huang, F.-L. (1996) Comp. Biochem. Physiol. 113B, 573–580
22. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A
Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
23. Short, J. M., Fernandez, J. H., Sorge, J. A., and Huse, W. D. (1988) Nucleic Acids Res. 16, 7583–7600
24. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463–5467
25. Pearson, W. R., and Lipman, D. J. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 2444 –2448
26. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673– 4680
27. Kozak, M. (1987) Nucleic Acids Res. 15, 8125– 8148
28. Yasumasu, S., Yamada, K., Akasaka, K., Mitsunaga, K., Iuchi, I., Shimada, H., and Yamagami, K. (1992) Dev. Biol. 153, 250 –258
29. Titani, K., Torff, H. J., Hormel, S., Kumar, S., Walsh, K. A., Rodl, J., Neurath, H., and Zwilling, R. (1987) Biochemistry 26, 222–226
30. Corbeil, D., Milhiet, P. E., Simon, V., Ingram, J., Kenny, A. J., Bioleau, G., and Crine, P. (1993) FEBS Lett. 335, 361–366
31. Gorbea, C. M., Marchand, P., Jiang, W., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., and Bond, J. S. (1993) J. Biol. Chem. 268, 21035–21043 32. Bode, W., Gomis-Ru¨ th, R. F., Huber, R., Zwilling, R., and Sto¨cker, W. (1992)
Nature 358, 164 –167
33. Yasumasu, S., Katow, S., Hamazaki, T., Iuchi, I., and Yamagami, K. (1992) Dev. Biol. 149, 349 –356
34. Lee, K. S., Yasumasu, S., Nomura, K., and Iuchi, I. (1994) FEBS Lett. 339, 281–284
35. Yan, L., Pollcok, G. H., Nagase, H., and Sarras, M. P., Jr. (1995) Development 121, 1591–1602
36. Wozney, J. M., Rosen, V., Celeste, A. J., Mitsock, L. M., Whitters, M. J., Kriz, R. W., Hewick, R. M., and Wang, E. A. (1988) Science 242, 1528 –1531 37. Takahara, K., Lyons, G. E., and Greenspan, D. S. (1994) J. Biol. Chem. 269,
32572–32578
38. Shimell, M. J., Ferguson, E. L., Childs, S. T., and O’Connor, M. B. (1991) Cell 67, 479 – 481
39. Lepage, T., Ghiglione, C., and Gasche, C. (1992) Development 114, 147–164 40. Reynolds, S. D., Angerer, L. M., Palis, J., Nasir, A., and Angerer, R. C. (1992)
Development 114, 769 –786
41. Vogt, G., Sto¨cker, W., Storch, V., and Zwilling, R. (1989) Histochemistry 91, 373–381
42. Butler, P. E., McKay, M. J., and Bond, J. S. (1987) Biochem. J. 241, 229 –235 43. Johnson, G. D., and Hersh, L. B. (1992) J. Biol. Chem. 267, 13505–13512;
Correction (1993) J. Biol. Chem. 268, 17647
44. Barnes, K., Ingram, J., and Kenny, A. J. (1989) Biochem. J. 264, 335–346 45. Yamaguchi, T., Kido, H., Kitazawa, R., Kitazawa, S., Fukase, M., and
Katunuma, N. (1993) Biochemistry 113, 299 –303 46. Springer, T. A. (1994) Cell 76, 301–314
47. Shimizu, Y., and Shaw, S. (1991) FASEB J. 5, 2292–2299 48. Birkedal-Hansen, H. (1995) Curr. Opin. Cell Biol. 7, 728 –735
49. Kaushal, G. P., Walker, P. D., and Shah, S. V. (1994) J. Cell Biol. 126, 1319 –1327
3G.-D. Chang, unpublished results.
at National Taiwan University on May 4, 2009
www.jbc.org