Paraquat increases connective tissue growth factor and collagen expression via angiotensin signaling pathway in human lung fibroblasts.

(1)

Other uses, including reproduction and distribution, or selling or

licensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of the

article (e.g. in Word or Tex form) to their personal website or

institutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies are

encouraged to visit:

(2)

Paraquat increases connective tissue growth factor and collagen expression via

angiotensin signaling pathway in human lung ﬁbroblasts

Jai-Nien Tung

a

, Yaw-Dong Lang

b

, Leng-Fang Wang

c,1

, Chung-Ming Chen

d,*,1 a

Department of Surgery, Tungs’ Taichung MetroHarbor Hospital, Taichung, Taiwan

b

Graduate Institute of Medical Sciences, Taipei Medical University Hospital, Taipei, Taiwan

c

Department of Biochemistry, College of Medicine, Taipei Medical University, Taipei, Taiwan

d

Department of Pediatrics, Taipei Medical University Hospital, Taipei, Taiwan

a r t i c l e

i n f o

Article history:

Received 9 July 2009 Accepted 17 December 2009 Available online 24 December 2009 Keywords:

Angiotensin Collagen

Connective tissue growth factor Saralasin

a b s t r a c t

Survivors of paraquat poisoning are left with pulmonary fibrosis which results in a restrictive type of long-term pulmonary dysfunction. Connective tissue growth factor (CTGF) is a key growth factor that ini-tiates tissue repair and underlies the development of lung fibrosis. Angiotensin (ANG) II may induce CTGF expression in the heart and kidney and plays an important role in the pathogenesis of lung fibrosis. The biological effects of ANG II are mediated by ANG II type 1 receptor (AT1R) and AT2R. The aims of this study were to investigate the effects of paraquat on ANG II, ANG II receptors, CTGF, and collagen expres-sions and to assess the role of ANG II receptors in paraquat-induced collagen synthesis in human lung fibroblasts (MRC-5). MRC-5 cells were incubated with various concentrations of paraquat with or without the ANG II receptor antagonist, saralasin. Paraquat increased ANG II production and AT1R mRNA and pro-tein expression and decreased AT2R mRNA expression. Furthermore, paraquat treatment increased CTGF and collagen mRNA and protein expression in a dose-dependent manner and saralasin inhibited these effects. These results indicate that paraquat increases CTGF and collagen expression by activating angio-tensin signaling pathway in human lung fibroblasts.

1. Introduction

Paraquat dichloride (1,10_{-dimethyl-4,4}0_{-bipyridilium dichloride;}

methyl viologen) is an effective and widely used herbicide. The intentional and accidental ingestion of commercial liquid formula-tions of paraquat has caused a large number of human fatalities in Taiwan during 1985 and 1997 (Satoh and Hosokawa, 2000). The lungs are one of the primary target organs in paraquat-induced toxicity in rats and humans (Chen and Lua, 2000; Dinis-Oliveira

et al., 2008). The acute toxic effects of paraquat are pulmonary

ede-ma, hypoxia, and respiratory failure. Survivors of paraquat poison-ing may be left with pulmonary ﬁbrosis which results in a restrictive type of long-term pulmonary dysfunction (Yamashita

et al., 2000).

Connective tissue growth factor (CTGF) is an important growth factor that initiates lung tissue repair and ﬁbrosis (Bogatkevich

et al., 2008). CTGF is a member of the CCN (CTGF, Cyr61/Cef10,

Nov) family and was originally identified in conditioned media from human umbilical vein endothelial cells and mice fibroblasts; it has been implicated in fibroblast proliferation, cellular adhesion, angiogenesis, and extracellular matrix synthesis (Moussad and

Brigstock, 2000). Angiotensin (ANG) II induces CTGF expression in

the heart and kidney (Finckenberg et al., 2003; Rupérez et al., 2003) and plays an important role in the pathogenesis of lung ﬁbro-sis (Marshall et al., 2004). The biological effects of ANG II are med-iated by its interaction with two distinct high-afﬁnity G protein-coupled receptors now designated ANG II type 1 receptor (AT1R) and AT2R (DeGasparo et al., 2000). Most physiological and patho-physiological effects of ANG II are mediated via the AT1R (Iwanciw

et al., 2003). Although CTGF has been reported to play a role in

pul-monary ﬁbrosis induced with bleomycin and hyperoxia (Lasky

et al., 1998; Bonniaud et al., 2003; Chen et al., 2007), its relationship

with ANG II has not yet been conﬁrmed in paraquat-induced colla-gen production. The aims of this study were to investigate the ef-fects of paraquat on ANG II, ANG II receptors, CTGF, and collagen expressions and to assess the role of ANG II receptors in para-quat-induced collagen synthesis in human lung ﬁbroblasts.

Abbreviations: ANG, angiotensin; ATR, ANG II receptor; CTGF, connective tissue growth factor; MTT, 3-(4,5-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide.

*Corresponding authors. Present address: Department of Pediatrics, Taipei Medical University Hospital, Taipei 110, Taiwan. Tel.: +886 0 27372181; fax: +886 0 27360399.

E-mail address:[email protected](C.-M. Chen).

1

These authors contributed equally to this work.

Contents lists available atScienceDirect

Toxicology in Vitro

(3)

2. Materials and methods 2.1. Cell culture

MRC-5 cells (human lung ﬁbroblasts; ATCC, Manassas, VA, USA) were maintained in Dulbecco’s minimal essential medium (DMEM, GIBCO Invitrogen Life Technologies, Grand Island, NY, USA) supple-mented with 100 U/ml penicillin, 100

l

g/ml streptomycin, and 10% heat-inactivated fetal calf serum (FCS; GIBCO Invitrogen Life Tech-nologies), and incubated at 37 °C in 5% CO2. Fibroblasts between

passages 25 and 35 were used for all experiments. For collagen expression induced by paraquat, 50

l

g/ml ascorbic acid and 50

l

g/ml b-aminopropionitrile fumarate (Sigma–Aldrich, Saint Louis, MO, USA) were added to the culture medium. Cells were grown to conﬂuence and then incubated in fresh medium with 0.2% fetal calf serum for 24 h, followed by administration of para-quat at indicated concentrations for 48 h. The cytotoxic effects of paraquat on incubated MRC-5 cells were measured using the 3-(4,5-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Mosmann, 1983) over a range of doses (100–900

l

M) for 48 h. The cell viability was maintained at 90% below 500

l

M paraquat, but decreased signiﬁcantly above 700

l

M paraquat. Therefore, paraquat concentrations between 0 and 500

l

M were used in this study. In order to verify the role of ANG II receptor sig-naling in paraquat-induced collagen synthesis, saralasin (10

l

M) was added 1 h before paraquat treatment. The dose has been shown to inhibit ANG II-induced extracellular matrix production in mesangial cells (Davis et al., 2008). The conditioned media were used to determine ANG II and collagen concentration, while the cell pellets were used to examine gene expression by quantitative RT-PCR and protein expression by Western blot.

2.2. ANG II levels

The ANG II in culture supernatant was measured by an ELISA kit (Phoenix Pharmaceuticals, Burlingame, CA, USA). The standards or samples were incubated with anti-ANG II antibody and biotinyla-ted ANG II, the bound biotinylabiotinyla-ted ANG II was reacbiotinyla-ted with strep-tavidin-horseradish peroxidase using tetramethyl benzidine and hydrogen peroxide as a substrate. The reaction was terminated by the addition of hydrogen chloride and absorbance was mea-sured at 450 nm.

2.3. Quantitative RT-PCR

The abundance of mRNA was determined by reverse transcrip-tion, followed by real-time PCR using appropriate primers (Table 1). Total cellular RNA was isolated with TRIzol (Invitrogen Life technologies). DNAse-treated RNA samples were reverse tran-scribed with poly (dT) primers using a ﬁrst-strand cDNA synthesis

kit (GE Healthcare, Piscataway, NJ, USA). Gene expression was quantiﬁed by SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and carried out using the ABI Prism 7300 Se-quence Detection System. The relative quantiﬁcation of gene expression was normalized to 18S rRNA as internal standard. Trip-licate experiments were done for each sample.

2.4. Immunoﬂuorescence assay

MRC-5 cells were ﬁxed in PBS with 4% formaldehyde and per-meabilized with 0.1% Triton X-100. The ﬁxed cells were incubated with an anti-AT1R polyclonal antibody (1:200, Abcam Inc., Cam-bridge, MA, USA), then indirect immunolabeling was performed by incubation with a Cy3-conjugated anti-mouse IgG antibody (1:200, Zymed). 40_{,6-Diamidino-2-phenylindole (DAPI,}

Sigma–Al-drich) was used for nuclear staining. Images of marked cells were visualized using a ﬂuorescence microscope (Leica Microsystems, Exton, PA, USA).

2.5. Western blot analysis

In total, 50

l

g of protein was separated on a 12% SDS–PAGE and transferred to a polyvinylidene ﬂuoride membrane. The primary antibodies used in this study were rabbit anti-AT1R (Abcam, 1:1000), rabbit anti-CTGF (Abcam, 1:1000) and mouse anti-b-actin (1:100,000; Sigma–Aldrich). After incubation with the primary antibody, the membranes were probed with the appropriate horse-radish peroxidase-conjugated secondary antibody (anti-mouse or anti-rabbit, 1:20,000; Pierce, Rockford, IL, USA). Immune com-plexes were visualized using ECL plus detection reagents (Pierce). Quantitative comparison of the ﬂuorescent images was achieved with a densitometer. Densitometric analysis was performed to measure the intensity of Western blot bands using AIDA software (Advenced Image Data Analyzer; Raytest Izotopenmessgeraete, Straubenhardt, Germany).

2.6. Collagen measurement

Total soluble collagen was measured in cultured supernatant using the Sircol Collagen Assay Kit (Biocolor, Belfast, UK). Brieﬂy, 0.3 ml of Sirius red reagent was added to an equal volume of test sample and mixed. The collagen–dye complex was dissolved in 0.5 M sodium hydroxide; the absorbance was measured at 540 nm. The collagen level in each specimen was obtained as an average of three readings.

2.7. Statistical analysis

Data are expressed as the mean ± SD. Differences among groups were evaluated by one-way ANOVA with post hoc Sheffe’s test. A p value of <0.05 was considered statistically signiﬁcant.

3. Results

3.1. Paraquat induces ANG II production and ANG II type I receptor (AT1R) mRNA and protein expression and reduces AT2R mRNA expression

Forty-eight hours after paraquat treatment, the ANG II levels and AT1R mRNA and protein expression increased, while AT2R mRNA expression decreased in a dose-dependent manner, and the values were signiﬁcantly higher or lower in 100, 300, and 500

l

M paraquat-exposed cells when compared with the 0

l

M paraquat-exposed control, respectively (Fig. 1).Fig. 1A and B shows that ﬁbroblasts incubated 48 h with 100, 300, 500

l

M paraquat

re-Table 1

Primers used for RT-PCR.

Primer Sequence 50_?₃0 _{Accesion No.}

AT1R 1422_{ATCCACCAAGAAGCCTGCAC}1441 _{NM_000685} 1533 TGAAGTGCTGCAGAGGAATG1514 AT2R 417 CCTCGCTGTGGCTGATTTACTCCTT441 NM_000686 517 CTTTGCACATCACAGGTCCAA497 Collagen I 1310 GTGCTAAAGGTGCCAATGGT1329 NM_000088 1437 ACCAGGTTCACCGCTGTTAC1418 Collagen III 4413 AACACGCAAGGCTGTGAGACT4433 NM_000090 4500_{GCCAACGTCCACACCAAATT}4481 CTGF 729 TTAGAGCCAACTGCCTGGTC748 NM_001901 828 CAGGAGGCGTTGTCATTGGTA808 18S rRNA 70 GGACACGGACAGGATTGACA89 AJ_844646 119 ACCCACGGAATCGAGAAAGA100

(4)

sulted in 0.5-, 1-, and 2-fold increase in ANG II level and 4-, 6-, and 7-fold increase in AT1R mRNA expression, respectively (all p < 0.001).

3.2. Immunofluorescent analysis of AT1R in human lung fibroblasts The immunostaining assay for AT1R was performed to assess its expression and cellular localization in the fibroblast cultures. Expression of AT1R and assumption of a fibroblast-like morphol-ogy was induced in MRC-5 monolayer exposed to paraquat (0– 500

l

M) for 48 h (Fig. 2). Immunoﬂuorescence microscopy shows that AT1R was diffusely and uniformly distributed on the cell sur-face and in the cytoplasm. The immunoreactivity of AT1R increased as the paraquat dosage increased.

3.3. Paraquat induces CTGF mRNA and protein expression and saralasin inhibits these effects

CTGF mRNA expression signiﬁcantly increased at 300 and 500

l

M paraquat-treated cells for 48 h when compared with 0

l

M paraquat-exposed controls (p < 0.01 and p < 0.001, respec-tively) and the addition of 10

l

M saralasin decreased CTGF mRNA expression (Fig. 3A). Paraquat treatment also signiﬁcantly in-creased CTGF protein expression at doses of P100

l

M (p < 0.001) and saralasin completely inhibited its expression (Fig. 3B). 3.4. Paraquat increases collagen type I and III mRNA expressions and total collagen content and saralasin inhibits these effects

The experiments were performed to determine whether the ﬁbroblast cultures respond to stimulation with paraquat by increasing collagen synthesis. Paraquat increased collagen type I and III mRNA expression and total collagen content after 48 h exposure (Fig. 4). The effects of paraquat on collagen expression

were observed at doses of P100

l

M tested ﬁbroblast cultures (p < 0.001). The concentration-dependent increase in paraquat-stimulated collagen mRNA expression and total collagen content was reduced in cells treated with saralasin, compared with cells that were treated with paraquat alone.

4. Discussion

Paraquat may cause acute respiratory distress syndrome and the final clinical course is characterized by collagen deposition and pulmonary fibrosis that lead to reduced expansibility and vital capacity, and eventually impaired gas exchange. Death usually oc-curs due to respiratory failure (Dinis-Oliveira et al., 2008). Survi-vors of paraquat poisoning may be left with a restrictive type of long-term pulmonary dysfunction (Yamashita et al., 2000). The sig-naling pathway that leads to pulmonary fibrosis is not clear. This study showed the existence of an ANG II and CTGF pathway in paraquat-induced collagen production, which is sensitive to sarala-sin. This evidence supports a functional role for ANG II receptor antagonist in the treatment of paraquat-induced lung fibrosis.

ANG II was formerly described as a potent vasoconstrictor; it is now recognized as a profibrotic and plays a role in the pathogene-sis of pulmonary fibropathogene-sis (Marshall et al., 2004; Otsuka et al., 2004). ANG II can be generated locally in lung tissues and may have auto-crine and paraauto-crine actions at the cellular level (Filippatos et al., 2001). The biological effects of ANG II are mediated by its interac-tion with two distinct high-affinity G protein-coupled receptors now designated AT1R and AT2R (DeGasparo et al., 2000). Most physiological and pathophysiological effects of ANG II are medi-ated via the AT1R (Iwanciw et al., 2003). Immunohistochemical studies have demonstrated that AT1R is expressed on alveolar type II cells, bronchiolar epithelial cells, vascular smooth muscle cells, endothelial cells, and fibroblasts (Otsuka et al., 2004). Lung AT1R expression was markedly increased in a rat model of

bleomycin-in-0 25 50 75 100 125 0 100 300 500 0 10 20 30 40 0 100 300 500

Angiotensin II

(pg/ml)

***

0 2 4 6 8 0 100 300 500

A

T1R/18S rRN

A

***

ΑΤ1R

18S rRNA

Percent of

β

-actin

***

ΑΤ1R

β-actin

Paraquat (

μM)

A

B

C

D

0 0.5 1 1.5 0 100 300 500

A

T2R/18S rRN

A

***

*

ΑΤ2R

18S rRNA

Paraquat (

μM)

***

Fig. 1. Effects of paraquat on (A) angiotensin (ANG) II level, (B) ANG II type 1 receptor (AT1R) mRNA, (C) AT2R mRNA, and (D) AT1R protein in MRC-5 cells. MRC-5 cells were treated with the indicated concentrations of paraquat for 48 h. The ANG II level and AT1R mRNA and protein expressions increased after paraquat treatment in a dose-dependent manner. AT2R mRNA expression decreased after paraquat treatment. Data are presented as the mean ± SD (n = 3). *p < 0.05 and ***p < 0.001 vs. 0lM paraquat.

(5)

duced pulmonary fibrosis (Otsuka et al., 2004). In this study, we found that paraquat significantly increased ANG II and AT1R and collagen mRNA and protein expressions and ANG II receptor antag-onist inhibited collagen synthesis in human lung fibroblast. These studies suggest that increased signaling through the ANG II recep-tor may be involved in mediating paraquat-induced pulmonary fibrosis.

CTGF is a multifunctional cytokine that plays an important role in lung fibrosis. CTGF has been reported to be increased in patients with scleroderma with severe pulmonary fibrosis (Sato et al., 2000) and associated with an animal model of pulmonary fibrosis (Chen

et al., 2007). A previous in vitro study demonstrated that ANG II

stimulation increased CTGF expression in human lung ﬁbroblasts

(Huang et al., 2006). However, whether ANG II signaling regulates

CTGF expression in paraquat-induced collagen synthesis is unclear. In this study, we found that paraquat increased ANG II and CTGF mRNA and protein expression in a dose-dependent manner and inhibition of angiotensin signaling pathway reduced CTGF and col-lagen expression. These results suggest the existence of an ANG II and CTGF pathway in paraquat-induced collagen production. We previously demonstrated that paraquat-induced lung fibrosis is independent of ANG II in rats (Chen et al., 2005). Tissue fibrosis is a complex response initiated to protect the host from an injuri-ous event and involves massive deposition of matrix. The differ-ence in response of ANG II to paraquat in MRC-5 fibroblasts and in rats remains unclear, but it may be due to other lung mesenchy-mal cells that regulate collagen production in vivo.

Collagen is the major extracellular matrix component of the lungs and is vital for maintaining the normal lung architecture. Types I and III collagen are the most abundant collagen subtypes in the lungs (Kirk et al., 1984). They are present in the adventitia of pulmonary arteries, the interstitium of the bronchial tree, the interlobular septa, the bronchial lamina propria, and the alveolar interstitium. Although acute lung injury presents as three consec-utive: exudative, proliferative, and ﬁbrotic phases, recent evidence

Fig. 2. Effects of paraquat on angiotensin II type I receptor (AT1R) immunoreactivity in MRC-5 cells (400). MRC-5 cells were treated with paraquat at indicated concentrations for 48 h and then processed for immunofluorescence detection. Upper panel: Monolayer in media reacted with the anti-AT1R monoclonal antibody. Red staining represents AT1R immunoreactivity and the staining increased as the paraquat dosage increased. Middle panel: DAPI nuclear staining. The lower panel shows a merged image. Photographs are representative of >12 cultures from more than three separate experiments. Staining was performed in fibroblasts on at least four occasions in each case with consistent results. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

A

0 5 10 15 20 0 100 300 500 0 100 300 500

CTGF

Percent of

β

-actin

Paraquat (μM) Saralasin 10 μM – – – – + + + +

CTGF

β-actin

***

B

0 1 2 3 4 5 0 100 300 500 0 100 300 500 Paraquat (μM) Saralasin 10 μM – – – – + + + +

CTGF

18S rRNA

**

***

CTGF/18S rRN A

**

Fig. 3. Paraquat induced (A) connective tissue growth factor (CTGF) mRNA, and (B) CTGF protein expressions, and the angiotensin receptor antagonist, saralasin, inhibited these expressions. Conﬂuent monolayers of MRC-5 cells were exposed to various concentrations of paraquat for 48 h with or without saralasin (10lM). The cell pellets were used to examine CTGF mRNA expression by quantitative RT-PCR and protein expression by Western blot. The same membrane was probed with an anti-b-actin antibody to assess equal loading of the gel. Data are presented as the mean ± SD (n = 3). **p < 0.01 and ***p < 0.001 compared with 0lM paraquat with or without saralasin.

(6)

suggests that there is an overlap of the inﬂammatory and ﬁbropro-liferative phases (Marshall et al., 2000). The amounts of collagen type I (Liebler et al., 1998) and III (Chesnutt et al., 1997; Meduri

et al., 1998) and the number of collagen ﬁbers (Rocco et al.,

2001) increase early in the course of acute lung injury and influ-ence the respiratory mechanics. In this study, we found that colla-gen increased 48 h after paraquat treatment in human lung fibroblasts. Those findings and our in vitro results suggest that the proliferative phase begins early in the evolution of the lesions. In conclusion, our data showed paraquat increased ANG II pro-duction, AT1R, CTGF and collagen mRNA and protein expressions in a dose-dependent manner and saralasin inhibited CTGF and colla-gen production in human lung fibroblasts. These results indicate these effects involve the activation of CTGF and angiotensin signal-ing pathways via the AT1R. With an understandsignal-ing of these signal

transduction pathways, we can design therapeutic strategies to re-duce ﬁbrosis caused by paraquat intoxication.

Conﬂict of interest statement None declared.

Acknowledgment

This study was supported by a grant from the Tungs’ Taichung MetroHarbor Hospital (TTM-TMU-96-03).

References

Bogatkevich, G.S., Ludwicka-Bradley, A., Singleton, C.B., Bethard, J.R., Silver, R.M., 2008. Proteomic analysis of CTGF-activated lung fibroblasts: identification of IQGAP1 as a key player in lung fibroblast migration. American Journal of Physiology 295, L603–L611.

Bonniaud, P., Margetts, P.J., Kolb, M., Haberberger, T., Kelly, M., Robertson, J., Gauldie, J., 2003. Adenoviral gene transfer of connective tissue growth factor in the lung induces transient ﬁbrosis. American Journal of Respiratory and Critical Care Medicine 168, 770–778.

Chen, C.M., Lua, A.C., 2000. Lung toxicity of paraquat in the rat. Journal of Toxicology and Environmental Health A 60, 477–487.

Chen, C.M., Chou, H.C., Hsu, H.H., Wang, L.F., 2005. Transforming growth factor-beta1 upregulation is independent of angiotensin in paraquat-induced lung ﬁbrosis. Toxicology 216, 181–187.

Chen, C.M., Wang, L.F., Chou, H.C., Lan, Y.D., Lai, Y.P., 2007. Up-regulation of connective tissue growth factor in hyperoxia-induced lung ﬁbrosis. Pediatric Research 62, 128–133.

Chesnutt, A.N., Matthay, M.A., Tibayan, F.A., Clark, J.G., 1997. Early detection of type III procollagen peptide in acute lung injury. Pathogenetic and prognostic signiﬁcance. American Journal of Respiratory and Critical Care Medicine 156, 840–845.

Davis, L.K., Rodgers, B.D., Kelley, K.M., 2008. Angiotensin II- and glucose-stimulated extracellular matrix production: mediation by the insulin-like growth factor (IGF) axis in a murine mesangial cell line. Endocrine 33, 32–39.

DeGasparo, M., Catt, K.J., Inagami, T., Wright, J.W., Unger, T., 2000. International Union of Pharmacology XXIII. The angiotensin II receptors. Pharmacological Reviews 52, 415–472.

Dinis-Oliveira, R.J., Duarte, J.A., Sánchez-Navarro, A., Remião, F., Bastos, M.L., Carvalho, F., 2008. Paraquat poisonings: mechanisms of lung toxicity, clinical features, and treatment. Critical Reviews in Toxicology 38, 13–71.

Filippatos, G., Tilak, M., Pinillos, H., Uhal, B.D., 2001. Regulation of apoptosis by angiotensin II in the heart and lungs. International Journal of Molecular Medicine 7, 273–280.

Finckenberg, P., Inkinen, K., Ahonen, J., Merasto, S., Louhelainen, M., Vapaatalo, H., Muller, D., Ganten, D., Luft, F., Mervaala, E., 2003. Angiotensin II induces connective tissue growth factor gene expression via calcineurin-dependent pathways. American Journal of Pathology 163, 355–366.

Huang, Z., Taylor, L., Liu, B., Yu, J., Polgar, P., 2006. Modulation by bradykinin of angiotensin type 1 receptor-evoked RhoA activation of connective tissue growth factor expression in human lung ﬁbroblasts. American Journal of Physiology 290, L1291–L1299.

Iwanciw, D., Rehm, M., Porst, M., Goppelt-Struebe, M., 2003. Induction of connective tissue growth factor by angiotensin II: integration of signaling pathways. Arteriosclerosis, Thrombosis, and Vascular Biology 23, 1782–1787.

Kirk, J.M., Heard, B.E., Kerr, I., Turner-Warwick, M., Laurent, G.J., 1984. Quantitation of types I and III collagen in biopsy lung samples from patients with cryptogenic ﬁbrosing alveolitis. Collagen and Related Research 4, 169–182.

Lasky, J.A., Ortiz, L.A., Tonthat, B., Hoyle, G.W., Corti, M., Athas, G., Lungarella, G., Brody, A., Friedman, M., 1998. Connective tissue growth factor mRNA expression is upregulated in bleomycin-induced lung ﬁbrosis. American Journal of Physiology 275, L365–L371.

Liebler, J.M., Qu, Z., Buckner, B., Powers, M.R., Rosenbaum, J.T., 1998. Fibroproliferation and mast cells in the acute respiratory distress syndrome. Thorax 53, 823–829.

Marshall, R.P., Bellingan, G., Webb, S., Puddicombe, A., Goldsack, N., McAnulty, R.J., Laurent, G.J., 2000. Fibroproliferation occurs early in the acute respiratory distress syndrome and impacts on outcome. American Journal of Respiratory and Critical Care Medicine 162, 1783–1788.

Marshall, R.P., Gohlke, P., Chambers, R.C., Howell, D.C., Bottoms, S.E., Unger, T., McAnulty, R.J., Laurent, G.J., 2004. Angiotensin II and the ﬁbroproliferative response to acute lung injury. American Journal of Physiology 286, L156–L164. Meduri, G.U., Tolley, E.A., Chinn, A., Stentz, F., Postlethwaite, A., 1998. Procollagen types I and III aminoterminal propeptide levels during acute respiratory distress syndrome and in response to methylprednisolone treatment. American Journal of Respiratory and Critical Care Medicine 158, 1432–1441.

Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. Journal of Immunological Methods 65, 55–63. 0 1 2 3 4 0 100 300 500 0 100 300 500 0 50 100 150 200

0

100

300

500

0

100

300

500

Paraquat (μM) Saralasin 10 μM – – – – + + + +

Col I

18S rRNA

***

Col I/18S rRN A 0 1 2 3 4 0 100 300 500 0 100 300 500 Paraquat (μM) Saralasin 10 μM – – – – + + + +

Col III

18S rRNA

***

**

Col III/18S rRN A

A

B

C

Paraquat (μM) Saralasin 10 μM – – – – + + + + Collagen (mg /ml)

***

*

***

_**

***

Fig. 4. Effects of paraquat alone or combined with saralasin on (A) type I collagen (Col I) mRNA expression, (B) type III collagen (Col III) mRNA expression, and (C) total collagen content in MRC-5 cells. MRC-5 cells were treated with paraquat at the indicated concentrations for 48 h. Saralasin (10lM) was added 1 h before paraquat treatment. The cells were harvested and real-time RT-PCR was applied to examine the mRNA levels of Col I and Col III. Conditioned medium was collected for measurement of collagen content by a Sircol Collagen Assay Kit. Type I and III collagen mRNA expression and total collagen content increased after paraquat treatment in a dose-dependent fashion. The concentration-dependent increase in paraquat-stimulated collagen mRNA expression was reduced by the addition of saralasin. Data are presented as the mean ± SD (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001 vs. 0lM paraquat alone or plus saralasin.

(7)

Moussad, E.E., Brigstock, D.R., 2000. Connective tissue growth factor: what’s in a name? Molecular Genetics and Metabolism 71, 276–292.

Otsuka, M., Takahashi, H., Shiratori, M., Chiba, H., Abe, S., 2004. Reduction of bleomycin induced lung ﬁbrosis by candesartan cilexetil, an angiotensin II type 1 receptor antagonist. Thorax 59, 31–38.

Rocco, P.R.M., Negri, E.M., Kurtz, P.M., Vasconcellos, F.P., Silva, G.H., Capelozzi, V.L., Romero, P.V., Zin, W.A., 2001. Lung tissue mechanics and extracellular matrix in acute lung injury. American Journal of Respiratory and Critical Care Medicine 164, 1067–1071.

Rupérez, M., Ruiz-Ortega, M., Esteban, V., Lorenzo, O., Mezzano, S., Plaza, J.J., Egido, J., 2003. Angiotensin II increases connective tissue growth factor in the kidney. American Journal of Pathology 163, 1937–1947.

Sato, S., Nagaoka, T., Hasegawa, M., Tamatani, T., Nakanishi, T., Tagikawa, M., Takehara, K., 2000. Serum levels of connective tissue growth factor are elevated in patients with systemic sclerosis: association with extent of skin sclerosis and severity of pulmonary ﬁbrosis. Journal of Rheumatology 27, 149–154. Satoh, T., Hosokawa, M., 2000. Organophosphates and their impact on the global

environment. Neurotoxicology 21, 223–227.

Yamashita, M., Yamashita, M., Ando, Y., 2000. A long-term follow-up of lung function in survivors of paraquat poisoning. Human and Experimental Toxicology 19, 99–103.