Mesenchymal stem cells promote neutrophil activation by inducing IL-17 production in CD4+ CD45RO+ T cells
Running title: MSCs induce IL-17 production in CD4+CD45RO+ T-cell
Shu-Ching Hsu1, *, #, Li-Tzu Wang1, 2, #, Chao-Ling Yao3, Hsiu-Yu Lai4, Kuang-Yu
Chan3, Bing-Sin Liu1, Pele Chong1,7, Oscar Kuang-Sheng Lee4, 5, 6, Hsin-Wei Chen1, 7, *
1National Institute of Infectious Diseases and Vaccinology, National Health Research
Institutes, Miaoli, Taiwan
2Graduate Institute of Life Sciences, National Defense Medical Center, Taipei,
Taiwan
3Department of Chemical Engineering and Materials Science, Yuan-Ze University,
Chung-Li, Taiwan,
4Institute of Clinical Medicine, National Yang-Ming University, Taipei, Taiwan
5Stem Cell Research Center, National Yang-Ming University, Taipei, Taiwan
6Department of Orthopaedics and Traumatology, Taipei Veterans
General Hospital, Taipei, Taiwan
7Graduate Institute of Immunology, China Medical University, Taichung, Taiwan
Hsin-Wei Chen, E-mail: [email protected], or Shu-Ching Hsu, E-mail: [email protected],
National Institute of Infectious Diseases and Vaccinology, National Health Research Institutes,
35 Keyan Road, Zhunan, Miaoli 350, Taiwan, R.O.C.
#These authors equally contributed to this work.
Keywords: IL-17; memory T cells; mesenchymal stem cell; neutrophil; phagocytosis.
Abbreviations: BM, bone marrow; BM-MSC, bone marrow-derived mesenchymal stem cell; HSC, hematopoietic stem cell; IL-17, interleukin-17; MSC, mesenchymal stem cell; PBMC, peripheral blood mononuclear cell.
Abstract
Mesenchymal stem cells (MSCs) are multi-potent with numerous
mesenchymal-lineage differentiation potential and immunomodulatory capabilities. However, the immunoregulatory properties of MSCs are not clearly defined. The objective of the present study was to elucidate the role(s) of MSCs in IL-17 production and the subsequent effect(s) on neutrophil activation. We have demonstrated that human bone marrow-derived MSCs (BM-MSCs) instruct anti-CD3/anti-CD28 antibody-activated CD4+ CD45RO+ memory T cells, but not other
CD4+ subsets or CD8+ T cells, to produce IL-17 after cell-cell contact. After the
addition of IL-17, neutrophil phagocytic activity was increased. This is the first report on the ability of BM-MSCs to induce IL-17 production in memory CD4+ T cells that,
in turn, promotes enhanced phagocytic activity of neutrophils. These results suggest that MSCs regulate the functional activation of neutrophils via their role in
Introduction
Mesenchymal stem cells (MSCs) are multi-potent cells that can differentiate into the osteogenic, chrondrogenic and adipogenic lineages. They are
non-hematopoietic stem cells that represent 0.01% - 0.001% of bone marrow cells
(Chamberlain et al., 2007). The interaction of MSCs with cells of both the innate and adaptive immune systems can modulate several effector functions (Uccelli et al., 2006; Uccelli et al., 2008). Compelling evidence has shown that MSCs exert
immunosuppressive effects on T (Aggarwal and Pittenger, 2005; Glennie et al., 2005; Sato et al., 2007; Zappia et al., 2005), B (Corcione et al., 2006), NK (Sotiropoulou et al., 2006; Spaggiari et al., 2008), and dendritic cells (Aggarwal and Pittenger, 2005; Chen et al., 2007; Ramasamy et al., 2007). Several studies have shown that the immunosuppressive properties of MSCs have therapeutic benefits in autoimmune (Rafei et al., 2009; Zappia et al., 2005; Zhang et al., 2011) and graft-versus-host diseases (Le Blanc et al., 2004) in clinical settings. However, conflicting results have also been reported by independent research groups regarding the effect of MSCs on collagen-induced arthritis (Chen et al., 2010; Djouad et al., 2005) and graft-versus-host diseases (Sudres et al., 2006). These studies do not support the notion that MSCs have sufficient immunosuppressive potential in vivo for clinical applications.
Although the underlying reasons for these contradictory results are at present unexplained, they may be due to the heterogeneous nature of the MSC populations that have been studied.
IL-17 is recognized as an inflammatory cytokine. It is believed that IL-17 is mainly secreted by Th17 cells. The biological functions of IL-17 have been widely studied since its identification. Accumulating evidence has shown that IL-17 plays a central role in the cytokine networks that coordinate innate and adaptive immunity (Weaver et al., 2007; Xu and Cao, 2010). It has been clearly shown that the combination of TGF- and IL-6 is critical for the differentiation of activated T lymphocytes into Th17 cell lineage in mice, whereby the regulation of IL-17 production from cellular interactions between T and non-T cells remains unclear. A better understanding of how IL-17 production is regulated by Th17 cellular
interactions may significantly impact our ability to clinically modulate immunity. As part of the bone marrow stromal microenvironment, MSCs closely interact with hematopoietic stem cells (HSCs) and support their growth and differentiation. There is a general consensus that MSCs are one of the main cell types that contribute to the bone marrow HSC niche (Ehninger and Trumpp, 2011). MSCs can facilitate the expansion of Th17 cells and up-regulate IL-17 production (Guo et al., 2009). In addition, IL-17 has been shown to increase neutrophil counts via the induction of
granulocyte colony-stimulating factor (Forlow et al., 2001; Schwarzenberger et al., 1998). Thus, we hypothesized that the modulation of IL-17 production by MSCs could have a marked impact on neutrophil maturation and activation.
The objective of this study was to elucidate the role(s) and effect(s) of human bone marrow-derived MSCs (BM-MSCs) on IL-17 production. Our results
demonstrate that direct cell contact of BM-MSCs with activated CD4+ CD45RO+
memory T cells, but not with other CD4+ or CD8+ T-cell subsets, induces the
production of IL-17. Induction of IL-17 can further activate neutrophils to enhance their phagocytic ability. These findings suggest that MSCs play an important role in bridging adaptive and innate immune responses.
Materials and Methods
Culture of human BM-MSCs
Isolation of human MSCs from bone marrow was performed using a previously reported protocol (Lee et al., 2004). Human MSCs were cultured in an expansion medium consisting of Iscove’s modified Dulbecco’s medium (IMDM, Sigma-Aldrich, St. Louis, MO, USA) and 10% fetal bovine serum (FBS, Hyclone, Logan, UT, USA), supplemented with 10 ng/mL bFGF (R&D Systems, Minneapolis, MN, USA), 100
U/mL penicillin, 100 μg/mL streptomycin, and 2 mM L-glutamine (Sigma-Aldrich). Human BM-MSCs at passages 7-10 were used for the experiments. Approval from the Institutional Review Board of Yuan-Ze University was obtained prior to the commencement of this study.
Isolation of human T lymphocytes
Human T lymphocytes were prepared from peripheral blood mononuclear cells (PBMCs) by Ficoll-Paque density gradient centrifugation. CD3+ T lymphocytes were
purified using a human CD3+ isolation kit (Dynabeads® CD3, Dynal Biotech, Oslo,
Norway) following the manufacturer’s instructions. To evaluate the capability of different subsets of T lymphocytes to produce IL-17, purified CD3+ T cells were
stained with CD4-FITC, CD8-PerCP, CD45RA-APC, and anti-CD45RO-PE antibodies (BD Biosciences, Bedford, MA). CD4+ CD45RA+, CD4+
CD45RO+, CD8+ CD45RA+, and CD8+ CD45RO+ T cells were sorted using a FACS
Aria cell sorter (BD Biosciences). The purity of individual human T-cell subpopulations was greater than 95%.
Co-culture experiments
Purified human T cells (5x105 cells) from different subpopulations were
culture plates. After three days of co-culture with or without 5 µg/mL of anti-CD3 (OKT3, eBioscience, San Diego, CA, USA) and 5 µg/mL of anti-CD28 antibodies (eBioscience), T cells were sorted and subjected to real-time PCR analysis. IL-17 secretion was measured in the supernatants from different culture groups by ELISA.
Analysis of IL-17 production
Culture supernatants were collected, and IL-17 concentrations were determined using a commercial ELISA kit according to the manufacturer’s protocol (R&D systems). In transwell (Millicell®, Millipore system, Billerica, MA, USA) experiments, human BM-MSCs were seeded in the basolateral compartment and CD3+ T lymphocytes were cultured in the apical compartment in the presence of 5
µg/mL anti-CD3 and 5 µg/mL anti-CD28 antibodies for three days. Supernatants were then collected for IL-17 measurement.
Phagocytosis assay
Human peripheral blood was collected and mononuclear cells were separated following Ficoll-Histopaque density gradient centrifugation. The supernatant was discarded, and the red blood cell/neutrophil pellet was resuspended in 20 mL of a cold 0.2% sodium chloride (Sigma-Aldrich) solution for 30 sec at room temperature to lyse the red blood cells. Isotonicity was restored by adding an equal volume of a cold 1.6%
sodium chloride solution. The cells were centrifuged at 300xg for 20 minutes at 20°C. The cell collection and resuspension steps were repeated three times to enrich for neutrophil purity of up to 99% as judged by CD11b-PE and CD15-FITC (eBioscience system) surface staining. Neutrophils (1x105/well) were incubated in a 96-well
microtiter plate with either recombinant human IL-17 (10 ng/mL) or supernatants collected from BM-MSCs co-cultured with activated T cells with the addition of 1 µg/mL anti-IL-17 monoclonal antibody (Peprotech, Princeton, NJ, USA) or its corresponding isotype control (Peprotech) to the different culture groups. The level of IL-17 in the supernatants from BM-MSCs/activated T cell co-cultures after
neutralization with anti-IL-17 antibodies was reduced to approximately 20% of its initial value, as determined by ELISA (data not shown). Their phagocytic ability was assessed after adding Alexa Fluor 488 (Invitrogen)-conjugated Lactobacillus
fermentum and analyzing neutrophil-associated fluorescence intensity by FACS analysis. Fluorescence images were observed with a Leica confocal microscope (Leica TCS SPII, Leica Camera AG, Solms, Germany) and captured using a Leica TCS SP5 camera.
RNA isolation and real-time PCR analysis
a ReverTra Ace kit (Toyobo Life Science, OSAKA, JAPAN), according to the manufacturer’s instructions. Real-time PCR was performed using an ABI Prism 7900 system (Applied Biosystems, Foster City, CA, USA). Intron-spanning primers
specific for each gene were designed, and their sequences are as follows: glyceraldehyde-3-phosphate-dehydrogenase (GAPDH),
GAGTCAACGGATTTGGTCGT (forward primer, F),
TTGATTTTGGAGGGATCTCG (reverse primer, R); IL-17 F,
CCGCCACTTGGGCTGCATCA (F), GGGCAGTGTGGAGGCTCCCT (R). The levels of mRNA expression in different cell groups were analyzed by subtracting the average threshold cycles of each gene with that of the housekeeping gene GAPDH.
Statistical analyses
Statistical analyses were performed using GraphPad Prism, version 5.02 (GraphPad Software, Inc.). Statistical significance of the differences between the groups was assessed using a one-tailed Student’s t-test. Differences with a p value of less than 0.05 were considered statistically significant.
Production of IL-17 is markedly increased in the co-cultured supernatants of mesenchymal stem cells and activated T cells
Levels of IL-17 mRNA were determined by real-time PCR from co-cultures of human BM-MSCs and human peripheral blood purified CD3+ T cells stimulated with
or without anti-CD3/anti-CD28 antibodies. The presence of anti-CD3/anti-CD28 antibodies increased the level of IL-17 mRNA produced from mixed MSCs/T cell co-cultures by more than 10-fold (Fig. 1A). To investigate the effect of T-cell receptor signaling on IL-17 production, we analyzed the secretion profile of IL-17 in the supernatants of co-cultured BM-MSCs and T cells that were stimulated with anti-CD3 or anti-CD28 antibodies in different dose combinations. The results obtained from two donors are shown in figure 1B. CD28 signaling alone could not trigger IL-17 secretion, and the levels of IL-17 in the supernatant were barely detectable without anti-CD3 stimulation. Interestingly, combining anti-CD3 and anti-CD28 antibodies had a synergistic effect on stimulating IL-17 production. We chose 5 µg/mL of anti-CD3 and 5 µg/mL of anti-CD28 antibodies as optimal activation conditions for use in all further studies. In additional co-culture experiments, the production of IL-17 was dramatically increased in the supernatants of BM-MSCs mixed with activated T cells but not in the cultures of BM-MSCs or T cells alone. The mean level of IL-17 from
mixed cell cultures was 3343.1±1752.9 pg/mL (Fig. 1C), and only minimal amounts of IL-17 were detected in the absence of T-cell activation. These results clearly indicate that the combination of MSCs, T cells and CD3/ CD28 signaling was necessary to stimulate IL-17 secretion.
We next examined whether cellular interactions between MSCs and activated T cells were required for IL-17 secretion. To accomplish this, we prevented direct cell-to-cell contact with a transwell culture system. As shown in figure 2, levels of IL-17 production were reduced 10-fold when cell-to-cell contact was prohibited. These results suggest that MSCs interact directly with activated T cells to promote the induction of IL-17 secretion.
Mesenchymal stem cells instruct activated CD4+ CD45RO+ memory T cells to produce IL-17
IL-17 was secreted in high amounts in the supernatants of BM-MSCs co-cultured with activated T cells. Therefore, we next set out to determine which T-cell subset was responsible for IL-17 production. To this end, we separated non-adherent T cells from adherent BM-MSCs and determined IL-17 mRNA levels using RT-PCR. The results from one of the three representative experiments are shown in figure 3A. IL-17 mRNA was not detected in BM-MSCs alone or BM-MSCs that were previously
co-cultured with T cells. In contrast, IL-17 mRNA levels were dramatically increased (10-fold) in T cells that were co-cultured with BM-MSCs compared with T cells that were cultured alone. These results suggest that IL-17 was essentially produced by T cells from mixed cell cultures but not by MSCs.
IL-17 can be secreted by both CD4+ (Aggarwal et al., 2003) and CD8+ (Liu et
al., 2007) T cells. Therefore, a separate set of experiments was performed to elucidate which subsets of T cells were the major contributors to IL-17 production. Different human T-cell subpopulations were purified by FACS and co-cultured with BM-MSCs in the presence of anti-CD3/anti-CD28 antibodies. Levels of secreted IL-17 were determined by ELISA from the cultured supernatants. CD8+ T cells that were
co-cultured with BM-MSCs were not able to secrete IL-17, whereas high levels of IL-17 were detected in the supernatants of CD4+ T cells that were co-cultured with
BM-MSCs. Most interestingly, IL-17 was produced by the CD4+ CD45RO+ memory
T-cell subset rather than by the CD4+ CD45RA+ naïve T cells (Fig. 3B). Indeed, purified
CD4+ CD45RO+ T cells, purified CD4+ CD45RA+ T cells and CD4+ CD45RO+
-depleted CD4+ T cells were obtained from CD4+ T cell-enriched populations by cell
sorting and subsequently activated with anti-CD3/anti-CD28 antibodies in the presence of BM-MSCs. High amounts of IL-17 (7460.9±4334.0 pg/mL) were produced only in CD4+ CD45RO+ T-cell co-cultures and was not present in the
supernatants of the other T-cell subset cultures (Fig. 3C). These results support the conclusion that BM-MSCs stimulate activated CD4+ CD45RO+ memory T cells to
produce IL-17.
The effect of IL-17 on neutrophil activation
IL-17 is one of the growth factors of MSCs (Huang et al., 2006) that were first isolated from bone marrow. Memory T cells are also significantly present in bone marrow niches (Su et al., 2010). In addition, neutrophils are produced in the bone marrow (Borregaard, 2010). To evaluate whether IL-17, which derived from MSCs contacted memory T cells, influences the phagocytic function of neutrophils,
granulocytes were isolated and incubated with FITC-labeled bacteria. Phagocytosis of neutrophils for FITC-labeled bacteria is shown in figure 4A. The potency of
phagocytosis was assessed by measuring the fluorescence intensity of neutrophils following a one-hour incubation. The results from one representative experiment are shown in figure 4B. The phagocytic activity of neutrophils was significantly enhanced in the presence of recombinant human 17. Similar findings were obtained with IL-17 that was produced by the activated T-cells that were co-cultured with BM-MSCs. Five-fold diluted culture supernatants and FITC-labeled bacteria were
control. Neutrophil-associated fluorescence intensity was partially decreased in the presence of the anti-IL-17 antibody compared with its isotype control (Fig. 4C). The results from seven independent experiments are summarized in figure 4D. These results show that IL-17 plays an important role in activation of neutrophil
phagocytosis.
Discussion
Following T-cell receptor engagement with peptide-MHC complexes, T cells proliferate and perform effector functions, such as cytokine secretion. The interaction of MSCs with T cells can modulate their effector functions. For the first time, we have unambiguously demonstrated that human BM-MSCs stimulated IL-17
production in activated CD4+CD45RO+ memory T cells but not in other CD4+ subsets
or CD8+ T cells (Fig 3B and 3C). This observation is in agreement with the finding
that IL-17 is secreted by long-lived effector memory Th17 cells (Liu and Rohowsky-Kochan, 2008). Furthermore, cell-cell contact between BM-MSCs and T cells is a prerequisite for IL-17 secretion (Fig. 2).
Numerous studies have shown that MSCs can inhibit the proliferation of T lymphocytes in the presence of various stimulatory agents (Aggarwal and Pittenger,
2005; Glennie et al., 2005; Sato et al., 2007; Zappia et al., 2005). However, the effects of MSCs on Th17 cells remain controversial. Human MSCs were found to inhibit human Th17 cell differentiation and function (Ghannam et al., 2010). In addition, MSCs have been shown to improve experimental autoimmune encephalomyelitis in mice (Rafei et al., 2009) and experimental autoimmune uveoretinitis in rats (Zhang et al., 2011) by inhibiting Th17 cell function. Conversely, human fetal bone marrow-derived MSCs have been shown to promote the expansion of Th17 cells and decrease IFN-γ-producing Th1 cells (Guo et al., 2009). Another report revealed that the
administration of MSCs aggravated arthritis in a collagen-induced arthritis mouse model by up-regulating IL-6 secretion and Th17 differentiation (Chen et al., 2010). Although the underlying mechanisms for these discrepancies are still unclear, they might be due to different states of T-cell activation (Carrion et al., 2011). In the present study, we have demonstrated that T-cell receptor signaling was essential for the induction of IL-17 (Fig. 1). Although co-stimulatory signaling synergized with T-cell receptor engagement, it was not necessary to stimulate IL-17 production. These results suggest that the activation status of T cells is a critical factor for determining the levels of IL-17 production when BM-MSCs contact human T lymphocytes.
The IL-17 receptor is constitutively expressed on circulating human neutrophils (Dragon et al., 2008). In addition, IL-17 produced by T cells is a key
cytokine for the recruitment, maturation and activation of neutrophils (Gaffen, 2008; Ley et al., 2006; Silva, 2010). Expanding these findings, our results show that IL-17 is able to promote neutrophils activation and to enhance their phagocytic activity (Fig. 4B). We hypothesized that IL-17 derived from activated T cells after contact with BM-MSCs could maintain or augment the activation of neutrophils. We found that the supernatants obtained from the co-cultures of BM-MSCs and activated T cells
contained high levels of IL-17 (Fig. 1C). Depletion of IL-17 in MSCs/T-cell co-cultured supernatants by the addition of a neutralizing antibody inhibited neutrophil phagocytic activity, thereby demonstrating the role of IL-17 in neutrophil
phagocytosis (Fig 4B-D). Taken together, these results show that IL-17 secretion induced by BM-MSC-stimulated T cells is critical to maintain or augment the functional activation of neutrophils.
MSCs have been shown to redistribute among a wide range of tissues after infusion, including sites of injury or inflammation (Caplan, 2007; Devine et al., 2003; Gao et al., 2001; Mouiseddine et al., 2007). Recently, several reports have provided concrete evidence that MSCs are a functional component of the bone marrow HSC niche (Adams et al., 2007; Calvi et al., 2003; Mendez-Ferrer et al., 2010). The
invasion of hosts with pathogens activates T cells and rapidly evokes CD4+ CD45RO+
sites of injury, inflammation, or in the bone marrow microenvironment where they recirculate. As a result of these encounters, activated memory T cells produce large amounts of IL-17, which can further activate neutrophils. We propose that MSCs regulate the functional activation of neutrophils via their role in orchestrating IL-17 secretion from CD4+ CD45RO+ T cells (Fig. 5). In summary, our results provide
evidence supporting the notion that this immunoregulatory function of MSCs plays a significant role in linking adaptive and innate immunity.
Acknowledgements
This study was supported by the following grants: VC-099-PP-01 and VC-100-PP-01 to HWC and VC-099-PP-03 and VC-100-PP-03 to SCH from the National Health Research Institutes. The authors thank the Core Facility of the Flow Activation Cell Sorter at the National Health Research Institutes and Miss Ya-Min Lin from the Institute of Molecular Biology of Academia Sinica for performing the sterile cell sorting. We are also grateful to Dr. John Kung and Dr. Michel Klein for critically reviewing the manuscript and providing suggestions.
References
Adams, G.B., Martin, R.P., Alley, I.R., Chabner, K.T., Cohen, K.S., Calvi, L.M., Kronenberg, H.M., Scadden, D.T., 2007. Therapeutic targeting of a stem cell niche. Nat Biotechnol 25, 238-243.
Aggarwal, S., Ghilardi, N., Xie, M.-H., de Sauvage, F.J., Gurney, A.L., 2003.
Interleukin-23 Promotes a Distinct CD4 T Cell Activation State Characterized by the Production of Interleukin-17. J. Biol. Chem. 278, 1910-1914.
Aggarwal, S., Pittenger, M.F., 2005. Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 105, 1815-1822.
Borregaard, N., 2010. Neutrophils, from marrow to microbes. Immunity 33, 657-670. Calvi, L.M., Adams, G.B., Weibrecht, K.W., Weber, J.M., Olson, D.P., Knight, M.C.,
Martin, R.P., Schipani, E., Divieti, P., Bringhurst, F.R., Milner, L.A., Kronenberg, H.M., Scadden, D.T., 2003. Osteoblastic cells regulate the haematopoietic stem cell niche. Nature 425, 841-846.
Caplan, A.I., 2007. Adult mesenchymal stem cells for tissue engineering versus regenerative medicine. J Cell Physiol 213, 341-347.
Carrion, F., Nova, E., Luz, P., Apablaza, F., Figueroa, F., 2011. Opposing effect of mesenchymal stem cells on Th1 and Th17 cell polarization according to the state of CD4+ T cell activation. Immunol Lett 135, 10-16.
Chamberlain, G., Fox, J., Ashton, B., Middleton, J., 2007. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity,
immunological features, and potential for homing. Stem Cells 25, 2739-2749. Chen, B., Hu, J., Liao, L., Sun, Z., Han, Q., Song, Z., Zhao, R.C., 2010. Flk-1+
mesenchymal stem cells aggravate collagen-induced arthritis by up-regulating interleukin-6. Clin Exp Immunol 159, 292-302.
Chen, L., Zhang, W., Yue, H., Han, Q., Chen, B., Shi, M., Li, J., Li, B., You, S., Shi, Y., Zhao, R.C., 2007. Effects of human mesenchymal stem cells on the differentiation of dendritic cells from CD34+ cells. Stem Cells Dev 16,
719-731.
Corcione, A., Benvenuto, F., Ferretti, E., Giunti, D., Cappiello, V., Cazzanti, F., Risso, M., Gualandi, F., Mancardi, G.L., Pistoia, V., Uccelli, A., 2006. Human mesenchymal stem cells modulate B-cell functions. Blood 107, 367-372. Devine, S.M., Cobbs, C., Jennings, M., Bartholomew, A., Hoffman, R., 2003.
Mesenchymal stem cells distribute to a wide range of tissues following systemic infusion into nonhuman primates. Blood 101, 2999-3001.
Djouad, F., Fritz, V., Apparailly, F., Louis-Plence, P., Bony, C., Sany, J., Jorgensen, C., Noel, D., 2005. Reversal of the immunosuppressive properties of
mesenchymal stem cells by tumor necrosis factor alpha in collagen-induced arthritis. Arthritis Rheum 52, 1595-1603.
Dragon, S., Saffar, A.S., Shan, L., Gounni, A.S., 2008. IL-17 attenuates the anti-apoptotic effects of GM-CSF in human neutrophils. Mol Immunol 45, 160-168.
Ehninger, A., Trumpp, A., 2011. The bone marrow stem cell niche grows up:
mesenchymal stem cells and macrophages move in. J Exp Med 208, 421-428. Forlow, S.B., Schurr, J.R., Kolls, J.K., Bagby, G.J., Schwarzenberger, P.O., Ley, K.,
2001. Increased granulopoiesis through interleukin-17 and granulocyte colony-stimulating factor in leukocyte adhesion molecule-deficient mice. Blood 98, 3309-3314.
Gaffen, S.L., 2008. An overview of IL-17 function and signaling. Cytokine 43, 402-407.
Gao, J., Dennis, J.E., Muzic, R.F., Lundberg, M., Caplan, A.I., 2001. The dynamic in vivo distribution of bone marrow-derived mesenchymal stem cells after infusion. Cells Tissues Organs 169, 12-20.
Ghannam, S., Pene, J., Torcy-Moquet, G., Jorgensen, C., Yssel, H., 2010.
Mesenchymal stem cells inhibit human Th17 cell differentiation and function and induce a T regulatory cell phenotype. J Immunol 185, 302-312.
Glennie, S., Soeiro, I., Dyson, P.J., Lam, E.W., Dazzi, F., 2005. Bone marrow mesenchymal stem cells induce division arrest anergy of activated T cells. Blood 105, 2821-2827.
Guo, Z., Zheng, C., Chen, Z., Gu, D., Du, W., Ge, J., Han, Z., Yang, R., 2009. Fetal BM-derived mesenchymal stem cells promote the expansion of human Th17 cells, but inhibit the production of Th1 cells. Eur J Immunol 39, 2840-2849. Huang, W., La Russa, V., Alzoubi, A., Schwarzenberger, P., 2006. Interleukin-17A: a
T-cell-derived growth factor for murine and human mesenchymal stem cells. Stem Cells 24, 1512-1518.
Le Blanc, K., Rasmusson, I., Sundberg, B., Gotherstrom, C., Hassan, M., Uzunel, M., Ringden, O., 2004. Treatment of severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet 363, 1439-1441. Lee, K.D., Kuo, T.K., Whang-Peng, J., Chung, Y.F., Lin, C.T., Chou, S.H., Chen, J.R., Chen, Y.P., Lee, O.K., 2004. In vitro hepatic differentiation of human mesenchymal stem cells. Hepatology 40, 1275-1284.
Ley, K., Smith, E., Stark, M.A., 2006. IL-17A-producing neutrophil-regulatory Tn lymphocytes. Immunol Res 34, 229-242.
Liu, H., Rohowsky-Kochan, C., 2008. Regulation of IL-17 in human CCR6+ effector
memory T cells. J Immunol 180, 7948-7957.
Liu, S.-J., Tsai, J.-P., Shen, C.-R., Sher, Y.-P., Hsieh, C.-L., Yeh, Y.-C., Chou, A.-H., Chang, S.-R., Hsiao, K.-N., Yu, F.-W., Chen, H.-W., 2007. Induction of a distinct CD8 Tnc17 subset by transforming growth factor-β and interleukin-6. J Leukoc Biol 82, 354-360.
Mendez-Ferrer, S., Michurina, T.V., Ferraro, F., Mazloom, A.R., Macarthur, B.D., Lira, S.A., Scadden, D.T., Ma'ayan, A., Enikolopov, G.N., Frenette, P.S., 2010. Mesenchymal and haematopoietic stem cells form a unique bone marrow niche. Nature 466, 829-834.
Mouiseddine, M., Francois, S., Semont, A., Sache, A., Allenet, B., Mathieu, N., Frick, J., Thierry, D., Chapel, A., 2007. Human mesenchymal stem cells home specifically to radiation-injured tissues in a non-obese diabetes/severe combined immunodeficiency mouse model. Br J Radiol 80 Spec No 1, S49-55.
Rafei, M., Campeau, P.M., Aguilar-Mahecha, A., Buchanan, M., Williams, P., Birman, E., Yuan, S., Young, Y.K., Boivin, M.N., Forner, K., Basik, M., Galipeau, J., 2009. Mesenchymal stromal cells ameliorate experimental autoimmune encephalomyelitis by inhibiting CD4 Th17 T cells in a CC chemokine ligand 2-dependent manner. J Immunol 182, 5994-6002.
Ramasamy, R., Fazekasova, H., Lam, E.W., Soeiro, I., Lombardi, G., Dazzi, F., 2007. Mesenchymal stem cells inhibit dendritic cell differentiation and function by preventing entry into the cell cycle. Transplantation 83, 71-76.
Sato, K., Ozaki, K., Oh, I., Meguro, A., Hatanaka, K., Nagai, T., Muroi, K., Ozawa, K., 2007. Nitric oxide plays a critical role in suppression of T-cell
proliferation by mesenchymal stem cells. Blood 109, 228-234.
Schwarzenberger, P., La Russa, V., Miller, A., Ye, P., Huang, W., Zieske, A., Nelson, S., Bagby, G.J., Stoltz, D., Mynatt, R.L., Spriggs, M., Kolls, J.K., 1998. IL-17 stimulates granulopoiesis in mice: use of an alternate, novel gene therapy-derived method for in vivo evaluation of cytokines. J Immunol 161, 6383-6389.
Silva, M.T., 2010. Neutrophils and macrophages work in concert as inducers and effectors of adaptive immunity against extracellular and intracellular microbial pathogens. J Leukoc Biol 87, 805-813.
Sotiropoulou, P.A., Perez, S.A., Gritzapis, A.D., Baxevanis, C.N., Papamichail, M., 2006. Interactions between human mesenchymal stem cells and natural killer cells. Stem Cells 24, 74-85.
Spaggiari, G.M., Capobianco, A., Abdelrazik, H., Becchetti, F., Mingari, M.C., Moretta, L., 2008. Mesenchymal stem cells inhibit natural killer-cell
proliferation, cytotoxicity, and cytokine production: role of indoleamine 2,3-dioxygenase and prostaglandin E2. Blood 111, 1327-1333.
Su, Y.C., Lee, C.C., Kung, J.T., 2010. Effector function-deficient memory CD8+ T
cells clonally expand in the liver and give rise to peripheral memory CD8+ T
cells. J Immunol 185, 7498-7506.
Lataillade, J.J., Bourin, P., Holy, X., Vernant, J.P., Klatzmann, D., Cohen, J.L., 2006. Bone marrow mesenchymal stem cells suppress lymphocyte proliferation in vitro but fail to prevent graft-versus-host disease in mice. J Immunol 176, 7761-7767.
Uccelli, A., Moretta, L., Pistoia, V., 2006. Immunoregulatory function of mesenchymal stem cells. Eur J Immunol 36, 2566-2573.
Uccelli, A., Moretta, L., Pistoia, V., 2008. Mesenchymal stem cells in health and disease. Nat Rev Immunol 8, 726-736.
Weaver, C.T., Hatton, R.D., Mangan, P.R., Harrington, L.E., 2007. IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu Rev Immunol 25, 821-852.
Xu, S., Cao, X., 2010. Interleukin-17 and its expanding biological functions. Cell Mol Immunol 7, 164-174.
Zappia, E., Casazza, S., Pedemonte, E., Benvenuto, F., Bonanni, I., Gerdoni, E., Giunti, D., Ceravolo, A., Cazzanti, F., Frassoni, F., Mancardi, G., Uccelli, A., 2005. Mesenchymal stem cells ameliorate experimental autoimmune
encephalomyelitis inducing T-cell anergy. Blood 106, 1755-1761.
Zhang, X., Ren, X., Li, G., Jiao, C., Zhang, L., Zhao, S., Wang, J., Han, Z.C., Li, X., 2011. Mesenchymal stem cells ameliorate experimental autoimmune
Ophthalmol Vis Sci 52, 3143-3152.
Figure Legends
Figure 1. IL-17 production is induced in co-cultures of human BM-MSCs and human CD3+ T cells activated with anti-CD3/anti-CD28 antibodies. BM-MSCs and peripheral blood purified CD3+ T cells were co-cultured with or without
anti-CD3/anti-CD28 antibody activation for 3 days. The antibody concentration of both anti-CD3 and anti-CD28 antibodies was 5 µg/mL, unless otherwise indicated. (A) The cells were harvested and IL-17 mRNA levels were analyzed by real-time PCR. Levels of human IL-17 secretion in the supernatants were determined by ELISA. (B)
Supernatants (n=2) were collected from co-cultured BM-MSCs and CD3+ T cells
stimulated with different dose combinations of anti-CD3 or anti-CD28 antibodies. (C) Supernatants (n=9) were obtained from various co-culture conditions as indicated.
Figure 2. Direct cell-to-cell contact involves in IL-17 production. BM-MSCs were directly or indirectly co-cultured with peripheral blood purified CD3+ T cells using a
transwell system to separate the BM-MSCs from the CD3+ T cells. Cells were
IL-17 secretion in the supernatants were determined by ELISA. The means and standard deviations obtained from six donors are shown. Significant differences were determined using Student’s t test, and the p values are indicated.
Figure 3. IL-17 is mainly secreted by activated CD4+ CD45RO+ memory T cells. (A) BM-MSCs and T cells were harvested from individual cultures or from co-culture systems with anti-CD3/anti-CD28 antibody activation. IL-17 mRNA levels were determined by real-time PCR. (B) Various human T-cell subsets from human peripheral blood mononuclear cells were purified by fluorescence-activated cell sorting. Human BM-MSCs were co-cultured with different T-cell subsets in the presence of anti-CD3/anti-CD28 antibodies for 3 days. Supernatants were collected, and human IL-17 levels were determined by ELISA. (C) Individual group of CD4+
CD45RO+, CD4+ CD45RA+, and CD4+ CD45RO+-depleted whole CD4+ T cells was
isolated from total CD4+ T cell populations and each T-cell subset was sorted out by
FACS aria cell sorter. BM-MSCs were co-cultured with different T-cell subsets and stimulated with anti-CD3/anti-CD28 antibodies for 3 days. Supernatants (n=3) were collected, and IL-17 levels were determined by ELISA.
Figure 4. IL-17 promotes the functional activation of neutrophils. (A) The determination of phagocytytic activity of neutrophils by confocal microscopy.
Neutrophils were incubated alone or feed with Alexa Fluor 488 -conjugated
Lactobacillus fermentum at room temperature for 2 hours then fixed onto microscopy slide covered with ProLong Gold antifade reagent. The Fluorescence images were observed with a Leica confocal microscope. Neutrophils: neutrophils alone; Neutrophils + Bacteria: neutrophils incubated with Alexa Fluor 488 -conjugated bacteria (Lactobacillus fermentum). (B) The effect of IL-17 on the phagocytic activity of neutrophils that were isolated from peripheral blood mononuclear cells was
measured by incubating the cells with FITC-labeled bacteria and analyzing the fluorescence intensity of the internalized particles in neutrophils by flow cytometry after a one-hour incubation. (C) The effect of IL-17 supernatants from BM-MSC-activated T cell co-cultures on the phagocytic activity of neutrophils was further evaluated in the presence of an anti-IL-17 neutralizing antibody or its isotype control. (D) The means and standard deviations obtained from seven donors are shown. Significant differences were determined using Student’s t test, and the p values are indicated.
Figure 5. Illustration of the proposed mechanism by which MSCs bridge the adaptive and innate immune responses. CD4+ CD45RO+ memory T cells are
rapidly evoked when hosts are invaded by pathogens. A large amount of IL-17 can be produced by activated CD4+ CD45RO+ T cells after contact with MSCs. IL-17 plays
