Carp gamma-crystallins with high methionine content: Cloning and sequencing of the complementary DNA

226 Iliochmm-a ct th,phv.~, a -I, ta. t~51 I 1 9 ~ ) 22(~ 22t* lb, e~ tc~

BBA 90122 BBA Report

Carp gamma-crystallins with high methionine content:

cloning and sequencing of the complementary. DNA

Tschining Chang. Yun-Jin Jiang, Shyh-Horng Chiou and Wen-Chang Chang

Instttute of Btochemical Sou, noes, Nattonal Taiwan Umversttv and Instttute of Btologtcal( "hemtstrv. Academta .~'ltlt('~g,

"l'aipe, ¢ Taiwan, ('hina)

(Received 16 May 19881

(Revised manuscript received 11 August 1988)

Key words: "£-('rystallin: c l ) N A : A m i n o acid sequence: Methionine content: Sequence homology: I ) N A sequence: ( ('. carpts )

The nucleotide sequences of 3,-crystallin cDNAs cloned from the common carp

((_)'prinus carpio)

have been determined. The amino-acid ~ q u e n c e s derived consist of two polypeptides with 177 and 172 amino-acid residues for y-ml and ~,-m2, respectively. They exhibit unusually high methionine contents: 12.4% for ~,-ml and 14% for ~,-m2. Comparison of both fish 3,-crystallins with bovine y-ll crystallin reveals that they are similar in structure. The striking features of both fish ":,-c~'stallins are as follows. (i) Both of them retain the 'conserved' residues, i.e., Tyr-6, Glu-7, Gly-13, Ser-34 and their equivalents in other motifs. (2) they possess the second aromatic residue at position I 1. Both of these structural features are considered to be the major factors in stabilizing the folded hairpin structure of the protein. (3) The variable residues in the core region of C-terminal domain are almost all sulfur-containing amino acids, i.e., methionine or cysteine. (4) 3t)% of the surface hydrophobic groups are composed of methionine. The last two unusual features have been found so far only in these two fish y-crystallins. The high methionine content may make an important contribution to the protein stability, of fish ~,-crystallins.

The eye lenses of vertebrates form a complex conundrum of protein evolution as judged by the abundant presence of various common and specific classes of structural proteins, i.e., lens crystallins, in different species of vertebrates [1 ]. Lens crystal- lins comprisc several major classcs of proteins with various extents of heterogeneity [2,3]. Recent progress in recombinant-DNA techniques has

The sequence data in this paper have been submitted to the E M B L / G e n b a n k Data Libraries under the accession numbers X12902 ( y - m l ) and X12903 (~,-m2).

Correspondence: W.('. ('hang. Institute of Biological Chem- istry, Academia Sinica, P.O. Box 23-106. Taipei. Taiwan, Re- public of ('hina.

facilitated the elucidation of gene structures and their corresponding protein sequences from several different species [4--7]. The comparison of amino- acid compositions of ),-crystatlins from different species reveals a high methionine content in aquatic lens crystallins [8]. In this study, we report the nucleotide sequences of two c D N A s encoding the major y-crystallin polypeptides of high methionine content. These polypeptides are of un- usual amino-acid composition compared to other y-crystallins from higher vertebrates and they complement our previous sequence characteriza- tion of another closely related carp /3~ crystallin gene [9].

The e D N A library of carp lenses was con- structed as described previously [9] with the cx- 0 1 6 7 - 4 7 8 1 / 8 8 / $ 0 3 . 5 0 " 1988 Elsevier Science Publishers B.V. (Biomedical Division)

227

ception of using dG-tailed p U C 1 9 as vector. Posi- tive colonies were selected by the m e t h o d of Southern blotting [10] with carp /3., [9] fragment (nucleotide residues 5 6 - 4 3 0 ) as probe. O n e of the

positive clones, pC18, was sequenced and f o u n d to contain 14 A T G c o d o n s in frame (data not shown). T h e pC18 was treated with B a m H I a n d HinfI to cut off the d G . d C h o m o p o l y m e r together with

CARP Y-m1

CARP Y-m2 G13 CTGAAGCACTGAGATAAACAACCCTCTACCATC _{Gll TGGCCC}

ATGGGCAAGATCATCTTCTACGAGGACAGGAACTTCCAGGGCCGCAGCTATG ATG---AAGGTCACCTTTTATGAGGACAGGAACTTCCAGGGTCGCTCTTATG ACTGCATGAGCGACTGCTCTGATATCTCCTCTTACCTCAGCCGCGTTGGTTC ACTGTATGAGCGACTGTGCCGATTTCTCCTCCTACATGAGCCGCTGTCACTC AATCAGGGTGGAGAGTGGTTGTTTCATGGTCTATGAGCGCAACAGCTACATG TTGCAGAGTGCACAGCGGATGCTGGATGATGTACGATCAACCCAACTACATG GGGAACCAGTTCTTCCTGAGGAGGGGCGAGTACCATGATATGCAGCGCATGA GGAAATCAGTATTTCTTTAGGAGGGGAGAGTATGCTGATTACATGTCTATGT TGAGCATGGGCATGATGTTTGACACTATCAGATCCTGCCGCATGATTCCTCC TTGGAATGAGC ... AACTGCATCAGGTCCTGCCGTATGATCCCTAT ATACAGGGGTTCCTACAGAATGAGGATCTACGAGAGGGACACCTTCGGAGGA GCACAGGGGATCCTACAGAATGAGGATCTACGAGAGGGAGAACTTCATGGGC CAGATGCACGAGGTGATGGATGACTGTGACAACATCATGGAACGTTACCGTA CAGATGTACGAAATGGCCGATGACTGTGACAGTATCATGGACCGTTACCGCA TGTCTGACTGGCAGTCTTGTCATGTGATGGACGGCCACTGGCTCTTCTATGA TGCCTCACTGCCAGTCCTGCCATGTGATGGACGGCCACTGGCTCATGTATGA GCAGCCACACTACAGAGGCAGAATGTGGTACTTCAGGCCTGGAGAGTACAGG GCAGCCCCACTACAGAGGCAGGATGTGGTACTTCAGGCCTGGAGAGTACAGG AGCTTCAGAGATATGGGATACAGCAACATGAGATTCATGAGCATGAGGCGTA AGCTTCAGCAATATGGGTGGA ... ATGAGATTCATGAGCATGAGGCGTA T C A C T G A T A T G T G T - - - ~ A C T G C T A G A A T A T A G A A G G ~ A A A G T G T T A T C A T G G A C T C C T G G T A C ~ J A G T T T A T A T T ~ T ~ A T A A C T C C T C 1 9 TTCTCAGAACTA1 4

Fig. 1. Comparison of cDNA sequences for carp 7-rot and 7-m2 crystallins. The sequences are aligned according to their corresponding amino-acid sequence. The stop codons for the longest open reading frame are blocked. Polyadenylation signals for

228

poly(A) stretches. The resultant ATG-rich D N A fragment was used as probe to re-screen the c D N A library. Two of the positive clones, y - m l and "/-m2, which carry full-sized c D N A , were sub- jected to sequence determination by chemical [11] or supercoil sequencing [12] methods. The com- plete nucleotide sequence is shown in Fig. 1. Not counting the d G . d C homopolymer, the total length of "y-ml is 627 base-pairs (bp) and "/-m2 is 550 bp (Fig. 1). The 5' noncoding region of y - m l upstream from the initiation A T G codon consists of 33 nucleotides and the sequences flanking the A T G codon are consistent with the consensus sequence (purine-X-X-A-T-G-G). However, "/-m2 has only 6 nucleotides upstream from the first A T G codon and lacks the consensus sequence. The possibility that 3,-m2 is part of a ,8-crystallin gene cannot be ruled out, since no information about fish ,8-crystallin is available at the present time.

In the 3' noncoding region we found the poly- adenylation signal, A A T T A A A , in y - m l which is dissimilar to the c o m m o n sequence of A A T A A A for "/-m2, carp ,8,, calf ,8~ and calf 7-1I [9,13,14]. It is noteworthy that at 5'-end of y-m2 there is a deletion of G G C codon for glycine just after the

initiation codon as compared to y - m l . The de- rived amino-acid sequences are shown in Fig. 2.

The homology of the coding sequence between these two e D N A is 75%. which is lower than those of other known m a m m a l i a n y-crystallins of the same species, i.e., 84g~ for human [18] and 86% for mouse [16], but similar to that of frog. 69q: [17]. The homology of the derived amino-acid se- quences is also lower. 73% for carp (Fig. 3). 79c,: for human [15] and 81% for mouse [16]. If y-tnl is used as reference for comparison, the sequence of "y-m2 reveals much more deletions than other known m a m m a l i a n and amphibian 7-crystallin genes. The possibility remains that the carp 7- crystallin gene has follow an evolutionary pathway different from that of higher species, but this hypothesis would be proved only when the ge- home sequence of fish y-crystallin gene become available.

The fish y-crystallins reported here contain the unusually high content of methionine (12.,!,% for y-ml and 14% for y-m2) m amino-acid composi- tions, similar only to haddock y-crystallin fraction IV (20.9%) [18] and the invertebrate crystallin of squid lens (12.5%) [8]. Both the N-terminal and ('-terminal segments of carp crystallin are almost

C A R P Y - m l C A R P Y - m 2 C A L F Y-II G K I I F Y E D R N F Q G R S Y D C M S D C S D I S S Y L S K V T F Y E D R N F Q G R S Y D C M S D C A D F S S Y M S G K I T F Y E D R G F Q G H C Y E C S S D C P N L Q P Y F S 10 20 30 R V G S I R V E S R C H S C R V S H R C N S I R V D S M O T I F 1 Y R M R I Y E R D N F G G Q M H E V M D D C D N I M E R Y R M S Y R M R I Y E R E N F M G Q M Y E M A D D C D S I M D R Y R M P F R M R I Y E R D D F R G Q M S E I T D D C P S L Q D R F H L T 90 i 0 0 i i 0 D W Q S C H V M D H C Q S C H V M D E V H S L N V L E 1 2 0 G C F M V Y E R N S Y M G N Q F F L R R G E Y H D M Q R M M S M G M M F D T I R S C R M I P G C W M M Y D Q P N Y M G N Q Y F F R R G E Y A D Y M S M F G M S N C I R S C R M I P G C W M L Y E R P N Y Q G H Q Y F L R R G D Y P D Y Q Q W M G F N D S T R S C R L I P 40 50 60 70 80 M O T I F 3 M O T I F 2 G H W L F Y E Q P H Y R G R M W Y F R P G E Y R S F R D M G Y S N M R F M S M R R I T D M C G H W L M Y E Q P H Y R G R M W Y F R P G E Y R S F S N M G G - - M R F M S M R R I M D S W Y M O T I F 4 G S W V L Y E M P S Y R G R Q Y L L R P G E Y R R Y L D W G A M N A K V G S L R R V M D F Y 130 140 1 5 0 160 1 7 0

Fig. 2. Comparison of the carp y-m], y-m2 and calf y-I! crystallins. Protein sequences are shown in the single-letter amino-acid code. The sequences are displayed by placing motif 1 on top of motif 3 and motif 2 on top of motif 4 so that topologically equivalent

the same as that of reported for haddock, as shown below:

carp H 2N-G-K-I-I-F-Y-E-D- ; -I-T-D-M-C-COOH

haddock H 2N-G-K-I-T-F-Y-E-D-; -I-T-D-M-C-COOH However, there is no apparent homology between the N-terminal segments of carp and squid crystal- lins [19]. It is a prerequisite to obtain the primary sequences of squid crystallin in order to have an unequivocal comparison of phylogenetic relation- ship between the vertebrate and invertebrate crys- tallins.

Compared with the amino-acid sequence of calf T-II, both -/-ml and T-m2 were found to retain the conserved residues, i.e., Tyr-6, Glu-7, Gly-13, Ser- 34 and their equivalents in the other three motifs. Those residues are important in stabilization of the folded hairpin of T-crystallins [20,21]. They also possess a second aromatic residue ( P h e - l l ) which packs against the conserved Tyr to stabilize the structure further. In both T-ml and "/-m2, these solvent-exposed aromatic and its nearby re- sidues in the tertiary structure are also conserved, i.e., sheet 1: Arg-36, P h e - l l ; sheet 2: Arg-79, Asp-21, Tyr-50; sheet 3: Arg-152, Glu-150, Phe-98 and sheet 4: Arg-168, Asp-108, Tyr-139 [22]. Since the putative disulfide bond, Cys-18-Cys-22, is also retained, together with those structure maintaining factors mentioned above, both T-ml and T-m2 should assume the similar tertiary structure of calf T-II crystallin. Both T-ml and T-m2 have a penta- peptide connector between motif 2 and motif 3. They also have a dipeptide extension for T-ml and tripeptide extension for y-m2 at the C- terminus. All of these are unique features of T- crystailins. Since the T-ml and T-m2 crystallins (Fig. 2) have revealed the similar features of mam- malian T-crystallins, it is very likely that both of them are major components of carp T-crystallin family.

The most unusual feature of both carp T-crys- tallins is the distribution of some hydrophobic residues on the surface and in their core structure. In the core structure, the N-terminal domain is more conserved. But around the variable residues in the C-terminal domain are almost sulfur-con- taining amino acids: Met-90, Met-105/106, Met- 113, Cys-121, Cys-124, Met-165, Met-167. Also, 30% of the surface hydrophobic groups are com-

229 posed of methionine: Met-68, -69 (T-m1), -71, -80, -99 (-/-m2), -102, -118, -127. Because the core region is usually composed of hydrophobic re- sidues and aromatic groups, interaction of the polarizable moieties between aromatic groups and methionines might exist. If so, they may contrib- ute significantly to the protein stability [22]. The crystal-structure study of carp T-crystallin should shed some light on the function of those methionine residues in the protein.

References

1 De Jong, W.W. and Hendriks, W. (1986) J. Mol. Evol. 24, 121-129.

2 Blocmendal, H. (1985) Exp. Eye Res. 41,429-448. 3 De Jong, W.W. (1981) in Molecular and Cellular Biology of

the Eye Lens 9Bloemendal, H., ed.), pp. 221-278, John Wiley & Sons, New York.

4 King, C.R., Shinohara, T. and Piatigorsky, J, (1982) Science 215. 985-987.

5 Yasuda, K., Kondoh, H., Okada, T.S., Nakajima, N. and Shimura, Y. (1982) Nucleic Acids Res. 10, 2879-2891. 6 Tomarev, S.I., Zinovieva, R.D., Chalovka, P., Krayev, A.S.,

Skryabin, K.G. and Gause, G.G., Jr. (1984) Gene 27. 301-308.

7 Den Dunnen, J.T., Moormann, R.J.M., Lubsen, N.H. and Schoenmakers, J.G.G. (1986) J. Mol. Biol. 189, 37-46. 8 Chiou, S.-H. (1986) FEBS Lett. 201.69-73.

9 Chang, T. and Chang, W.-C. (1987) Biochim. Biophys. Acta 910, 89-92.

10 Southern, E. (1975) J. Mol. Biol. 98, 503.

11 Maxam, A.M. and Gilbert, W. (1977) Proc. Natl. Acad. Sci. USA 74, 560-564.

12 Chen, E.Y. and Seeburg, P.H. (1985) DNA 4, 165-170. 13 Bhat, S.P. and Spector, A. (1984) DNA 3, 287-295. 14 Quax-Jeuken, Y., Driessen, H., Leunissen, J., Quax, W.. De

Jong, W. and Bloemendal, H. (1985) EMBO J. 4, 2597-2602. 15 Meakin, S.O., Breitman, M.L. and Tsui, L.-C. (1985) Mol.

Cell. Biol. 5, 1408-1414.

16 Breitman, M.L., Lok, S.. Wistow, G., Piatigorsky, J.. Tre-

ton, T.A., Gold, R.J.M. and Tsui, L.-C. (1984) Proc. Natl. Acad. Sci. USA 81, 7762-7766.

17 Tomarev, S.I., Zinovievz, R.D., Chalovka, P., Krzyev, A.S., Skryabin, K.G. and Gause, G.G., Jr. (1984) Gene 27, 301-308.

18 Croft, L.R. (1973) Biochim. Biophys. Acta 295, 174-177. 19 Chiou, S.-H., Chang, W.-C., Pan, F.-M., Chang, T. and Lo.

T.-B. (1987) J. Biochem. (Tokyo) 101,751-759.

20 Wislow, G., Turnell, B., Summers, L., Slingsby, C., Moss, D., Miller, L., Lindley, P. and Blundell, T, (1983) J. Mol. Biol. 170, 175-202.

21 Summers, L.J., Slingsby, C., Blundell, T.L., Den Dunnen,

J.T., Moormann, R.J.M. and Schoenmakers, J.G.G. (1986) Exp. Eye Res. 43, 77-92.

22 Bodner, B.L., Jaekman. L.M. and Morgan, R.S. (1977)