• 沒有找到結果。

Effect of Paeonol on Tissue Destruction in Experimental Periodontitis of Rats.

N/A
N/A
Protected

Academic year: 2021

Share "Effect of Paeonol on Tissue Destruction in Experimental Periodontitis of Rats."

Copied!
21
0
0

加載中.... (立即查看全文)

全文

(1)

Effect of Paeonol on Tissue Destruction in Experimental

Periodontitis of Rats

Chih-Yuan Chang, DDS, MSD *, †, Earl Fu, DDS, DScD *, †, Cheng-Yang Chiang, DDS, MSD *, Wei-Jeng Chang, PhD §, Wan-Chien Cheng, DDS *, Hsiao-Pei Tu, PhD *, ‡

Affiliation

*: School of Dentistry, National Defense Medical Center and Tri-Service General Hospital, 114 No.161, Sec. 6, Minquan E. Rd., Neihu Dist., Taipei City 114, Taiwan, ROC

§: National Laboratory Animal Center, NARL, 128 Academia Road, Section 2, Nankang, Taipei 115, Taiwan, ROC

‡: Department of Dental Hygiene, China Medical University, 91 Hsueh-Shih Road, Taichung, 40402, Taiwan, ROC.

†: These authors equally contributed to the works

Running title: Protection of paeonol on periodontitis in rat (<40 bites) Number of pages, figures and tables: 19 pages and 6 figures

Correspondence Dr. Hsiao-Pei Tu

School of Dentistry, National Defense Medical Center, PO Box 90048-507, Taipei, Taiwan, ROC, and

Department of Dental Hygiene, China Medical University, 91 Hsueh-Shih Road, Taichung, 40402, Taiwan, ROC.

Email: [email protected] w

(2)

Abstract

We evaluated the effects of paeonol, a phenolic compound of Moutan Cortex, on the tissue inflammation and destruction in experimental periodontitis of rats. Maxillary palatal bony surfaces of 18 rats received injections of lipopolysaccharide (LPS, 5 mg/mL), PBS or LPS-plus-paeonol (40 mg/kg, intra-peritoneal injection) for 3 days. Five days later, the osteoclasts were examined and compared after tartrate-resistant acid phosphatase staining. In another 36 rats, the experimental periodontitis was induced by placing the ligatures around maxillary second and mandibular first molars. Seven days later, the periodontal destruction and inflammation in rats with paeonol (40 or 80 mg/kg) and those had no ligature or without paeonol were compared by dental radiography, micro-computerized tomography (micro-CT), and histology. Gingival mRNA expressions of pre-inflammatory cytokines, including IL-1β、IL-6 and TNF-α were also examined. Compared to the effect of the LPS positive control, paeonol injection significantly reduced the induced osteoclast formation. In ligature-induced periodontitis, the periodontal bone supporting ratio was significantly higher in the ligature-plus-paeonol groups compared to that of the ligature group, although they were still less than those in the non-ligature group. By micro-CT and by histology/histometry, a consistent anti-destructive effect was observed when paeonol was added. Moreover, less amount of inflammatory cell-infiltrated connective tissue area, connective tissue attachment and mRNA expressions of pro-inflammatory cytokines were presented in the ligature-plus-paeonol groups than those in the ligature group. These results suggested paeonol might have a protective potential on gingival tissue inflammation and alveolar bone loss during the process of periodontitis by inhibiting pro-inflammatory cytokines.

(3)

Introduction

Periodontal disease is an inflammation-associated disease and bacterial plaque is the primary etiology. The periodontal pathogens, as well as their products, can induce inflammatory cell infiltration, edema and vascular dilatation in inflamed periodontal tissues . This inflammatory reaction may damage surrounding cells and connective tissue structures, including the alveolar bone, and eventually causes tooth loss . However, a complex interaction among various inflammatory mediators and tissue modeling are involved in this pathogenic mechanism of periodontitis. Lipopolysaccharide (LPS) is a major component of the outer membrane of gram-negative bacteria and can elicit strong immune responses. Studies have shown that LPS can penetrate gingival connective tissue and induce local inflammatory responses that lead to periodontal bone resorption . Therefore, the injection of bacterial toxins has been commonly used to induce an experimental periodontitis in vivo . Periodontal destruction has also been successfully induced in animals by other modalities e.g. dietary manipulation , introduction of pathogenic microorganisms , and placement of a ligature that acts as a site for bacterial colonization .

Paeonol, 2′-hydroxy-4′-methoxyacetophenone, is a major phenolic compound of Moutan Cortex, the root bark of Paeonia moutan Sims (Paeonia suffruticosa Andrews) . Paeonol is commonly known as an important component in traditional Chinese medicine. Paeonol has been known as an antioxidant, anxiolytic-like and anti-inflammatory agent . Although the anti-anti-inflammatory effect of paeonol has been demonstrated both in vitro and in vivo , its effects on periodontal inflammation and destruction have never been examined. The present study was therefore designed to examine the effects of paeonol on the periodontal destruction and pro-inflammatory cytokine expressions by using two animal models of experimental periodontitis.

(4)

Materials and Methods Experimental Design

To evaluate the effect of paeonol on osteoclast formation induced by LPS, eighteen SD rats were randomly divided into three groups (control, LPS, and LPS-plus-paeonol) with six animals in each group, as described in our previous study . Briefly, the rats in the LPS group received 5 mg/mL of LPS 10uL (Escherichia coli Serotype 055:B5; Sigma Co.) injection daily at the right palatal gingiva around the first and second molars for 3 days. The animals in the control group were received daily phosphate buffered saline (PBS) injections. The rats in the LPS-plus-paeonol group not only received LPS as the LPS group but also had the intra-peritoneal injection of paeonol (40 mg/kg body weight; Alfa Aesar) dissolved in dimethyl sulfoxide (DMSO; Mallinckrodt Baker) 1 day before the start of the experiment . All animals were sacrificed on day 5th and the palatal specimens were taken and prepared for histology.

The inhibitory effect of paeonol on the dental alveolar bony destruction was further examined in an experimental periodontitis induced by placing silk-ligature around molars of rats. Thirty-six male SD rats were randomly divided into four groups. The rats in the non-ligature group received no ligature, whereas the 3-O silk (surgical silk sutures; UNIK) were wrapped bilaterally around the cervical margins of maxillary second and mandibular first molars in the ligature group. The rats in these two groups received the intra-peritoneal injection of were fed daily with dimethyl sulfoxide (DMSO), a solvent of paeonol. The rats in the ligature-plus-paeonol groups were given with the same silk ligatures as rats in the ligature group, but they also received daily doses of paeonol (40 or 80 mg/kg in DMSO) from 1 day before the ligation. On day 8th, all animals were sacrificed by carbon dioxide inhalation. The

(5)

gingival specimens around the maxillary 2nd and the mandibular 1st molars were taken and stored to determine the mRNA expressions of specific inflammatory cytokines. The remained specimens were then fixed in 4% paraformaldehyde and prepared for dental radiography, micro computerized tomography (micro-CT) or histology. In the present study, all animals were kept in a specific pathogen free facility and handled according to the protocols approved by Institutional Animal Care and Use Committee, National Defense Medical Center, Taipei, Taiwan.

Dental Radiography

In this study, the first mandible molars were selected to determine the bone loss examined by radiography as previous studies did . In brief, the standardized digital radiographs were obtained with the use of a computerized imaging system that utilizes an electronic sensor instead of x-ray film. Electronic sensors were exposed at 65 KV and 10 mA with the time of exposition at 12 impulses per second. The source-to-film distance was always set at 50 cm. The distance between the cemento-enamel junction (CEJ) and the crest of alveolar bone was determined from the mesial root surfaces of the right and left first molars with the aid of the software (Figure 1). Moreover, the periodontal bone support ratio (PBSr) was measured on the same images. Along the long axis of the distal roots of the molars, three points were taken as references: the apex of the distal root (A), the distal cusp tip (C) and the bottom of the deepest bony defect distal to the tooth (B). Afterwards the distances from apex to cusp tip (AC) and to deepest bone defect (AB) were measured in mm. Periodontal bone supporting ratio was determined by the formula: PBSr = AB/AC x100.

Micro Computed Tomography Imaging

(6)

periodontitis were scanned for micro-CT imaging with a high resolution in vivo micro-CT scanner (Skyscan1076 micro-CT system; SkyScan, Aartselaar, Belgium). The tube was operated at an accelerated potential of 50 kVp with a beam current of 200 μA for 460 ms, with an image pixel size of 18 μm and an 0.8 degree rotation step. All data were collected and reconstructed with medical image processing software (Medical image illustrator, Visualization and Interactive Media Laboratory of National Center for High-performance Computing, Taipei, Taiwan). This enabled us to observe the 3D morphology around the tooth and dental alveolar bone in all directions and dimensions, including the CEJ, root surface and dental alveolar crest, as well as the relationships between these areas. The distance between the CEJ and the coronal level of the alveolar bone crests were recorded at 4 sites (i.e. mesio-buccal, disto-mesio-buccal, mesio-palatal, and disto-palatal) around maxillary second and mandibular first molars bilaterally, on the reconstructed three-dimensional micro-CT images .

Histology and Histometry:

After the scanning of micro-computed tomography, the maxillary specimens were prepared for histology. On the mesial surfaces of the maxillary second molars of each rat, the following histometric measurements were performed: the periodontal tissue loss (the attachment loss, i.e. the distance from CEJ to the most coronal level of epithelial cells), the histological distance from CEJ to bone, the surface area of inflammatory cell-infiltrated connective tissue (ICT area), and the length connective tissue attachment (i.e. the distance from the most apical level of epithelial cells to the alveolar bone crest). The surface area of ICT was performed in a zone of 0.14 mm2 of sub-epithelial gingiva on the mesial surface of the maxillary second molar of each rat as the previous studies did . The grid point intersection analysis was used to estimate

(7)

the areas of infiltrated and total connective tissue of inter-dental gingiva at 120X magnification.

Extraction of RNA and Reverse Transcription–Polymerase Chain Reaction: Total RNA was extracted from homogenized gingival tissue of rats. The RNA was reverse transcribed, and the PCR reactions included an initial denaturation at 94 ℃ for 2 min 30 s, followed by the denaturation cycles between 30 cycles for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and 35 cycles for others at 94 ℃ for 30 s, annealing at 58 - 60 ℃ for 30 s, and elongation at 72 ℃ for 55 s. The PCR primers used in the present study were as follows: interleukin (IL)-1β (Accession No.: M98820), TTCATCTCGAAGCCTGCAGTG -3’ and 5’-GACCTGTTCTTTGAGGCTGAC-3; tumor necrosis factor (TNF)-α (Accession No.:

AY427675), 5’-GCCACTACTTCAGCATCTCG-3’ and

AGTCTTCCAGCTGGAGAAGC-3’; IL-6 (Accession No.: M26745),

5’-TAGCCACTCCTTCTGTGACTCTAACT-3’ and

5’-GACTGATGTTGTTGACAGCCACTGC -3’; and GAPDH (Accession No.:

NM_017008), 5’-TGCTGGTGCTGAGTATGTCG-3’ and

5’-ATTGAGAGCAATGCCAGCC-3’. Amplified RT-PCR products were then analyzed on a 1% agarose gel and visualized with ethidium bromide staining using a camera system (Transilluminator/SPOT; Diagnostic Instruments). The gel images were directly scanned (ONE-Dscan 1-D Gel Analysis Software; Scanalytic Inc.), and the relative intensities were obtained by determining the ratio of the signal intensity relative to that of the GAPDH band.

Statistical Analysis:

One-way ANOVA with Duncan’s test as post hoc analysis was used to determine the effect of LPS on osteoclast formation, and the effects of paeonol on the induced

(8)

osteoclast formation. The one-way ANOVA was also used to examine the effect of paeonol on the ligature-induced radiographic bone loss and histometric measurements. Repeated-measures analysis of variance was used to evaluate the effect of paeonol or ligature treatment (the between-subject factor), as well as the effects of anatomic location (e.g. maxillary vs. mandibular molars, right vs. left side, or buccal vs. palatal/lingual) (the within-subject factors) on the tomographic distance from CEJ to bone. P < 0.05 was considered as significant.

(9)

Results

Generally speaking, small amount of active osteoblasts with osteoids underneath were observed on the bony surfaces of the control rats (Figure 2, left histograms). Osteoclasts with resorptive lacunae were easily observed in the alveolus treating with LPS (Figure 2, center histograms), whereas the number of osteoclasts was reduced in the group treating with LPS and paeonol (Figure 2, right histograms). The number of osteoclast was significantly increased in the LPS group, compared to the control, but significantly reduced in LPS-plus-paeonol group, compared to LPS group, although it was still higher than that in control group. The nucleus numbers of osteoclast were statistically similar among the three animal groups (Figure 2, lower plots).

For the experiment of the ligature-induced periodontitis, the periodontal bone supporting ratio by radiography was significantly decreased in the ligature group when compared with that of the non-ligature group on both right and left jaws (Figure 3A). However, the ratios were rebounded in the ligature-plus-paeonol groups, although they were still less than those in the non-ligature group. The radiographic distances from enamel to bone, which indicate periodontal bone loss, presented with an opposite result: the distance was increased in the ligature group, but reduced in ligature-plus-paeonol groups (Figure 3B).

By micro-CT, the alveolar bone crests could be identified and measured easily (Figure 4). Consistent findings were also observed in the tomographic distance from CEJ to bone. The distance was significantly increased in the ligature group when compared with that of the non-ligature group but reduced again in the ligature-plus-paeonol groups, and the distances were not different between the right and left, the maxilla and mandible, the buccal and lingual surfaces, and the mesial and distal surfaces (Figure 4).

(10)

observed in the ligature group (Figure 5); however, the inflammation and destruction was significantly less in animals received paeonol. The histometric measurements, including periodontal tissue loss, histological distance from CEJ to bone, ICT surface area, and connective tissue attachment, were significantly different among the four animal groups. Post-hoc analysis revealed that the periodontal tissue loss was significantly increased in the ligature group if compared with that in the non-ligature group; however, the increased tissue loss was significantly reduced in the paeonol-plus-ligature groups. Consistent pattern was again observed in the other three histometric measurements, including the histological distance from CEJ to bone, the ICT surface area, and the connective tissue attachment (Figure 5).

The mRNA expressions of cytokines of IL-1β, TNF-α and IL-6 in gingiva among different animal groups also demonstrated a consistent pattern with the expressions significantly increased in the ligature group if compared with those in the non-ligature group, but the increased expressions was reduced in the paeonol-plus-ligature groups (Figure 6).

(11)

Discussion

In this study, the effects of paeonol on the periodontal destruction and inflammation were examined by using two experimental periodontitis models of rats. Our results illustrated a consistent ameliorative effect of paeonol on ligature- or LPS-induced periodontal destruction, bony loss, gingival inflammation, and cytokine responses. Various Chinese medicinal herbs have been shown to safely suppress pro-inflammatory pathways and possess anti-pro-inflammatory effects . A review study has demonstrated that a considerable number of Chinese medicinal herbs can perform dual roles on immunological regulation by activating and/or suppressing immune responses . A few different types of Chinese medicinal herbal composites have been selected for examining their inhibitory effects on periodontal pathogens and their therapeutic effects on periodontitis . However, the scientific evidence of applying paeonol in periodontal disease is still absent.

Periodontitis is an inflammation-associated disease and involves a complex mechanism associated with bacterial and immune modulations. The experimental periodontitis in animal models have been frequently used to overcome the limitations of clinical study; however, the experimental periodontitis in animals still have their own limitations . In the model of LPS injection, for instance, the endotoxin from bacteria is directly delivered into the tissue, and this direct delivery might have simplified the mechanisms of the disease . Whereas the periodontitis induced by ligature causes unnatural exaggerated plaque retention and trauma into the local gingival tissue . Nevertheless, by using LPS injection in the present study, osteoclasts in the resorptive pattern were largely observed on the surface of dental alveolar bone in rats received LPS, but a formative pattern was observed in rats did not receive LPS (Figure 2). The paeonol, on the other hand, could significantly inhibit the

(12)

LPS-induced osteoclast formation. Similarly, paeonol prevented the ovariectomy-LPS-induced bone loss was recently demonstrated in an animal study . Because paeonol further in vitro inhibited the induced osteoclast differentiation and the resorption activity of mature osteoclasts, the authors suggested that paeonol inhibited osteoclastogenesis, which in turn protect bone loss from ovariectomy.

For the experimental periodontitis with ligation, the periodontal destruction was induced around molars with silk ligature (Figures 3 to 5). The periodontal destruction and the dental alveolar bone resorption had been clearly demonstrated in many previous experiments . In the present study, we have successfully performed the ligature-induced periodontitis model and verified that paeonol could significantly ameliorate the periodontal destruction and inflammation in this model. In the present study, the effects of paeonol on the induced periodontal destruction were confirmed by dental radiography, micro-CT and histology. By using dental radiography, the quantitative measurements, including the bone supporting ratio and the distance from CEJ to bone, were recorded as the methods demonstrated in the previous study . Although dental radiograph can easily provide dimensional images of the bony structure around the tooth, the images by dental radiograph is two-dimensional. Detailed surface morphology for tooth or bone was easily observed by micro-CT, while the bone supporting ratio was merely evaluated by radiography. Nevertheless, consistent findings were observed by the two radiographic methods. Regrettably, the exact periodontal soft tissue changes could not be evaluated by the two methods, but only by histology (Figure 5).

By microscopy, the distance from CEJ to bone and the attachment loss were shown to be increased in the ligature group but that increase was inhibited in the ligature-plus-paeonol groups (Figure 3) to the levels similar to those results obtained

(13)

by dental radiography and micro-CT (Figures 3 to 4). In combined with the findings obtained from the LPS-induced osteoclast formation, all of our current results indicated that paeonol might have an ameliorative effect on the dental alveolar bone destruction during the induced experimental periodontitis. Moreover, a significantly reduced ICT surface area was recorded in the ligature-plus-paeonol groups compared with the ligature group which might further imply an anti-inflammatory activity involved the amelioration. The detailed mechanism of the ameliorative effect of paeonol in the periodontal destruction is still uncertain. However, the induced local inflammation and tissue damage might be through the induction of proinflammatory cytokines, such as IL-1, TNF, or IL-6 (Figure 6). The protective and destruction roles of the pro-inflammatory cytokines against periodontal infection have been discussed . These cytokines may further induce the production of secondary mediators, resulting in an amplification of the inflammatory response and leading to the destruction of connective tissue and osteoclastic bone resorption . In the present study, nevertheless, the identification of the cell types at the site that are predominantly producing the pro-inflammatory cytokines was not performed. Further detailed evaluation is consequently needed.

Apart from the inhibitory effects of paeonol on cytokines in the present study, the anti-inflammatory activities from paeonol have been observed in vitro and in vivo in the literature. Orally administered paeonol has been shown to reduce the edema induced by arachidonic acid in rats, and prevent LPS induced iNOS, COX-2 and ERK activations in macrophages . The anti-inflammatory and analgesic effects of paeonol have also been examined in carrageenan-evoked thermal hyperalgesia in a paw model of rats. In that study, paeonol inhibited TNF-α, IL-1β and IL-6 formation, but enhanced IL-10 production in the rat paw exudates . Paeonol has also been shown to

(14)

inhibit the anaphylactic reaction by regulating histamine, IL-1β, and TNF-α . Recently, a strong bactericidal effect from paeonol has been assessed ; therefore, the direct effect of paeonol on the bacteria at the sites with periodontitis should also be carefully evaluated. These limited findings in the current literature all support and are consistent with the discovery in the present study.

Paeonol is commonly known as an important compound in traditional Chinese medicine. Paeonol has been thought to be a candidate for preventing various diseases because of the thriving discoveries of its therapeutic biological effects. Here, we provide an in vivo evidence illustrating that paeonol may have a preventive potential in periodontitis.

In conclusion, the present in vivo experiments provided an evidence that paeonol partially prevented the LPS-induced osteoclast formation on dental alveolar bony surface and the ligature-induced periodontal alveolar bone loss in rats. Moreover, in the animal model of ligature-induced experimental periodontitis, paeonol ameliorated the enhanced gingival tissue inflammation (the ICT areas) and pro-inflammatory cytokine elevations. Therefore, we suggested that paeonol might have preventive potential on the gingival tissue inflammation and the dental alveolar bone loss during the process of periodontitis.

Acknowledgements

This study was partially supported by the research grants from Tri-Service General Hospital (TSGH-C98-111), Taipei, Taiwan, Republic of China.

Conflict of Interest

(15)

References

Botelho, M. A., J. G. Martins, R. S. Ruela, R. I, J. A. Santos, J. B. Soares, M. C. Franca, D. Montenegro, W. S. Ruela, L. P. Barros, D. B. Queiroz, R. S. Araujo and F. C. Sampio. Protective effect of locally applied carvacrol gel on ligature-induced periodontitis in rats: a tapping mode AFM study. Phytother Res 23(10): 1439-1448, 2009.

Cai, X., C. Li, G. Du and Z. Cao. Protective effects of baicalin on ligature-induced periodontitis in rats. J Periodontal Res 43(1): 14-21, 2008.

Chae, H. S., O. H. Kang, Y. S. Lee, J. G. Choi, Y. C. Oh, H. J. Jang, M. S. Kim, J. H. Kim, S. I. Jeong and D. Y. Kwon. Inhibition of LPS-induced iNOS, COX-2 and inflammatory mediator expression by paeonol through the MAPKs inactivation in RAW 264.7 cells. Am J Chin Med 37(1): 181-194, 2009.

Chan, Y., C. H. Lai, H. W. Yang, Y. Y. Lin and C. H. Chan. The evaluation of Chinese herbal medicine effectiveness on periodontal pathogens. Am J Chin Med 31(5): 751-761, 2003.

Chang, B., Y. Lee, Y. Ku, K. Bae and C. Chung. Antimicrobial activity of magnolol and honokiol against periodontopathic microorganisms. Planta medica 64(4): 367-369, 1998.

Cheng, W. C., R. Y. Huang, C. Y. Chiang, J. K. Chen, C. H. Liu, C. L. Chu and E. Fu. Ameliorative effect of quercetin on the destruction caused by experimental periodontitis in rats. J Periodontal Res 45(6): 788-795, 2010.

Chou, T. C. Anti-inflammatory and analgesic effects of paeonol in carrageenan-evoked thermal hyperalgesia. Br J Pharmacol 139(6): 1146-1152, 2003.

Cyong, J. and Y. Otsuka. A pharmacological study of the anti-inflammatory activity of Chinese herbs. A review. Acupunct Electrother Res 7(2-3): 173-202, 1982. de Souza, D. M., L. H. Ricardo, A. Prado Mde, A. Prado Fde and R. F. da Rocha. The

effect of alcohol consumption on periodontal bone support in experimental periodontitis in rats. J Appl Oral Sci 14(6): 443-447, 2006.

Fiehn, N. E., B. Klausen and R. T. Evans. Periodontal bone loss in Porphyromonas gingivalis-infected specific pathogen-free rats after preinoculation with endogenous Streptococcus sanguis. J Periodontal Res 27(6): 609-614, 1992. Garcia de Aquino, S., F. R. Manzolli Leite, D. R. Stach-Machado, J. A. Francisco da

Silva, L. C. Spolidorio and C. Rossa, Jr. Signaling pathways associated with the expression of inflammatory mediators activated during the course of two models of experimental periodontitis. Life Sci 84(21-22): 745-754, 2009.

Graves, D. T. and D. Cochran. The contribution of interleukin-1 and tumor necrosis factor to periodontal tissue destruction. J Periodontol 74(3): 391-401, 2003. Graves, D. T., D. Fine, Y. T. Teng, T. E. Van Dyke and G. Hajishengallis. The use of

(16)

rodent models to investigate host-bacteria interactions related to periodontal diseases. J Clin Periodontol 35(2): 89-105, 2008.

Holzhausen, M., C. Rossa Junior, E. Marcantonio Junior, P. O. Nassar, D. M. Spolidorio and L. C. Spolidorio. Effect of selective cyclooxygenase-2 inhibition on the development of ligature-induced periodontitis in rats. J Periodontol 73(9): 1030-1036, 2002.

Huang, H., E. J. Chang, Y. Lee, J. S. Kim, S. S. Kang and H. H. Kim. A genome-wide microarray analysis reveals anti-inflammatory target genes of paeonol in macrophages. Inflamm Res 57(4): 189-198, 2008.

Kim, S. A., H. J. Lee, K. S. Ahn, E. O. Lee, S. H. Choi, S. J. Jung, J. Y. Kim, N. Baek and S. H. Kim. Paeonol exerts anti-angiogenic and anti-metastatic activities through downmodulation of Akt activation and inactivation of matrix metalloproteinases. Biol Pharm Bull 32(7): 1142-1147, 2009.

Kim, S. H., S. A. Kim, M. K. Park, Y. D. Park, H. J. Na, H. M. Kim, M. K. Shin and K. S. Ahn. Paeonol inhibits anaphylactic reaction by regulating histamine and TNF-alpha. Int Immunopharmacol 4(2): 279-287, 2004.

Li, C. H. and S. Amar. Morphometric, histomorphometric, and microcomputed tomographic analysis of periodontal inflammatory lesions in a murine model. J Periodontol 78(6): 1120-1128, 2007.

Li, H., M. Dai and W. Jia. Paeonol attenuates high-fat-diet-induced atherosclerosis in rabbits by anti-inflammatory activity. Planta medica 75(1): 7-11, 2009.

Lindhe, J. and S. Nyman. Clinical trials in periodontal therapy. J Periodontal Res 22(3): 217-221, 1987.

Listgarten, M. A. Nature of periodontal diseases: pathogenic mechanisms. J Periodontal Res 22(3): 172-178, 1987.

Liu, Y. C., U. H. Lerner and Y. T. Teng. Cytokine responses against periodontal infection: protective and destructive roles. Periodontol 2000 52(1): 163-206, 2010.

Lohinai, Z., P. Benedek, E. Feher, A. Gyorfi, L. Rosivall, A. Fazekas, A. L. Salzman and C. Szabo. Protective effects of mercaptoethylguanidine, a selective inhibitor of inducible nitric oxide synthase, in ligature-induced periodontitis in the rat. Br J Pharmacol 123(3): 353-360, 1998.

Mi, X. J., S. W. Chen, W. J. Wang, R. Wang, Y. J. Zhang, W. J. Li and Y. L. Li. Anxiolytic-like effect of paeonol in mice. Pharmacol Biochem Behav 81(3): 683-687, 2005.

Mimura, K. and S. Baba. Studies on the biotransformation of paeonol by means of isotope tracer techniques.--Synthesis and physicochemical properties of carbon-13 and deuterium labeled compounds. Radioisotopes 28(12): 739-744, 1979.

(17)

Ngan, L. T., J. K. Moon, T. Shibamoto and Y. J. Ahn. Growth-inhibiting, bactericidal, and urease inhibitory effects of Paeonia lactiflora root constituents and related compounds on antibiotic-susceptible and -resistant strains of Helicobacter pylori. Journal of agricultural and food chemistry 60(36): 9062-9073, 2012. Okubo, T., F. Nagai, T. Seto, K. Satoh, K. Ushiyama and I. Kano. The inhibition of

phenylhydroquinone-induced oxidative DNA cleavage by constituents of Moutan Cortex and Paeoniae Radix. Biol Pharm Bull 23(2): 199-203, 2000. Page, R. C. The role of inflammatory mediators in the pathogenesis of periodontal

disease. J Periodontal Res 26(3 Pt 2): 230-242, 1991.

Robinson, M., D. Hart and G. H. Pigott. The effects of diet on the incidence of periodontitis in rats. Lab Anim 25(3): 247-253, 1991.

Rotelli, A. E., T. Guardia, A. O. Juarez, N. E. de la Rocha and L. E. Pelzer. Comparative study of flavonoids in experimental models of inflammation. Pharmacol Res 48(6): 601-606, 2003.

Schwartz, J., F. L. Stinson and R. B. Parker. The passage of tritiated bacterial endotoxin across intact gingival crevicular epithelium. J Periodontol 43(5): 270-276, 1972.

Tsai, H. Y., H. Y. Lin, Y. C. Fong, J. B. Wu, Y. F. Chen, M. Tsuzuki and C. H. Tang. Paeonol inhibits RANKL-induced osteoclastogenesis by inhibiting ERK, p38 and NF-kappaB pathway. European journal of pharmacology 588(1): 124-133, 2008.

Wong, R. W., U. Hagg, L. Samaranayake, M. K. Yuen, C. J. Seneviratne and R. Kao. Antimicrobial activity of Chinese medicine herbs against common bacteria in oral biofilm. A pilot study. Int J Oral Maxillofac Surg 39(6): 599-605, 2010.

(18)

Legends for Figures

Figure 1. The periodontal or dental alveolar bony loss measured by dental radiography. The radiographic film on left presents the shadow of the rat hemi-mandible, as well as the molars in the jaw. The right image, the high magnification of the radiography, presents the measurements of the ratio of periodontal bone supporting (PBSr) and the distance from the cemento-enamel junction (CEJ, arrow) to the most coronal level of alveolar bone (arrowhead) at the distal and mesial root surfaced of first mandibular molar, respectively. (Abbreviations in radiography: A, the root apex; B’, the deepest bony defect; B-B’, the level of deepest bony defect; C, the cusp tip; PBSr = the distance of AB/the distance of AC ×100%)

Figure 2. Effect of paeonol on LPS-induced periodontitis on palatal surface of molars. The upper histographs present the palatal histology of rats in PBS, LPS (5 μg/mL) and LPS-plus-paeonol groups (5μg/mL LPS and 40mg/kg paeonol). The lower plots show that the histometric comparison of the number of osteoclast and the nucleus number per ostoclast among the three animal groups. (TRAP staining, magnification  40 and  200 for the first and second rows, respectively; arrowheads indicate the bony surfaces of dental alveoli and arrow points out an osteoclast within the lacuna) (n = 5; *p < 0.05)

Figure 3. The effect of paeonol on the ligature-induced bone loss around the

mandibular first molars examined by digital dental radiography. The bone loss

was determined by the ratio ofperiodontal bone support (PBSr) (A) and by the radiographic distance from CEJ to bone (B). On the right and left first mandibular molars, the ratio was calculated along the long axis of distal root and the distance was recorded on the mesial surfaces of the root, respectively. (a-c: subgroups by post-hoc analysis, if significant difference obtained with the repeated measures analysis of variance at p < 0.05)

Figure 4. The effect of paeonol on the ligature-induced bone loss examined by micro-CT. Upper images present the reconstructed 3-dimensional morphology of the maxillary and mandibular molars. The tomographic distances from CEJ to bone were recorded at 4 sites of earh first molars on the right and left jaws, including the mesio- and disto-buccal, and the mesio- and disto-palatal sites. The lower plot showed the effects of paeonol on the distances between CEJ and bone crest were analyzed among

(19)

four animal groups using the repeated measures analysis of variance. (N-L: non-ligature group, Lig: non-ligature group, L+P40: the group of non-ligature plus 40mg/kg paeonol, and L+P80: the group of ligature plus 80mg/kg paeonol) (*: significant difference at p < 0.05 by the repeated measures analysis of variance; a-c: subgroups by post-hoc analysis, if significant difference obtained)

Figure 5. Histological observations and histometric measurements of the maxillary interdental tissue in four animal groups. Histographs present the inter-proximal periodontal tissue between the maxillary first and second molars of rats from the non-ligature, the ligature (Lig) and the two Lig+paeonol groups, with the daily dose of 40 or 80 mg/kg paeonol (H & E stain, 40X). Arrows indicate the level of cemento-enamel junction (CEJ) and arrowheads indicate the most coronal level of alveolar bone crest (ABC). The histolographs at higher magnifications (200X) are shown in the second row. The lower plots demonstrate the comparisons of histometric measurements, including the periodontal tissue loss, the histological bone level (distance from enamel to bone), the connect tissue attachment, and the gingival tissue inflammation among the animal groups. (JEc: the most coronal level of epithelial cells, JEa: the most apical level of epithelial cells, ICT area: the surface area of inflammatory cell-infiltrated connective tissue) (a-c: subgroups by One-way ANOVA and Duncan post-hoc, at p < 0.05)

Figure 6. The effect of paeonol on the gingival mRNA expression of

pro-inflammatory cytokines. The upper left illustrates the representative gel images of mRNA expressions of IL-1ß , TNFα , IL-6, and GAPDH. The quantitative

comparisons of the relative intensities (to GAPDH) of mRNA expression of the pro-inflammatory cytokines in 4 groups were presented in the three drew plots. (a-c: subgroups by One-way ANOVA and Duncan post-hoc, at p < 0.05)

參考文獻

相關文件

- The hypothesis of heterotopia may explain the origin of salivary tissue in parotideal lymph nodes, in the periparotideal region and the upper neck, but fails to

Its main tool is the stem cells that are seeded on the surface of biomaterials (scaffolds), in order to create a biocom- plex. Several populations of mesenchymal stem cells are found

Histologically VX is distinguished from other lesions by presence of large numbers of foam cells, and limited to the connective tissue papillae.. The foam cells on

According to animal models, the typical patho- logical feature of fibrous ankylosis is abundant fibrous connective tissue occupying the joint space with or with- out cartilage on

Histopathological examination of our case showed islands of basophilic mature cartilage in a dense fibrous connective tissue stroma with focal collection of chronic inflammatory

In this report, we describe a rare case of bilateral symmetric ectopic oral tonsillar tissue located at the ventral surface of the tongue along with two solitary cases arising from

Here we report a rare case of bilateral symmetric ectopic oral tonsillar tissue observed on the ventral surface of the tongue and two other solitary cases arising from floor of

Winnick, “Salivary gland inclusion in the anterior mandible: report of a case with a review of the literature on aberrant salivary gland tissue and neoplasms,” Oral Surgery,